CN107281475A - A kind of gene vaccine for preventing and treating tumour and its production and use - Google Patents

Abstract

The invention discloses a kind of gene vaccine for preventing and treating tumour, the gene vaccine includes the recombination carrier for expression of eukaryon of carrier AFP genes, human IgG1 Fc fragment genes and people's CSF2 genes simultaneously.The gene vaccine can be used for Gene immunotherapy and the prevention of the diseases such as liver cancer, the immunoregulation effect of cell factor can be played, it can target again and produce specific immune response for diseases such as liver cancer, the number of components of vaccine is also reduced using the strategy of double gene coexpression.Result of the test shows that vaccine being capable of normal expression target gene in human archeocyte system, and can significantly inhibit the division growth of liver cancer cells under in vitro conditions in vitro.

Description

A kind of gene vaccine for preventing and treating tumour and its production and use

Technical field

The present invention relates to a kind of gene vaccine, more particularly to one kind can activate specific organism immune response and with prevention And treat design, the preparation method and applications of the gene vaccines of cancer effect such as liver cancer.

Background technology

Gene vaccine is a kind of new generation vaccine of eighties of last century appearance at the beginning of the nineties, refers to that use can express specific antigen The vaccine form for preparing of gene in itself, current gene vaccine is mainly the eukaryon expression plasmid DNA containing antigen gene.Base Because vaccine has had been obtained for quick and significant progress since the appearance, its application is extended to from infectiousness and preventative vaccine NCD and therapeutic vaccine field, including diabetes and oncotherapy etc..Compared with traditional vaccine, gene vaccine Large-scale production can be industrialized, with vaccine purity is higher, easily prepared and comparatively safe, stability is good, good immune effect, Many advantages, such as with low cost, storage facilitates.Therefore, gene vaccine research is received more and more attention and achieved very Big progress, especially in therapeutic field of tumor.In order to evoke more fully immune response for tumour, researcher is in vaccine In introduce dual-gene or polygenes expressing in series technology, express two or more tumour antigens, structure with a kind of vaccine Build polyvaccine；Or synchronous expression tumour antigen and immuno-stimulator.The design of polygenes series connection vaccine can either be avoided Prepare and cause complicated components, cost increase using multiple carriers, expression product can again approached on room and time, so that Play synergistic function (Yan Jin fine jade et al., 2008).The design that polygenes series design has expanded DNA vaccination significantly is empty Between.At present, the gene in polygenes series connection DNA vaccination mainly has two ways series arrangement：One kind is to use single promoter, Linked between each gene by internal ribosome entry site sequence (IRES)；Second is that each gene has the startup of oneself Son, relatively independent each gene of expression.(Schirmbeck et al.,2000；Chu Su rosy clouds et al., 2011).Pass through IRES The relative multiple promoter cascaded structure of polygenes series connection of sequence mediation can greatly reduce the size of expression vector, but also avoid Mutual inhibitory action between multiple promoter, it is to avoid produce fusion protein.

Alpha-fetoprotein (Alpha Fetoprotein, AFP) is a kind of glycoprotein, it exist only in human body some is specific Period.Under normal circumstances, after liver cell and yolk bag of the albumen essentially from embryo, fetal birth about two weeks alpha-fetoproteins from Disappeared in blood, the content of alpha-fetoprotein is very low in normal human serum, about 1-3ng/ml [Becker F F, Stillman D,Sell S.Serumα-fetoprotein in a mouse strain(C3H-Avy fB)with spontaneous hepatocellular carcinomas[J].Cancer research,1977,37(3):870- 872.].When lesion such as gastroenteric tumor, endodermal sinus tumor (yolk sac tumor), germinocarcinoma, primary carcinoma of liver occurs for human body, AFP levels can drastically raise (up to 1000ng/ml) in patient body, and hepatitis, hepatic sclerosis equivalent damage feelings are occurring for liver in addition Under condition, AFP also has increasing for varying degree.Primary carcinoma of liver is one of more typical malignant tumour of China, and AFP is used as sensitiveness And the higher hepatocellular carcinoma blood serum designated object of specificity, it is widely used in the screening of clinic, early diagnosis and therapy prognosis and comments [Kirkwood J M, Lotze M T, Yasko J M.Current Cancer Therapeutics Current in estimating Medicine[J].1994.].In recent years, with people to tumor pathogenesis probe into and tumour immunotherapy increasingly Maturation, specific immunotherapy has turned into the focus that advanced liver cancer is treated and studied.AFP acts not only as the weight of Hepatocarcinoma screening Want mark, at the same can also as immunotherapy of tumors target spot.By specific drug design, immunocyte can be at it Surface expression and submission AFP polypeptides and MHC compounds, stimulate the immune response of body, and then it is thin to produce specific killing T Born of the same parents, suppress growth [Bei R, the Mizejewski G J.Alpha fetoprotein is more than a of tumour hepatocellular cancer biomarker:from spontaneous immune response in cancer patients to the development of an AFP-based cancer vaccine[J].Current molecular medicine,2011,11(7):564-581.].Research shows that the AFP through BMDC (DC) activation is special Property T cell has significant anti tumor activity in vitro, and design basis [Liu is provided for gene vaccine clinical treatment hepatocellular carcinoma Raise, Wang Yueru, human liver cancer cell HepG2 is immunized fourth radiance, the BMDC for waiting alpha-fetoproteins adenovirus vector to induce Therapeutic action [J] Chinese Journal of Hepatobiliary Surgery, 2015,21 (7):486-489.].In addition, research shows, directly AFP genes or Peptide fragment gene is transferred in experimental animal or human body by plasmid vector or viral vector, can also excite special in vivo be directed to Immune response (the Butterfield et al., 2014 of AFP or tumour；Meng et al.,2001；Vollmer et al.,1999).But, currently with AFP as the not successful granted listing of gene vaccine of target spot, one of them is main The reason for be exactly to express half-life short in AFP proteosomes, antigen submission inefficient, it is impossible to effectively activate vivo immuning system.

The content of the invention

The technical problem to be solved in the present invention is：The expression product Half-life in vivo of existing isoformgene vaccine is short, antigen Submission efficiency is low, and the problem of vaccine composition complexity, degree of integration difference and poor concertedness.Letter is prepared the invention provides one kind DNA vaccination single, with low cost and safe and reliable, can produce specific immunity GVT to targeting for tumour, The skeptophylaxis stimulation for playing cell factor can be cooperateed with again.

The present invention solve the technical scheme that is used of above-mentioned technical problem for：The gene epidemic disease of prevention and treatment tumour is provided Seedling, it is characterised in that the gene vaccine includes carrier AFP genes, human IgG1 Fc fragment genes and people's CSF2 genes simultaneously Recombination carrier for expression of eukaryon.

Vaccine of the present invention is made up of carrier for expression of eukaryon and insertion gene order, and insertion gene order upstream and downstream is respectively swollen The antigen-4 fusion protein gene sequence and immuno-stimulator sequence of tumor antigen, both use IRES sequence links, while fusion protein Contain Linker sequences between tumor antigen gene and fusion partner GFP.

Wherein, human tumor antigen includes but is not limited to tumor neogenetic antigen, tumour specific antigen and tumor associated antigen, Such as AFP, prostate cancer antigen PSCA.

Fusion partner protein fragments refer to half-life period in order to extend tumour antigen or strengthen the antigen of immunocyte to pass The chaperone or protein fragments of expression, the signified fusion partner albumen bag of the present invention are coupled with tumor antigen protein in efficiency Contain but be not limited to human IgG Fc, human serum albumins HAS, transferrins etc..

Common fusion protein form has Fc fusion proteins, albumin fusion protein and transferrin fusion protein etc..Its In especially with Fc albumen most studies, many protein drugs including Etanercept etc. including weight pound medicine are all Fc fusion eggs In vain, many Fc fusion proteins medicines separately are in clinical investigation phase.

Fc fusion proteins are the chimeric proteins of the Fc sections fusion functional protein molecule and Immunoglobulin IgG, and this sets Meter can realize following several main purposes：

1. it can significantly lift protein drug long-term effect in vivo and stability.It is similar with internal endogenous antibody, In vivo in cyclic process, Fc fragments can be combined with its endothelial cell surface receptor FcRn, so that it is molten to protect it to exempt from intracellular Enzyme body is degraded.Except long-term effect, Fc can also be by hinge area disulfide formation dimer or polymer, so as to lift stabilization Property.

2. can more effectively immune presentation of the mediate antigen presenting cell to specific antigen, and then guide antibody-dependant cell The immune response such as toxicity (ADCC) and complement-dependent cytotoxicity (CDC).The Fc sections of such as IgG1Fc fusion proteins can be with The Fc acceptors FcR of Antigen Presenting Cell surface is combined, and mediates the antigen presentation to the target antigen of fusion, is resisted so as to greatly reduce target The former free time in body, lift antigen presentation efficiency.Meanwhile, Fc fragments can also be with acceptor (FqR) and complement component Lq (Clq) interactions play ADCC and CDC reactions respectively.Work(of the performance of these effects for lifting tumor therapeutic vaccine Effect is even more important.

3. the purifying and detection of albumen can be facilitated in vitro.The Fc of fusion can also play the effect of protein tag, take Fusion protein with Fc fragments can be with specific combination Protein A, can be conveniently fast via Protein A affinity chromatographys Prompt large-scale purification fusion protein, is that in vitro study provides more convenience.As label, it can be utilized to as identification Target spot, such as carries out cell using the antibody for Fc fragments and organizes the expression identification work of aspect.

In addition, Fc is also used as the target spot of a protein function transformation, more targeted function is realized to target protein Design.Such as can be by being mutated the specific sites of Fc fragments, regulation and the binding activity of special receptor, so as to optimize or realize Other functions, such as lifting half-life period by a larger margin, adjust ADCC activity, lift the targeting of medicine.

Further, the people AFP genes, the position of human IgG1 Fc fragment genes and CSF2 genes in carrier for expression of eukaryon Put from upstream to downstream is people AFP genes, human IgG1 Fc fragment genes and CSF2 genes, people AFP genes (SEQ ID successively NO.1) and human IgG1's Fc fragment genes sequence (SEQ ID NO.2) connects and composes antigen-4 fusion protein gene by Linker, and pass through Internal ribosome entry site IRES sequences (SEQ ID NO.4) are connected with people CSF2 genes (SEQ ID NO.5), wherein Linker sequence is as shown in SEQ ID NO.3.

Further contain restriction enzyme site BamH I in the linker sequences.

Linker is one section of sequence for being used for connecting tumour antigen and fusion partner albumen that we design, and possesses low hydrophobic Property, low charge and preferable mildness, so can be smaller on the influence of the protein steric conformation of connection, so as to ensure to merge companion The physiological function of companion's albumen is played；Meanwhile, Linker length is also suitable, and too short influence both sides protein function is oversize, holds Protease cutting site is easily introduced, causes degraded to fail.In addition, we utilize synonym in Link, devise restricted Inscribe restriction enzyme site BamH I, can for below in the carrier sub-stituent because or expand element provides facilitate.Protein Function depends greatly on its space structure, in construction of fusion protein, if connection peptide design is improper, it is also possible to lead Each corresponding circle of sensation conformational change in fusion protein is caused, activity reduction is allowed to or loses.Therefore, we are carrying out AFP and IgG1Fc During amalgamation and expression, the preferable Hydrophilic linkers of the free degree being made up of glycine and serine are designed, AFP and IgG1Fc can be made to exist Spatially individually separated, folding forms respective three-dimensional structure, to play its biological function.

Granulocyte-macrophage colony stimutaing factor (granulocyte-macrophage colony-stimulating factor,CSF2)：CSF2 same G-CSF, M-CSF, IL-3 and IL-5 etc. albumen belongs to hematopoietic cytokine.Mankind hCSF2 is A kind of single chain glycoprotein of secreting type, is made up of 144 amino acid, possesses the targeting sequencing of 17 amino acid.It can be by activating The various kinds of cell such as T lymphocytes, bone-marrow-derived lymphocyte, fibroblast, macrophage, vascular endothelial cell produce.It is used as one Immunomodulating cytokines, hCSF2 can play a variety of effects in immune response：Being capable of the main group of inducing macrophage II types The antigen presentation of histocmpatibility is knitted, promotes DC cell maturations and migration, is locally causing immunization inflammatory reaction, is recruiting periphery Blood monocyte, is used as medicine, the inflammatory reaction that injection site can be caused local, it is possible to increase for exotic antigen Antibody titer.So, hCSF2 is often used as the adjuvant of immunization therapy.Can be with as the hCSF2 of tumor therapeutic vaccine adjuvant Active antigen presenting cells (mainly macrophage and DC cells), and antigen presenting cell passes through processing and submission tumour antigen And downstream T cell is activated, so as to play a part of killing tumour.In hepatocarcinoma gene immunotherapy field, CSF2 is just studied people Member is inserted into expression vector in the way of cistron of connecting as immunologic adjuvant together with AFP albumen, in vitro plus It is downloaded in the DC cells as tumor vaccine.But the design and use of the carrier have certain limitation.Purposes is not Used directly as vaccine, and the auxiliary material of external preparation DC cell vaccines, its expression vector used is also simply general Logical expression vector, rather than ratify Clinical practice by FDA, the tumour immunity containing a variety of skeptophylaxis stimulation elements is controlled Treat special carrier.

In the present invention, people CSF2 gene orders can be replaced B7.1 costimulatory moleculeses gene coded sequence, leucocyte and be situated between Any of gene coded sequence or immunologic test point albumen inhibiting antibody gene coded sequence of element or interferon.

Carrier for expression of eukaryon of the present invention refer to any one can mammal expression alien gene eucaryon table Up to carrier, including but not limited to recombinant plasmid, bacterium, virus etc., such as pVAX1, pSilence1.0-U6 (Ambion, Austin, TX, USA), pEGFP-N1 (ClonTech companies), pCMV (Stratagene companies), pSV40 (Marker Gene companies), PSI, pCI, pCI-neo (Promega companies), pPICZ α, pTEF1, pcDNA3.1 or pcDNA (Invitrogen companies) etc., Either salmonella typhi, Listeria etc. or adenovirus, adeno-associated virus, slow virus etc..It is preferred that, the tumour epidemic disease The expression vector that seedling is used is pVAX1.

The present invention is using pVAX1 as the carrier that sets out, the carrier AFP-Linker-Fc antigen-4 fusion protein genes of structure, IRES sequences The tumor gene vaccine of row and CSF2 genes is named as pVAX1-AFP-Linker-Fc-IRES-CSF2, and the vaccine can be used for The prevention and treatment of cancer positive all AFP, including but not limited to gastroenteric tumor, endodermal sinus tumor (yolk sac tumor), reproduction Cell cancer, primary carcinoma of liver etc..NO in the nucleotide sequence of wherein described AFP genes such as sequence table:Shown in 1, the Fc sequences Nucleotide sequence such as sequence table in NO:2, NO in the nucleotide sequence of the linker sequences such as sequence table:3, the IRES NO in the nucleotide sequence of sequence such as sequence table:4, NO in the nucleotide sequence of the CSF2 genes such as sequence table:5.

Said gene vaccine can also add one or more pharmaceutically acceptable carriers, and the carrier includes but do not limited In the conventional diluent of pharmaceutical field, sorbefacient, surfactant；Or by means of auxiliary material, it is prepared into new medicine Thing packaged form, such as liposome or nanoparticulate drug.

In order to improve curative effect, this gene vaccine can also be used with the combinational drug therapy such as immunostimulant, antibody drug.

Second object of the present invention is to provide the preparation method of said gene vaccine, it is characterised in that including following step Suddenly：

1) AFP genes are expanded from the recombinant plasmid template containing AFP gene orders and restriction enzyme site and linker is introduced, Obtain AFP-linker；Wherein linker sequence is as shown in SEQ ID NO.3；

2) IRES sequences are expanded from containing IRES sequence plasmid carriers respectively, purpose is expanded from CSF2 template plasmid Gene C SF2, and in gene C SF2 downstreams addition restriction enzyme site Xba I；

3) sequence AFP-linker and IgG1Fc are spliced into by AFP-linker- by Overlap PCR method respectively Fc, IRES-CSF2 is spliced into by sequence IRES and CSF2；

4) by homologous recombination, AFP-linker-Fc and IRES-CSF2 is stitched together and carrier pVAX1 is connected to, Obtain recombinant plasmid pVAX1-AFP-Linker-Fc-IRES-CSF2.

Further, the specific primer of step 1 amplification AFP genes is：

Primer 1:5’-ACCCAAGCTGGCTAGCGTTTAAACTTAAGATGAAGTGGGTGGAATCAATTTTTTTA- 3’

Primer 2:5’-GGATCCGCCGCCGCCAACTCCCAAAGCAGCACGAG-3’；

Step 2 amplification IRES sequences specific primer be：

Primer 3:5’-AGCCTCTCCCTGTCTCCGGGTAAAGCCCCTCTCCCTCCCCCCCCCCTAACGTTAC

TGGCCGAAGCCGC-3’；

Primer 4:5’-AGCAGCAGGCTCTGCAGCCACATGGTTGTGGCCATATTATCATCGTG-3’；

Step 2 amplification CSF2 genes specific primer be：

Primer 5:5’-CACGATGATAATATGGCCACAACCATGTGGCTGCAGAGCCTGCTGCT-3’

Primer 6:5’-GATCAGCGGGTTTAAACGGGCCCTCTAGATCACTCCTGGACTGGCTCCCAGC-3’。

Overlap PCR spliced genes fragment AFP-linker and Fc primer are in step 3：

Primer 7:5’-ACCCAAGCTGGCTAGCGTTTAAACTTAAGATGAAGTGGGTGGAATCAATTTTTTTA- 3’

Primer 8:5’-GGATCCGCCGCCGCCAACTCCCAAAGCAGCACGAG-3’

Primer 9:5’-CTCGTGCTGCTTTGGGAGTTGACAAAACTCACACATGCCCACCG-3’

Primer 10:5’-GGGGGGGGGAGGGAGAGGGGCTTTACCCGGAGACAGGGAGAGGCT-3’；

Overlap PCR spliced genes fragment IRES and CSF2 primer are in step 3：

Primer 11:5’-AGCCTCTCCCTGTCTCCGGGTAAAGCCCCTCTCCCTCCCCCCCCCCTAACGTTACT GGCCGAAGCCGC-3’

Primer 12:5’-AGCAGCAGGCTCTGCAGCCACATGGTTGTGGCCATATTATCATCGTG-3’

Primer 13:5’-CACGATGATAATATGGCCACAACCATGTGGCTGCAGAGCCTGCTGCT-3’

Primer 14:5’-GATCAGCGGGTTTAAACGGGCCCTCTAGATCACTCCTGGACTGGCTCCCAGC-3’。

By handling tumour cell in itself with the protein expressioning product or vaccine of vaccine in vitro, then detect to tumour The influence of Apoptosis or division growth, vitro detection vaccine tumor-suppression activity experiment proves that gene vaccine of the invention is to liver The overexpression AFP activity of tumor cells such as cancer significantly inhibits effect.

Compared with existing correlation technique or design, the present invention has the advantages that following prominent：

(1), the present invention can lift AFP genes and human IgG1's Fc fragment gene amalgamation and expressions antigen protein AFP and exist Internal half-life period and stability, and lift the targeting and efficiency of antigen submission, thus reduce vaccine dosage or Lift immune activation level；Simultaneously as label, can for the gene coupled by identification expression and isolate and purify Coupled albumen.

(2), CSF2 can lift the immune effect of vaccine in several ways as the addition of immunologic adjuvant：It can induce The antigen presentation of macrophage II type MHCs, promotes DC cell maturations and migration, exempts from locally causing Epidemic disease inflammatory reaction, recruits PMBC, and can improve the antibody titer for exotic antigen.

(3), AFP-Fc antigen-4 fusion protein genes and CSF2 genes pass through IRES sequences series connection access pVAX1 in the present invention Used vaccine classes have not only been simplified in carrier, such design, reduce drug component and production cost and risk, and The success rate that medicine is declared can be lifted, while the series design causes the same area position table of AFP-Fc and CSF2 in vivo Reach, can preferably play Regional Synergetic effect, preferably realize antigen submission and immune response activation.

(4), pVAX1 carriers are of new generation nucleic vaccine plasmid carrier of the U.S. FDA approval available for clinic, and it passes through A variety of comprehensive Designs, by a variety of sequential elements in carrier, can lift vaccine while insertion gene efficient expression is ensured Immune activation ability.

(5), the preparation method of gene vaccine of the present invention, devises BamH I restriction enzyme site in Linker, With reference to restriction enzyme site existing in IRES and pVAX, the gene substitution in existing vaccine can be conveniently implemented in, such as can be with Realized for some gene in AFP, Fc and CSF2 and delete or replace, considerably increase the follow-up autgmentability of the vaccine. Based on foregoing design, vaccine of the invention is compared to current similar vaccine, it is contemplated that will greatly promote tumor killing effect.

Brief description of the drawings

Fig. 1 is recombinant vector pVAX1-AFP-Linker-Fc-IRES-CSF2 collection of illustrative plates.

Fig. 2 is splice segment AFP-linker-Fc PCR amplification electrophoretograms, band 1,2：AFP-linker-Fc PCR pieces Section；Band 3：DNA marker.

Fig. 3 is splice segment IRES-CSF2 PCR amplification electrophoretograms, band 1,2：IRES-CSF2PCR fragments；Band 3： DNA marker.

Fig. 4 is recombinant plasmid pVAX1-AFP-Linker-Fc-IRES-CSF2 Nco I single endonuclease digestion electrophoretograms, band 1： Do not digest；Band 2：Nco I digest；Lane 3：DNA marker.

Fig. 5 is the Western Blot detections of recombinant protein (sample is cell culture supernatant).Western blot are examined Expression of the AFP-Fc fusion proteins in HEK293 cells is surveyed, first is albumen Marker；Second is recombinant plasmid Transfection；3rd road is control vector transfection.Image to left is anti-Fc antibody test results, and intermediate picture is examined for AntiAFP antibody Result is surveyed, right side is preceding two width picture stack result, illustrate that two kinds of albumen of Fc and AFP have expression and in the shape of fusion protein Formula.

Fig. 6 is AFP expressing quantities.

Fig. 7 is CSF2 expressing quantities.

Fig. 8 is that vaccine transfection suppresses HepG2 cell proliferation experiment schematic diagrames.

Fig. 9 is that vaccine expression product suppresses HepG2 cell proliferation experiment schematic diagrames.

Specific embodiment

Embodiment is implemented lower premised on technical solution of the present invention, gives detailed embodiment and specific Operating process, but protection scope of the present invention is not limited to following embodiments.

Method therefor is conventional method unless otherwise instructed in following embodiments.

It is recombinant vector pVAX1-AFP-Linker-Fc-IRES-CSF2 collection of illustrative plates as shown in Figure 1.Antioncogene of the present invention The active component of medicine is carrier's AFP gene, junction fragment Linker sequences, IgG antibody 1Fc fragment bases Cause, the recombinant expression plasmid pVAXl-AFP-linker-Fc-IRES-CSF2 of human immune factor CSF2 genes, in the plasmid, Human a-fetoprotein AFP genes, junction fragment Linker sequences, antibody I g G1Fc fragment genes, people CSF2 genes are in the carrier Position is to be followed successively by human a-fetoprotein AFP genes, junction fragment Linker sequences, antibody I g G1Fc fragments from upstream to downstream Gene and people's CSF2 genes, the AFP genes are connected by linker with Fc fragments and constitute fusion (AFP-Linker- Fc), and by IRES sequences it is connected with CSF2 genes, i.e., is fusion AFP-Linker-Fc, IRES downstreams from IRES upstreams For gene C SF2.

Embodiment 1：Vaccine plasmid pVAXl-AFP-linker-Fc-IRES-CSF2 structure

Plasmid and strain

The recombinant plasmid H3088pAV-MCMV-AFP commission limited public affairs of Shanghai English fine horse biotechnology containing AFP gene orders Department's synthesis is built, wherein AFP GenBank Serial No.：NM_001134.2.

CDNA clone strain containing pVAX1 carrier for expression of eukaryon and CSF2 is bought limited from Changsha win profit biotechnology Company, CSF2 GenBank Serial No.：BC113999.1.

Given containing IRES sequence plasmid carrier pIRES2-EGFP by Medical College of Zhejiang Univ. laboratory.

CH2, CH3 area of Fc sections of IgG1 heavy chain regions comprising people and hinge area, the sequence is by Suzhou gold only intelligence biotechnology Co., Ltd synthesizes, NO in nucleotide sequence such as sequence table:2.

1.1 gene order AFP-linker PCR amplifications.

PCR amplification gene AFP are utilized from template plasmid H3088pAV-MCMV-AFP, while passing through upstream and downstream primer Design, the AflII and 3 ' of restriction enzyme site 5 ' Linker are added at the AFP genes two ends obtained after PCR respectively.

Expand the primer sequence of AFP genes：

Primer 1:5’-ACCCAAGCTGGCTAGCGTTTAAACTTAAGATGAAGTGGGTGGAATCAATTTTTTTA- 3’

Primer 2:5’-GGATCCGCCGCCGCCAACTCCCAAAGCAGCACGAG-3’

PCR reaction conditions are：First 96 DEG C of pre-degeneration 3min；Then 96 DEG C are denatured 15s, 58 DEG C of annealing 25s, 72 DEG C of extensions 2min, totally 20 circulation, 20 circulation after again 72 DEG C extension 3min.

PCR reaction systems (50 μ L)

1.2 gene order IgG1Fc, IRES and CSF2 PCR amplifications

CH2, CH3 area of IgG1 heavy chain region of the IgG1Fc sections sequence of people comprising people and hinge area, the sequence is by Suzhou gold Wei Zhi bio tech ltd is synthesized, and IRES sequences is expanded from template plasmid pIRES2-EGFP respectively, from CSF2 template Amplifying target genes CSF2 in plasmid pDONR223, and add 3 ' XbaI in target gene CSF2.PCR reaction systems and reaction interval Ibid, the primer of two fragment PCR amplifications is as follows for sequence：

Expand IRES primer sequence

Primer 3:5’-AGCCTCTCCCTGTCTCCGGGTAAAGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTG GCCGAAGCCGC-3’

Primer 4:5’-AGCAGCAGGCTCTGCAGCCACATGGTTGTGGCCATATTATCATCGTG-3’

Amplification gene CSF2 primer sequence：

Primer 5:5’-CACGATGATAATATGGCCACAACCATGTGGCTGCAGAGCCTGCTGCT-3’

Primer 6:5’-GATCAGCGGGTTTAAACGGGCCCTCTAGATCACTCCTGGACTGGCTCCCAGC-3’

Genetic fragment AFP-linker-Fc and IRES-CSF2 acquisition

Sequence AFP-linker and IgG1Fc and sequence IRES and CSF2 are spelled respectively using Overlap PCR method It is connected into two fragments AFP-linker-Fc and IRES-CSF2.Wherein fragment AFP-linker-Fc upstream and fragment IRES- CSF2 downstream has the AflII and 3 ' of restriction enzyme site 5 ' XbaI, AFP-linker-Fc Fc ends downstream and fragment IRES- respectively CSF2 IRES ends upstream has homologous sequence.

1.3 utilize Overlap PCR spliced gene fragments AFP-linker and Fc

Overlap PCR primers

Primer 7:5’-ACCCAAGCTGGCTAGCGTTTAAACTTAAGATGAAGTGGGTGGAATCAATTTTTTTA- 3’

Primer 8:5’-GGATCCGCCGCCGCCAACTCCCAAAGCAGCACGAG-3’

Primer 9:5’-CTCGTGCTGCTTTGGGAGTTGACAAAACTCACACATGCCCACCG-3’

Primer 10:5’-GGGGGGGGGAGGGAGAGGGGCTTTACCCGGAGACAGGGAGAGGCT-3’

Overlap PCR response procedures：

With Primer 7 and the amplified fragments AFP-linker of Primer 8, with Primer 9 and the amplified fragments of Primer 10 Fc；

Reclaim fragment AFP-linker, Fc；

With fragment AFP-linker, Fc is common template, and Primer 7 and Primer 10 are primer, and amplification is spelled Tab segments AFP-linker-Fc, nucleic acid electrophoresis detection is as shown in Figure 2.

1.4 utilize Overlap PCR spliced gene fragments IRES and CSF2

Overlap PCR primers

Primer11:5’-AGCCTCTCCCTGTCTCCGGGTAAAGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTG GCCGAAGCCGC-3’

Primer 12:5’-AGCAGCAGGCTCTGCAGCCACATGGTTGTGGCCATATTATCATCGTG-3’

Primer 13:5’-CACGATGATAATATGGCCACAACCATGTGGCTGCAGAGCCTGCTGCT-3’

Primer 14:5’-GATCAGCGGGTTTAAACGGGCCCTCTAGATCACTCCTGGACTGGCTCCCAGC-3’

Ibid, nucleic acid electrophoresis detection is as shown in Figure 3 for OverlapPCR response procedures.

1.5 recombinant plasmid pVAX1-AFP-Linker-Fc-IRES-CSF2 structure

Finally utilize the homologous of the AflII and 3 ' of restriction enzyme site 5 ' XbaI and fragment AFP-linker-Fc and IRES-CSF2 The two fragment assemblies, by homologous recombination, together and are connected to carrier pVAX1, construction recombination plasmid pVAX1- by sequence AFP-Linker-Fc-IRES-CSF2。

Homologous recombination response procedures：

The genetic fragment AFP-linker-Fc and IRES-CSF2 that early stage is built and recombinant expression carrier pVAX1 totally 3 Fragment carries out homologous recombination, and reaction system is as follows：

Recombining reaction system

(remarks：The dosage summation of carrier and product is no more than 10ul as far as possible, and the moisturizing if less than 10ul makes itself and restructuring Enzymatic mixture cumulative volume reaches 20ul systems.)

Reacted 60 minutes at 50 DEG C, ice bath is converted after 5 minutes to Escherichia coli TOP 10F'.

Recombinant plasmid pVAX1-AFP-Linker-Fc-IRES-CSF2 single endonuclease digestion checking：

The recombinant plasmid pVAX1-AFP-Linker-Fc-IRES-CSF2 obtained by homologous recombination, recombinant plasmid size 6468, there are Nco I restriction enzyme digestion sites in its 411 and 5255 site, should using Nco I single endonuclease digestions recombinant plasmid This obtains two fragments that size is 1624bp and 4844bp, uses DS^TM5000DNA ladder, electrophoresis checking is as shown in Figure 4.

Obtained recombinant plasmid is delivered to Shanghai Sheng Gong bioengineering limited company and is sequenced, sequence after sequencing Comparison result shows that resulting gene and the gene homology designed are 100.00%, namely the recombinant plasmid built is same Theoretical Design is completely the same.

Embodiment 2：Vaccine plasmid pVAX1-AFP-Linker-Fc-IRES-CSF2 vivoexpressions are detected

2.1 plasmid-transfected cells

Micro- Microscopic observation, treats that HEK293 cell growths are transfected to more than 80%.If one group of negative control group and one Group plasmid transfection experimental group, wherein negative control group DNA uses pVAX1 empty plasmids, and plasmid transfection experimental group DNA is used PVAX1-AFP-Linker-Fc-IRES-CSF2, with the PolyJet of SignaGen companies^TMDNA in-vitro transfection reagents say above-mentioned Plasmid DNA transfection HEK293 cells, are comprised the following steps that (following steps are by taking 6cm culture dish systems as an example)：1. first 60 points of transfection Clock, carries out changing liquid with DMEM (Hyclone) culture mediums of the 2mL containing 10% hyclone (Chinese holly) to cell；2. with DMEM without Serum high glucose medium dilutes DNA and PolyJetTM transfection reagents, using DNA (μ g):PolyJetTM (μ L) ratio For 1：2；3. 2 μ g DNAs are diluted with 100 μ L DMEM serum-frees high glucose medium, gently shake, mark is after mixing Agent 1；4. 4 μ LPolyJetTM transfection reagents are diluted with 100 μ L DMEM serum-frees high glucose medium, gently shake, after mixing Labeled as reagent 2；5. reagent 2 is added in reagent 1 immediately, gently concussion is mixed, and is incubated at room temperature 15 minutes；6. by DNA/ PolyJet compound reagents are added into 6cm culture dish platelets, are jiggled；7. after transfection 8 hours, culture medium is replaced by 2mL plasma-free DMEM mediums continue to cultivate；8. after transfection 48 hours, HEK293 cell transfecting samples are collected, including transfection is carefully Born of the same parents' culture supernatant and transfectional cell lysate sample.

2.2HEK293 cell transfecting sample collections

After transfection 48 hours, culture dish is taken out, observation HEK293 cells are without sample collection is started after difference, specific steps are such as Under (following steps are by taking 6cm culture dish systems as an example)：1. collecting all cells and supernatants (about 2mL), 4000rpm centrifuges 5 points Zhong Hou, takes supernatant, labeled as transfectional cell culture supernatant sample；2. obtaining after supernatant nutrient solution, retain sedimentation cell, to 6cm 500 μ L pancreatin are added in culture dish, 37 DEG C of incubators are inserted digested 1 minute, being cultivated containing 10% serum DMEM for 1mL is added Base is blown and beaten to terminate digestion reaction, gently makes cell detachment, all cells of collection, and the sedimentation cell obtained by supernatant centrifugation is together 4000rpm is centrifuged 5 minutes.3. abandoning supernatant after centrifugation, add 1mL 1X PBS and blowing and beating is resuspended cell, use again 4000rpm is centrifuged 5 minutes, to remove remnants serum.4. abandoning supernatant after centrifugation, 150 μ L RIPA tissue/cells cracking is added Liquid (protease inhibitors containing 1%PMSF and 1%Cocktail), after cracking 15 minutes on ice, 4 DEG C of 12000rpm centrifuge 10 points Clock, to remove cell cleaved fragment, collects all supernatants, labeled as transfectional cell lysate sample.5.Western Blot samples Prepare, take transfectional cell lysate sample and each 40 μ L of transfectional cell culture supernatant sample, add 20 μ L 4X protein electrophoresis loadings Buffer solution, 12000rpm is centrifuged 10 minutes after water-bath 5 minutes at 100 DEG C, labeled as Western Blot loading samples.Collect In HEK293 cell samples, cell culture supernatant and cell lysate sample are used for ELISA method and quantitative determine destination protein concentration, The Western Blot loadings sample of preparation is used for the expression of Western Blot method verifying purpose albumen.

The recombinant protein A FP-Fc of 2.3 mesh detection of expression

Transfectional cell culture supernatant is collected, and utilizes RIPA lysate cell lysis, protein sample is collected.Collect finished white After sample, the cell concentration before cracking is determined, to ensure that the applied sample amount of each protein sample is consistent.Tested with Western Blot methods Purpose recombinant protein A FP-Fc expression is demonstrate,proved, is comprised the following steps that：1. appropriate 4XSDS- is added in the protein sample of collection PAGE protein concentrate sample-loading buffers, 100 DEG C or boiling water bath are heated 10 minutes, with abundant albuminate, 12000rpm before loading Centrifugation 10 minutes is simultaneously cooled to room temperature；2. loading to SDS-PAGE glue carries out protein electrophoresis, standard damp process goes to cellulose nitrate Plain film；3. carrying out rinsing 1-2 minutes to transfer film with TBST solution, then 1 is closed with the TBST solution room temperature containing 5% skim milk Hour；4. referring to primary antibody specification, the TBST solution containing 5% skim milk is used to dilute primary antibody according to proper proportion, to transfer film Carry out being incubated 1 hour or 4 degree of night incubations；5. with reference to the specification of secondary antibody, used according to proper proportion containing 5% skim milk The secondary antibody of TBST solution dilution horseradish peroxidase (HRP) mark, carries out being incubated 1 hour to transfer film；6. use ECL PLUS chemical luminous substrates detect albumen, and luminescence imaging result is detected using G-BOX chemiluminescence imagings, as a result such as Fig. 5.It is right In destination protein AFP-Fc detection, transfer film is first incubated with anti-AFP primary antibody and correspondence secondary antibody, and film washing liquid is used after exposure image Wash film, then the anti-igg 1Fc antibody incubations marked with horseradish enzyme, then times exposure image, using verifying purpose recombinant protein A FP-Fc as Fusion protein.As a result as shown in figure 5, the HEK293 cells and supernatants of pVAX1-AFP-Linker-Fc-IRES-CSF2 transfections It is middle to use anti-AFP and Fc antibody all to detect an obvious band (molecular weight is 100-130kDa), and pillar location respectively Unanimously, it was demonstrated that AFP-Fc is the expression-form of fusion protein, and in the cells and supernatant that transfects of empty plasmid of control It is not detected by respective strap.

The recombinant protein A FP-Fc and CSF2 of 2.4 mesh concentration mensuration

The culture of the HEK293 cells of pVAX1-AFP-Linker-Fc-IRES-CSF2 plasmid transfections is determined with ELISA method AFP-Fc and CSF2 expression concentration in supernatant, for AFP-Fc fusion proteins, uses Lian Ke Biotechnology Ltd. Human α-fetoprotein/AFP ELISA Kit kit measurements AFP concentration, then be converted into by molecular weight ratio AFP-Fc fusion protein concentration, as a result as shown in fig. 6, showing AFP- in pVAX1-AFP-Linker-Fc-IRES-CSF2 plasmids Fc fusion proteins obtain good representation, and the concentration of expression expresses 64 ± 11ng for every 1,000,000 cells.Specific detection step Suddenly referring to kit specification.

For destination protein CSF2, using the Human CSF2ELISA of affmetrix eBioscience companies Ready-SET-Go！(2^ndGeneration) kit measurement CSF2 protein concentrations, as a result as shown in fig. 7, showing pVAX1- CSF2 Cytokine proteins in AFP-Linker-Fc-IRES-CSF2 plasmids positioned at downstream obtain preferable expression, and expression Concentration for every 1,000,000 cells express 410 ± 101pg, specific detecting step is according to kit specification.

The vaccine of embodiment 3. suppresses the experiment of HepG2 hepatoma cell proliferations

The transfection of 3.1 vaccines suppresses experiment

With every hole 1.5 × 10³Individual HepG2 cells are inoculated in 24 orifice plates, and 500 μ L DMEM high glucose mediums of injection (contain 10%FBS) cultivate.Culture is transfected after one day, if control group and each 1 group of experimental group, every group sets 3 multiple holes, wherein compareing Group DNA uses pVAX1 empty plasmids, and experimental group DNA is using the pVAX1-AFP-Linker-Fc-IRES- built CSF2, passes through the PolyJet of SignaGen companies^TMDNA in-vitro transfections reagent is by above-mentioned plasmid DNA transfection HepG2 cells.Tool Body step is according to reagent specification, and 96 orifice plates add 5g DNAs per hole and the compound of 1 μ L liposomes is transfected, and with Continue to cultivate to 96h under 2.5%FBS low serum state.Cell proliferation inhibition rate is detected using mtt assay, 200 μ are added per hole LMTT (5mg/mL), supernatant is removed after 3 hours, and normal temperature on 500 μ L dimethyl sulfoxide (DMSO)s (DMSO), shaking table is added per hole and is vibrated 5 minutes, Precipitated crystal thing is set fully to dissolve.Optical density (OD) value at enzyme-linked immunosorbent assay instrument measurement 490nm.Three repetitions are carried out respectively After experiment, data carry out statistical analysis, as a result as shown in Figure 8.

3.2 vaccine expression products suppress experiment

With every 3000 HepG2 cells inoculations in hole, 100 μ L DMEM high glucose mediums of injection (containing 10%FBS) culture.Training Support one day after change to 100 μ L collection HEK293 cell transfecting culture supernatant samples, and add 2.5 μ L FBS, if control group and Each 1 group of experimental group, every group sets 5 multiple holes, and wherein control group changes liquid using collected by pVAX1 empty plasmid transfected HEK 293s Supernatant samples, experimental group change liquid using build pVAX1-AFP-Linker-Fc-IRES-CSF2 plasmid transfections HEK293 it is thin Continue to cultivate common 48h under Supernatant samples collected by born of the same parents, low serum state.Cell proliferation inhibition rate is detected using mtt assay, added per hole Enter 200 μ LMTT (5mg/mL), supernatant is removed after 3 hours, normal temperature vibration on 500 μ L dimethyl sulfoxide (DMSO)s (DMSO), shaking table is added per hole 5 minutes, precipitated crystal thing is set fully to dissolve.Optical density (OD) value at enzyme-linked immunosorbent assay instrument measurement 490nm.Three are carried out respectively Secondary to repeat after testing, data carry out statistical analysis, as a result as shown in Figure 9, it was demonstrated that vaccine expression product under in vitro conditions can Enough significantly inhibit the division growth of liver cancer cells.

Sequence table

<110>Hangzhou Bei Luokang Bioisystech Co., Ltd

<120>A kind of gene vaccine for preventing and treating tumour and its production and use

<160> 19

<170> PatentIn version 3.3

<210> 1

<211> 1830

<212> DNA

<213> Homo sapiens

<223>AFP genes

<400> 1

atgaagtggg tggaatcaat ttttttaatt ttcctactaa attttactga atccagaaca 60

ctgcatagaa atgaatatgg aatagcttcc atattggatt cttaccaatg tactgcagag 120

ataagtttag ctgacctggc taccatattt tttgcccagt ttgttcaaga agccacttac 180

aaggaagtaa gcaaaatggt gaaagatgca ttgactgcaa ttgagaaacc cactggagat 240

gaacagtctt cagggtgttt agaaaaccag ctacctgcct ttctggaaga actttgccat 300

gagaaagaaa ttttggagaa gtacggacat tcagactgct gcagccaaag tgaagaggga 360

agacataact gttttcttgc acacaaaaag cccactccag catcgatccc acttttccaa 420

gttccagaac ctgtcacaag ctgtgaagca tatgaagaag acagggagac attcatgaac 480

aaattcattt atgagatagc aagaaggcat cccttcctgt atgcacctac aattcttctt 540

tgggctgctc gctatgacaa aataattcca tcttgctgca aagctgaaaa tgcagttgaa 600

tgcttccaaa caaaggcagc aacagttaca aaagaattaa gagaaagcag cttgttaaat 660

caacatgcat gtgcagtaat gaaaaatttt gggacccgaa ctttccaagc cataactgtt 720

actaaactga gtcagaagtt taccaaagtt aattttactg aaatccagaa actagtcctg 780

gatgtggccc atgtacatga gcactgttgc agaggagatg tgctggattg tctgcaggat 840

ggggaaaaaa tcatgtccta catatgttct caacaagaca ctctgtcaaa caaaataaca 900

gaatgctgca aactgaccac gctggaacgt ggtcaatgta taattcatgc agaaaatgat 960

gaaaaacctg aaggtctatc tccaaatcta aacaggtttt taggagatag agattttaac 1020

caattttctt caggggaaaa aaatatcttc ttggcaagtt ttgttcatga atattcaaga 1080

agacatcctc agcttgctgt ctcagtaatt ctaagagttg ctaaaggata ccaggagtta 1140

ttggagaagt gtttccagac tgaaaaccct cttgaatgcc aagataaagg agaagaagaa 1200

ttacagaaat acatccagga gagccaagca ttggcaaagc gaagctgcgg cctcttccag 1260

aaactaggag aatattactt acaaaatgcg tttctcgttg cttacacaaa gaaagccccc 1320

cagctgacct cgtcggagct gatggccatc accagaaaaa tggcagccac agcagccact 1380

tgttgccaac tcagtgagga caaactattg gcctgtggcg agggagcggc tgacattatt 1440

atcggacact tatgtatcag acatgaaatg actccagtaa accctggtgt tggccagtgc 1500

tgcacttctt catatgccaa caggaggcca tgcttcagca gcttggtggt ggatgaaaca 1560

tatgtccctc ctgcattctc tgatgacaag ttcattttcc ataaggatct gtgccaagct 1620

cagggtgtag cgctgcaaac gatgaagcaa gagtttctca ttaaccttgt gaagcaaaag 1680

ccacaaataa cagaggaaca acttgaggct gtcattgcag atttctcagg cctgttggag 1740

aaatgctgcc aaggccagga acaggaagtc tgctttgctg aagagggaca aaaactgatt 1800

tcaaaaactc gtgctgcttt gggagtttaa 1830

<210> 2

<211> 681

<212> DNA

<213>Artificial sequence

<223>IgG1 Fc sequences

<400> 2

gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 60

ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 120

tgcgtggtgg tggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 180

ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cagcacgtac 240

cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaag 300

tgcaaggtct ccaacaaagc cctcccagcc cccatcgaga aaaccatctc caaagccaaa 360

gggcagcccc gagaaccaca ggtgtacacc ctgcccccat cccgggagga gatgaccaag 420

aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 480

tgggagagca atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc 540

gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 600

aacgtcttct catgctccgt gatgcacgag gctctgcaca accactacac gcagaagagc 660

ctctccctgt ctccgggtaa a 681

<210> 3

<211> 15

<212> DNA

<213>Artificial sequence

<223>Linker sequences

<400> 3

ggcggcggcg gatcc 15

<210> 4

<211> 588

<212> DNA

<213>Artificial sequence

<223>IRES sequences

<400> 4

gcccctctcc ctcccccccc cctaacgtta ctggccgaag ccgcttggaa taaggccggt 60

gtgcgtttgt ctatatgtta ttttccacca tattgccgtc ttttggcaat gtgagggccc 120

ggaaacctgg ccctgtcttc ttgacgagca ttcctagggg tctttcccct ctcgccaaag 180

gaatgcaagg tctgttgaat gtcgtgaagg aagcagttcc tctggaagct tcttgaagac 240

aaacaacgtc tgtagcgacc ctttgcaggc agcggaaccc cccacctggc gacaggtgcc 300

tctgcggcca aaagccacgt gtataagata cacctgcaaa ggcggcacaa ccccagtgcc 360

acgttgtgag ttggatagtt gtggaaagag tcaaatggct ctcctcaagc gtattcaaca 420

aggggctgaa ggatgcccag aaggtacccc attgtatggg atctgatctg gggcctcggt 480

gcacatgctt tacatgtgtt tagtcgaggt taaaaaaacg tctaggcccc ccgaaccacg 540

gggacgtggt tttcctttga aaaacacgat gataatatgg ccacaacc 588

<210> 5

<211> 435

<212> DNA

<213> Homo sapiens

<223>CSF2 genes

<400> 5

atgtggctgc agagcctgct gctcttgggc actgtggcct gcagcatctc tgcacccgcc 60

cgctcgccca gccccagcac gcagccctgg gagcatgtga atgccatcca ggaggcccgg 120

cgtctcctga acctgagtag agacactgct gctgagatga atgaaacagt agaagtcatc 180

tcagaaatgt ttgacctcca ggagccgacc tgcctacaga cccgcctgga gctgtacaag 240

cagggcctgc ggggcagcct caccaagctc aagggcccct tgaccatgat ggccagccac 300

tacaagcagc actgccctcc aaccccggaa acttcctgtg caacccagat tatcaccttt 360

gaaagtttca aagagaacct gaaggacttt ctgcttgtca tcccctttga ctgctgggag 420

ccagtccaggagtga 435

<210> 6

<211> 56

<212> DNA

<213>Artificial sequence

<400> 6

acccaagctg gctagcgttt aaacttaaga tgaagtgggt ggaatcaatt ttttta 56

<210> 7

<211> 35

<212> DNA

<213>Artificial sequence

<400> 7

ggatccgccg ccgccaactc ccaaagcagc acgag 35

<210> 8

<211> 68

<212> DNA

<213>Artificial sequence

<400> 8

agcctctccc tgtctccggg taaagcccct ctccctcccc cccccctaac gttactggcc 60

gaagccgc 68

<210> 9

<211> 47

<212> DNA

<213>Artificial sequence

<400> 9

agcagcaggc tctgcagcca catggttgtg gccatattat catcgtg 47

<210> 10

<211> 47

<212> DNA

<213>Artificial sequence

<400> 10

cacgatgata atatggccac aaccatgtgg ctgcagagcc tgctgct 47

<210> 11

<211> 52

<212> DNA

<213>Artificial sequence

<400> 11

gatcagcggg tttaaacggg ccctctagat cactcctgga ctggctccca gc 52

<210> 12

<211> 56

<212> DNA

<213>Artificial sequence

<400> 12

acccaagctg gctagcgttt aaacttaaga tgaagtgggt ggaatcaatt ttttta 56

<210> 13

<211> 35

<212> DNA

<213>Artificial sequence

<400> 13

ggatccgccg ccgccaactc ccaaagcagc acgag 35

<210> 14

<211> 44

<212> DNA

<213>Artificial sequence

<400> 14

ctcgtgctgc tttgggagtt gacaaaactc acacatgccc accg 44

<210> 15

<211> 45

<212> DNA

<213>Artificial sequence

<400> 15

ggggggggga gggagagggg ctttacccgg agacagggag aggct 45

<210> 16

<211> 68

<212> DNA

<213>Artificial sequence

<400> 16

agcctctccc tgtctccggg taaagcccct ctccctcccc cccccctaac gttactggcc 60

gaagccgc 68

<210> 17

<211> 47

<212> DNA

<213>Artificial sequence

<400> 17

agcagcaggc tctgcagcca catggttgtg gccatattat catcgtg 47

<210> 18

<211> 47

<212> DNA

<213>Artificial sequence

<400> 18

cacgatgata atatggccac aaccatgtgg ctgcagagcc tgctgct 47

<210> 19

<211> 52

<212> DNA

<213>Artificial sequence

<400> 19

gatcagcggg tttaaacggg ccctctagat cactcctgga ctggctccca gc 52

Claims (12)

1. a kind of gene vaccine for preventing and treating tumour, it is characterised in that the gene vaccine includes carrier's AFP bases simultaneously The recombination carrier for expression of eukaryon of cause, human IgG1 Fc fragment genes and people's CSF2 genes.

2. gene vaccine according to claim 1, it is characterised in that the people AFP genes, human IgG1 Fc fragment genes and Position of the CSF2 genes in carrier for expression of eukaryon from upstream to downstream successively for people AFP genes, human IgG1 Fc fragment genes and CSF2 genes, people AFP genes and human IgG1's Fc fragment genes sequence connect and compose antigen-4 fusion protein gene by Linker, and pass through Internal ribosome entry site IRES sequences are connected with people's CSF2 genes, and wherein linker sequence is as shown in SEQ ID NO.3.

3. gene vaccine according to claim 2, it is characterised in that contain restricted digestion position in the linker sequences Point BamH I.

4. gene vaccine according to claim 1 or 2, it is characterised in that the people CSF2 gene orders can be replaced Gene coded sequence or immunologic test the point albumen of B7.1 costimulatory moleculeses gene coded sequence, interleukins or interferon Inhibiting antibody gene coded sequence.

5. gene vaccine according to claim 1, it is characterised in that the carrier for expression of eukaryon is that any one can feed The carrier for expression of eukaryon of newborn zooblast or internal expression alien gene, including recombinant plasmid, bacterium, virus.

6. gene vaccine according to claim 5, it is characterised in that the carrier for expression of eukaryon be pVAX1, pSilence1.0-U6、pEGFP-N1、pCMV、pSV40、pSI、pCI、pCI-neo、pPICZα、pTEF1、pcDNA3.1、 Any of pcDNA, salmonella typhi, Listeria, adenovirus, adeno-associated virus, slow virus.

7. gene vaccine according to claim 1, it is characterised in that the gene vaccine can also include diluent, inhale Receive the one or more in accelerator, surfactant, liposome or nano particle.

8. the preparation method of any gene vaccine of claim 1~7, it is characterised in that comprise the following steps：

1) AFP genes are expanded from the recombinant plasmid template containing AFP gene orders and restriction enzyme site and linker is introduced, obtained AFP-linker；Wherein linker sequence is as shown in SEQ ID NO.3；

2) IRES sequences, the amplifying target genes from CSF2 template plasmid are expanded from containing IRES sequence plasmid carriers respectively CSF2, and in gene C SF2 downstreams addition restriction enzyme site Xba I；

3) sequence AFP-linker and IgG1Fc are spliced into by AFP-linker-Fc by Overlap PCR method respectively, will Sequence IRES and CSF2 are spliced into IRES-CSF2；

4) by homologous recombination, AFP-linker-Fc and IRES-CSF2 is stitched together and carrier pVAX1 is connected to, obtained Recombinant plasmid pVAX1-AFP-Linker-Fc-IRES-CSF2.

9. preparation method according to claim 8, it is characterised in that the specific primer of step 1 amplification AFP genes is：

Primer 1:5’-ACCCAAGCTGGCTAGCGTTTAAACTTAAGATGAAGTGGGTGGAATCAATTTTTTTA-3’

Primer 2:5’-GGATCCGCCGCCGCCAACTCCCAAAGCAGCACGAG-3’；

Step 2 amplification IRES sequences specific primer be：

Primer 3:5’-AGCCTCTCCCTGTCTCCGGGTAAAGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCG AAGCCGC-3’；

Primer 4:5’-AGCAGCAGGCTCTGCAGCCACATGGTTGTGGCCATATTATCATCGTG-3’；

Step 2 amplification CSF2 genes specific primer be：

Primer 5:5’-CACGATGATAATATGGCCACAACCATGTGGCTGCAGAGCCTGCTGCT-3’

Primer 6:5’-GATCAGCGGGTTTAAACGGGCCCTCTAGATCACTCCTGGACTGGCTCCCAGC-3’。

10. preparation method according to claim 8, it is characterised in that Overlap PCR spliced gene fragments in step 3 AFP-linker and Fc primer is：

Primer 7:5’-ACCCAAGCTGGCTAGCGTTTAAACTTAAGATGAAGTGGGTGGAATCAATTTTTTTA-3’

Primer 8:5’-GGATCCGCCGCCGCCAACTCCCAAAGCAGCACGAG-3’

Primer 9:5’-CTCGTGCTGCTTTGGGAGTTGACAAAACTCACACATGCCCACCG-3’

Primer 10:5’-GGGGGGGGGAGGGAGAGGGGCTTTACCCGGAGACAGGGAGAGGCT-3’；

Overlap PCR spliced genes fragment IRES and CSF2 primer are in step 3：

Primer 11:5’-AGCCTCTCCCTGTCTCCGGGTAAAGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCC GAAGCCGC-3’

Primer 12:5’-AGCAGCAGGCTCTGCAGCCACATGGTTGTGGCCATATTATCATCGTG-3’

Primer 13:5’-CACGATGATAATATGGCCACAACCATGTGGCTGCAGAGCCTGCTGCT-3’

Primer 14:5’-GATCAGCGGGTTTAAACGGGCCCTCTAGATCACTCCTGGACTGGCTCCCAGC-3’。

11. application of any gene vaccine of claim 1~7 in the vaccine for preparing preventing and treating overexpression AFP tumours.

12. application according to claim 11, it is characterised in that described overexpression AFP tumours are liver cancer.