CN107304433A - A kind of recombination bacillary viral vector of anti-apoptotic and preparation method thereof - Google Patents
A kind of recombination bacillary viral vector of anti-apoptotic and preparation method thereof Download PDFInfo
- Publication number
- CN107304433A CN107304433A CN201610257513.XA CN201610257513A CN107304433A CN 107304433 A CN107304433 A CN 107304433A CN 201610257513 A CN201610257513 A CN 201610257513A CN 107304433 A CN107304433 A CN 107304433A
- Authority
- CN
- China
- Prior art keywords
- viral vector
- expression
- apoptotic
- bacillary viral
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/14011—Baculoviridae
- C12N2710/14041—Use of virus, viral particle or viral elements as a vector
- C12N2710/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vectore
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of preparation method of the recombination bacillary viral vector of anti-apoptotic, the gene and regulating and controlling sequence of the tiny RNAs expressed of interference insect cell caspase 1 are knocked on bacillary viral vector skeleton, the recombination bacillary viral vector of infection cell survival period can be extended by producing.The restructuring Bacmid that the present invention is obtained, can be as viral vector, the recombinant baculovirus for construction expression foreign gene.After the recombinate shape virus infection insect cell obtained, virus titer can be significantly improved, and the time of exogenous protein expression can be extended to after infection 56 days.The baculovirus vector that the present invention is obtained can be directly used for optimizing baculoviral/insect cell expression system, can reduce the cost of virus production by the raising of virus titer, the expression of foreign protein can be improved by extending expression time.There is good application prospect in the protein expression of eukaryotic source, available for basic research, it can also be used to the production of protein drug and vaccine.
Description
Technical field：
The invention belongs to baculovirus vector and its preparation side in viral vector technology field, more particularly to a kind of anti-apoptotic
Method.
Background technology：
Baculoviral is the DNA virus of specific infection arthropod, autographa california multiple nuclear polyhedrosis virus（AcMNPV）
It is a type sepecies for baculoviral.Since baculoviral is transformed into expression system by nineteen eighty-three Smith etc. first, by
There is low cost, high yield in the system, and expression protein conformation close to natural eukaryotic protein, baculoviral table
It is widely used up to system in research and production.
Baculovirus expression system is a kind of transient expression system, and viral infected insect cell can cause cell after 3-4 days
Apoptosis and death.The Time limit of expression of baculovirus expression system based on late promoter is to open for 22-24 hours after infection
Begin dead to host cell.If the death time of infection cell can be postponed, the yield of foreign protein certainly will can be increased.Study table
Bright, p10 is relevant with the cracking of host cell.The baculovirus vector of some commercializations deletes p10 genes, significantly improves sense
The survival rate of cell is contaminated, so as to improve foreign protein yield.Another trial is by the vankyrin genes of polymorphic DNA virus
It is inserted into Baculovirus Gene group DNA, the vankyrin expressed in right amount can extend the survival period of infection cell, equally also reach
The purpose for improving foreign protein yield is arrived.
Apoptosis is a kind of programmed death process of cell, wherein cell regulation and control caspase activity on cell apoptosis
It is extremely important.And Spodopterafrugiperda（Spodoptera frugiperda）The caspase of current most study is to perform in cell
Caspase is Sf-caspase-1.2007, Sf- expressed with rna interference vector in Sf9 cells in a seminar in Taiwan
Sf-caspase-1 in caspase-1 dsRNA, success silence cell, the thin of Sf9 Apoptosis is suppressed so as to filter out
Born of the same parents system（Lin C C, Hsu J T A, Huang K L, et al. Sf‐Caspase‐1‐repressed stable
cells: resistance to apoptosis and augmentation of recombinant protein
production[J]. Biotechnology and applied biochemistry, 2007, 48(1): 11-19.）.
The present invention is based on these research backgrounds, gene and regulation and control the interference insect cell caspase-1 tiny RNAs expressed
Sequence is knocked on bacillary viral vector skeleton, and the recombination bacillary viral vector of infection cell survival period can be extended by having produced.
The content of the invention：
In view of the above-mentioned problems, the purpose of the embodiment of the present invention is the baculovirus vector and its system for providing a kind of anti-apoptotic
Preparation Method.
The embodiment of the present invention is achieved in that a kind of preparation method of the baculovirus vector of anti-apoptotic, the system
Preparation Method comprises the following steps：
Expand and clone U6 promoters, construction of expression vector pTriExU6；
Design shRNA1, shRNA2 and shRNA3, synthetic primer；
The method expanded with primer obtains shRNA genetic fragment；
By shRNA gene fragment clone to expression vector, expression plasmid is obtained；
With the counter-selection fragment of PCR method amplified band U6-shRNA genes；
By counter-selection fragment and AcMNPV BacmidKOchiACotransformation is screened to the Escherichia coli HS996 bacterial strains containing pRed/ET
BacmidU6-shRNA；
The correctness of sequence verification recombinant viral vector.
Concrete operation step, with reference first in NCBIHomo sapiens clone phU6A U6 small nuclear
RNA, promoter region（Sequence number 57232342）Primers, PCR amplifications obtain the DNA pieces of U6 promoters
Between section, two sites of SacII and pstI of double digestion rear clone to pTriEx, expression vector pTriExU6 is obtained.
According toSpodoptera frugiperdaCaspase-1 mRNA sequences（Sequence number 1814278）, design three sections
Interference caspase-1 expression MicroRNA gene sequence be：
shRNA1（SEQ ID NO.1）: GCTAGGATGCCAGTTGATAGATTAATAAGCTCTATCAACTGGCATCCTAGCA
AAAA
shRNA2（SEQ ID NO.2）: GCTGTATGCCAAAGATACTCATTAATAAGCTGAGTATCTTTGGCATACAGCA
AAAA
shRNA3（SEQ ID NO.3）: GCTAGACTTTGAGTCTAATGCTTAATAAGCGCATTAGACTCAAAGTCTAGCA
AAAA
Primer is designed, with PCR method by the primer extension amplification of two sections of partial complementarities, by above-mentioned three sections of shRNA genetic fragment
It is cloned into respectively between pTriExU6 pstI and XbaI sites, obtains shRNA expression plasmid.
Further, while shRNA gene fragment amplifications U6 promoters connected with PCR method, add ChiA bases
Because of the homology arm of insertion point, counter-selection fragment is obtained.
Further, by counter-selection fragment and AcMNPV BacmidKOchiACotransformation is to the Escherichia coli HS996 containing pRed/ET
Bacterial strain, the Bacmid of homologous recombination is screened by streptomycin resistance.
Further, the restructuring Bacmid that extraction purification screening is obtained, carries out sequencing identification.
The restructuring Bacmid that the present invention is obtained, can be as viral vector, and the restructuring for construction expression foreign gene is shaft-like
Virus.Because carrying the RNA interfering gene for suppressing insect cell apoptosis, the recombinate shape virus infection obtained in viral vector
After insect cell, insect cell lesion speed and degree reduction, obtain baculoviral titre significantly improve, protein expression when
Between can extend to infection after 5-6 days.The baculovirus vector that the present invention is obtained can be directly used for optimizing baculoviral/insect cell
Expression system, can reduce the cost of virus production by the raising of virus titer, external source egg can be improved by extending expression time
White expression.There is good application prospect in the protein expression of eukaryotic source, available for basic research, it can also be used to egg
The production of baiyao thing and vaccine.
Brief description of the drawings：
The construction strategy for the recombination bacillary viral vector that Fig. 1 present invention is provided；
After Fig. 2 is using the recombinate shape virus infection cell of the invention provided, the detection of Apoptosis situation；
The titer determination of the recombinant virus of expression luciferase prepared by the recombination bacillary viral vector that Fig. 3 is provided using the present invention
As a result；
The testing result for the recombination bacillary viral vector luciferase that Fig. 4 is provided using the present invention；
The recombination bacillary viral vector that Fig. 5 is provided using the present invention expresses the result of two kinds of cell proteins.
Embodiment：
In order to make the purpose , technical scheme and advantage of the present invention be clearer, with reference to embodiments, to present invention progress
It is further described.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not used to limit
The present invention.
Embodiment 1：A kind of preparation method of the baculovirus vector of anti-apoptotic, the preparation method includes following step
Suddenly：
Expand and clone U6 promoters, construction of expression vector pTriExU6；
Design shRNA1, shRNA2 and shRNA3, synthetic primer；
The method expanded with primer obtains shRNA genetic fragment；
By shRNA gene fragment clone to expression vector, expression plasmid is obtained；
With the counter-selection fragment of PCR method amplified band U6-shRNA genes；
By counter-selection fragment and AcMNPV BacmidKOchiACotransformation is screened to the Escherichia coli HS996 bacterial strains containing pRed/ET
BacmidU6-shRNA；
The correctness of sequence verification recombinant viral vector.
Concrete operation step, with reference first in NCBIHomo sapiens clone phU6A U6 small nuclear
RNA, promoter region（Sequence number 57232342）Primers, PCR amplifications obtain the DNA pieces of U6 promoters
Between section, two sites of SacII and pstI of double digestion rear clone to pTriEx, expression vector pTriExU6 is obtained.
According toSpodoptera frugiperdaCaspase-1 mRNA sequences（Sequence number 1814278）, design three sections
Interference caspase-1 expression MicroRNA gene sequence be：
shRNA1: GCTAGGATGCCAGTTGATAGATTAATAAGCTCTATCAACTGGCATCCTAGCAAAAA
shRNA2: GCTGTATGCCAAAGATACTCATTAATAAGCTGAGTATCTTTGGCATACAGCAAAAA
shRNA3: GCTAGACTTTGAGTCTAATGCTTAATAAGCGCATTAGACTCAAAGTCTAGCAAAAA
Primer is designed, with PCR method by the primer extension amplification of two sections of partial complementarities, by above-mentioned three sections of shRNA genetic fragment
It is cloned into respectively between pTriExU6 pstI and XbaI sites, obtains shRNA expression plasmid.
Further, while shRNA gene fragment amplifications U6 promoters connected with PCR method, add ChiA bases
Because of the homology arm of insertion point, counter-selection fragment is obtained.
Further, by counter-selection fragment and AcMNPV BacmidKOchiACotransformation is to the Escherichia coli HS996 containing pRed/ET
Bacterial strain, the Bacmid of homologous recombination is screened by streptomycin resistance.
Further, the restructuring Bacmid that extraction purification screening is obtained, carries out sequencing identification.
Embodiment 2：Compliance test result
（1）Express the apoptosis situation detection of shRNA recombinant virus-infected cell
ShRNA1, shRNA2 and shRNA3 recombinant baculovirus are expressed after infection SF9 cells 3 days, with PI dyeing and streaming
The method detection Apoptosis degree of cell art.As shown in Figure 2, shRNA1, shRNA2 and shRNA3 restructuring disease are expressed
The fluorescence intensity of the cell of poison infection is substantially weaker than the cell that comparison virus infects, and illustrates shRNA1, shRNA2 and shRNA3
Expression can suppress the generation of Apoptosis caused by baculovirus infection.
（2）Express the titer determination of the recombinant virus of luciferase
With luciferase expression vector and the Bacmid cotransfection insect cells for carrying shRNA, obtain and express luciferase simultaneously
With the recombinant baculovirus for the shRNA for suppressing Apoptosis；Comparison virus is not with expressing shRNA Bacmid and luciferase table
Obtained up to carrier cotransfection.As shown in Figure 3, expression shRNA1, shRNA2 and shRNA3 recombinant virus is after infection 4 days
Virus titer is all significantly higher than comparison virus, illustrates that virus can be improved by extending viral infection time by suppressing Apoptosis
The level of propagation.
（3）The detection of luciferase expression
As shown in Figure 4, with after above-mentioned viral infected insect cell 4 days, luciferin is detected with Western blot method
The expression of enzyme.As a result show, expressing the infection of shRNA1, shRNA2 and shRNA3 recombinant virus all makes luciferase
Expression is raised, and illustrates that protein expression level can be improved by extending the exogenous protein expression time by suppressing Apoptosis.
（4）The detection of two kinds of cell protein expression levels
With two kinds of eukaryotic albumen（Albumin A is DUF, and protein B is GWRN）Expression vector is total to carrying shRNA1 Bacmid
Transfection insect cell, the recombinant baculovirus of both albumen of construction expression；Comparison virus is with the Bacmid for not expressing shRNA1
Obtained with corresponding expression vector cotransfection.Virus infection detects protein expression level after 4 days with Western blot method,
As a result（Accompanying drawing 5）Display two kinds of albumen expression in the repressed cell of apoptosis is obtained for raising.Wherein albumin A compares
It is unstable, easily it is degraded, expression is nearly no detectable in the cell that comparison virus infects, but in expression shRNA1 cell
Middle expression product accumulation level is obviously improved.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all essences in the present invention
Any modifications, equivalent substitutions and improvements made within refreshing and principle etc., should be included in the scope of the protection.
<110>Beijing health Bravilor bio tech ltd
<120>A kind of recombination bacillary viral vector of anti-apoptotic and preparation method thereof
<160> 3
<210> 1
<211> 56
<212> DNA
<213> Spodoptera frugiperda
<220>
<221>ShRNA1
<400> 1
GCTAGGATGCCAGTTGATAGATTAATAAGCTCTATCAACTGGCATCCTAGCAAAAA
<210> 2
<211> 56
<212> DNA
<213> Spodoptera frugiperda
<220>
<221>ShRNA2
<400> 2
GCTGTATGCCAAAGATACTCATTAATAAGCTGAGTATCTTTGGCATACAGCAAAAA
<210> 3
<211> 56
<212> DNA
<213> Spodoptera frugiperda
<220>
<221>ShRNA3
<400>3
GCTAGACTTTGAGTCTAATGCTTAATAAGCGCATTAGACTCAAAGTCTAGCAAAAA
Claims (9)
1. a kind of recombination bacillary viral vector of anti-apoptotic, the recombination bacillary viral vector is interference insect cell
The gene and regulating and controlling sequence of the tiny RNA of caspase-1 expression are knocked on bacillary viral vector skeleton, and that produces can extend sense
Contaminate the recombination bacillary viral vector of cell survival phase, it is characterised in that it is small that the interference insect cell caspase-1 is expressed
RNA gene is that sequence is that the shRNA2 and/or sequence that SEQ ID NO.1 shRNA1, sequence are SEQ ID NO.2 are SEQ
ID NO.3 shRNA3.
2. the recombination bacillary viral vector of anti-apoptotic according to claim 1, it is characterised in that described regulation and control sequence
Row are U6 promoter sequences.
3. a kind of preparation method of the recombination bacillary viral vector of anti-apoptotic, it is characterised in that the preparation method include with
Lower step：
(1) expand and clone U6 promoters, construction of expression vector pTriExU6；
(2) shRNA1, shRNA2 and shRNA3, synthetic primer are designed；
(3) method expanded with primer obtains shRNA genetic fragment；
(4) by shRNA gene fragment clone to expression vector, expression plasmid is obtained；
(5) with the counter-selection fragment of PCR method amplified band U6-shRNA genes；
(6) counter-selection fragment and AcMNPV Bacmid cotransformations are screened to the Escherichia coli HS996 bacterial strains containing pRed/ET
BacmidU6-shRNA；
(7) correctness of sequence verification recombinant viral vector.
4. the preparation method of the recombination bacillary viral vector of anti-apoptotic as claimed in claim 3, it is characterised in that design
The MicroRNA gene sequence of three sections of interference insect cell caspase-1 expression, the gene order of this three sections of RNA interferings is：
shRNA1:
GCTAGGATGCCAGTTGATAGATTAATAAGCTCTATCAACTGGCATCCTAGCAAAAA；
shRNA2:
GCTGTATGCCAAAGATACTCATTAATAAGCTGAGTATCTTTGGCATACAGCAAAAA；
shRNA3:
GCTAGACTTTGAGTCTAATGCTTAATAAGCGCATTAGACTCAAAGTCTAGCAAAAA。
5. the preparation method of the recombination bacillary viral vector of anti-apoptotic as claimed in claim 3, it is characterised in that select
The regulating and controlling sequence that the U6 promoters of people are expressed as shRNA.
6. the preparation method of the recombination bacillary viral vector of anti-apoptotic as claimed in claim 3, it is characterised in that use chain
The method of chloramphenicol resistance counter-selection, the MicroRNA gene sequence for suppressing caspase-1 expression is knocked in the skeleton of baculovirus vector
On.
7. a kind of recombination bacillary viral vector of anti-apoptotic, it is prepared into by the method for claim 3-6 any one
Arrive.
8. the recombination bacillary viral vector of the anti-apoptotic in claim 1-2 or 7 described in any one is outside construction expression
Application in the recombinant baculovirus of source gene.
9. the recombination bacillary viral vector of the anti-apoptotic in claim 1-2 or 7 described in any one in protein drug and
Application in production of vaccine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610257513.XA CN107304433A (en) | 2016-04-23 | 2016-04-23 | A kind of recombination bacillary viral vector of anti-apoptotic and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610257513.XA CN107304433A (en) | 2016-04-23 | 2016-04-23 | A kind of recombination bacillary viral vector of anti-apoptotic and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107304433A true CN107304433A (en) | 2017-10-31 |
Family
ID=60150279
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610257513.XA Pending CN107304433A (en) | 2016-04-23 | 2016-04-23 | A kind of recombination bacillary viral vector of anti-apoptotic and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107304433A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636207A (en) * | 2016-09-22 | 2017-05-10 | 西北农林科技大学 | Recombinant baculovirus vector resistant to host apoptosis |
| CN108728491A (en) * | 2018-06-21 | 2018-11-02 | 陕西杆粒生物科技有限公司 | A kind of wide spectrum anti-apoptotic rhabdovirus expression vector |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20150078237A (en) * | 2013-12-30 | 2015-07-08 | 대한민국(관리부서 질병관리본부장) | Antisense nucleotide against baculovirus |
| CN106636207A (en) * | 2016-09-22 | 2017-05-10 | 西北农林科技大学 | Recombinant baculovirus vector resistant to host apoptosis |
-
2016
- 2016-04-23 CN CN201610257513.XA patent/CN107304433A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20150078237A (en) * | 2013-12-30 | 2015-07-08 | 대한민국(관리부서 질병관리본부장) | Antisense nucleotide against baculovirus |
| CN106636207A (en) * | 2016-09-22 | 2017-05-10 | 西北农林科技大学 | Recombinant baculovirus vector resistant to host apoptosis |
Non-Patent Citations (1)
| Title |
|---|
| 欧艳梅: "抗宿主细胞凋亡策略以优化杆状病毒表达载体", 《中国优秀硕士学位论文全文数据库 基础科学辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636207A (en) * | 2016-09-22 | 2017-05-10 | 西北农林科技大学 | Recombinant baculovirus vector resistant to host apoptosis |
| CN108728491A (en) * | 2018-06-21 | 2018-11-02 | 陕西杆粒生物科技有限公司 | A kind of wide spectrum anti-apoptotic rhabdovirus expression vector |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Taning et al. | Engineered flock house virus for targeted gene suppression through RNAi in fruit flies (Drosophila melanogaster) in vitro and in vivo | |
| Franz et al. | Fitness impact and stability of a transgene conferring resistance to dengue-2 virus following introgression into a genetically diverse Aedes aegypti strain | |
| van Mierlo et al. | Novel Drosophila viruses encode host-specific suppressors of RNAi | |
| Chen et al. | Transgenic clustered regularly interspaced short palindromic repeat/Cas9-mediated viral gene targeting for antiviral therapy of Bombyx mori nucleopolyhedrovirus | |
| Johnson et al. | Densonucleosis viruses (‘densoviruses’) for mosquito and pathogen control | |
| Sagisaka et al. | Genome-wide analysis of host gene expression in the silkworm cells infected with Bombyx mori nucleopolyhedrovirus | |
| Zhu et al. | Genome sequence and analysis of Buzura suppressaria nucleopolyhedrovirus: a group II Alphabaculovirus | |
| CN1696294A (en) | High-performance bioreactor for baculovirus of insects | |
| Dong et al. | CRISPR/Cas9‐mediated disruption of the immediate early‐0 and 2 as a therapeutic approach to Bombyx mori nucleopolyhedrovirus in transgenic silkworm | |
| Wu et al. | The early gene hhi1 reactivates Heliothis zea nudivirus 1 in latently infected cells | |
| CN101914537B (en) | Bombyx mori nuclear polyhydrosis virus (BmNPV) 39k inducible promoter and application thereof | |
| Simón et al. | Expression of a peroral infection factor determines pathogenicity and population structure in an insect virus | |
| CN107304433A (en) | A kind of recombination bacillary viral vector of anti-apoptotic and preparation method thereof | |
| CN106636207A (en) | Recombinant baculovirus vector resistant to host apoptosis | |
| Clavijo et al. | Mixtures of complete and pif1-and pif2-deficient genotypes are required for increased potency of an insect nucleopolyhedrovirus | |
| Simón et al. | Deletion of egt is responsible for the fast-killing phenotype of natural deletion genotypes in a Spodoptera frugiperda multiple nucleopolyhedrovirus population | |
| JP2012501171A (en) | Insect-derived promoter for expression of foreign proteins in insect cells | |
| Ioannidis et al. | Bombyx mori nucleopolyhedrovirus lef8 gene: effects of deletion and implications for gene transduction applications | |
| CN103642807B (en) | Enhanced bombyx mori nuclear polyhedrosis virus inducible promoter En39k and application thereof | |
| CN102925484B (en) | Application and recombinant vector of bombyx mori nuclear polyhedrosis virus polygene inverted repeat sequence and bombyx mori lipase-1 gene | |
| Lai et al. | AcMNPV PKIP is associated with nucleocapsid of budded virions and involved in nucleocapsid assembly | |
| Kramer et al. | RNA interference as a metabolic engineering tool: potential for in vivo control of protein expression in an insect larval model | |
| Kim et al. | Metabolic engineering of the baculovirus‐expression system via inverse “shotgun” genomic analysis and RNA interference (dsRNA) increases product yield and cell longevity | |
| CN101285072A (en) | Process for enhancing gene level of expression of baculoviral expression carrier | |
| Li et al. | Common strategies in silkworm disease resistance breeding research |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20171031 |
|
| WD01 | Invention patent application deemed withdrawn after publication |