CN107267638A - The molecular labeling and its method of a kind of quick breeding high-quality erect head rice varieties - Google Patents

The molecular labeling and its method of a kind of quick breeding high-quality erect head rice varieties Download PDF

Info

Publication number
CN107267638A
CN107267638A CN201710616190.3A CN201710616190A CN107267638A CN 107267638 A CN107267638 A CN 107267638A CN 201710616190 A CN201710616190 A CN 201710616190A CN 107267638 A CN107267638 A CN 107267638A
Authority
CN
China
Prior art keywords
molecular labeling
erect
quality
rice
seed
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710616190.3A
Other languages
Chinese (zh)
Inventor
周坤能
李泽福
夏加发
王元垒
马廷臣
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Rice Research Institute of Anhui Academy of Agricultural Sciences
Anhui Academy of Agricultural Sciences
Original Assignee
Rice Research Institute of Anhui Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rice Research Institute of Anhui Academy of Agricultural Sciences filed Critical Rice Research Institute of Anhui Academy of Agricultural Sciences
Priority to CN201710616190.3A priority Critical patent/CN107267638A/en
Publication of CN107267638A publication Critical patent/CN107267638A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Botany (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses a kind of molecular labeling of quick breeding high-quality erect head rice varieties and its method, the molecular labeling is that paddy rice erect head gene EP2 the 6th introne and the single base G of the 7th extron junction sport A, methods described is to pass through the molecular markers development dCAPs labeled primers, the method for recycling molecular marker assisted selection to be combined with traditional breeding way, quick breeding high-quality erect head rice varieties.The molecular labeling has polymorphism between F190 and multiple curved fringe parents, labeled primer EP2 dCAPs 1 can distinguish differential fragment between erect head donor parents F190 and curved fringe parent, compared with prior art, required fragment can quickly and accurately be imported, it is with clearly defined objective, shorten breeding cycle, it is cost-effective, effectively improve the efficiency of selection, can it is rapider, more accurately select the high erect panicle variety of yield potentiality.

Description

The molecular labeling and its method of a kind of quick breeding high-quality erect head rice varieties
Technical field
The present invention relates to the technical field of crop Biology Breeding, more particularly to a kind of quick breeding high-quality are straight The molecular labeling and its method of vertical fringe rice varieties.
Background technology
Paddy rice is the most important cereal crops of China, as the improvement of people's living standards, the demand to rice is more next It is bigger, due to the limitation of cultivated area, improve rice yield particularly important.Fringe type be influence rice yield key factor it One, improving fringe type structure contributes to the raising of rice yield.In Japonica two line hybrid rice, the seed selection of curved fringe type kind to erect panicle variety It is an important transformation, just has pointed out the Breeding Model of cultivation erect head japonica rice variety the beginning of the eighties early in eighties of last century, directly Vertical fringe kind is conducive to the raising of the efficiency of light energy utilization and the accumulation of photosynthate, shows higher yield potentiality；In recent years, educate Plant house and select a large amount of erect panicle varieties, and obtain the popularization and application of large area, important tribute is made that to improve paddy rice total yield Offer.
It is more crucial to the precise Identification of erect head character in erect panicle variety Breeding Process；Erect head character easily by The influence of environment and material Background, is likely to result in qualification result inaccurate using traditional method identification, and can not accurate area Divide erect head and half erect head character, waste time and energy simultaneously, therefore, how rapidly and accurately to identify that erect head character is particularly weighed Will.With the successive clone of paddy rice erect head gene, the seed selection for accelerating erect panicle variety using molecular marker assisted selection is entered Degree.However, because some kinds for containing erect head gene are usually associated with as spike length shortens, Spikelet density becomes close, grain number per spike The unfavorable yield traits such as reduce, therefore simple utilization molecular marker assisted selection tends not to obtain intended effect.
The content of the invention
It is an object of the invention to overcome the deficiencies of the prior art and provide a kind of quick breeding high-quality erect head paddy rice The molecular labeling and its method of kind, to overcome conventional upright fringe Characters Identification inaccurate, high-quality erect panicle variety breeding side Method such as wastes time and energy at the technical problem.
The present invention is achieved by the following technical solutions：
The invention provides a kind of molecular labeling of quick breeding high-quality erect head rice varieties, the molecular labeling is A paddy rice erect head gene EP2 equipotential mutator, the nucleotide sequence such as SEQ ID of the paddy rice erect head gene EP2 Shown in NO.1, the allelic variant gene for paddy rice erect head gene EP2 the 6th introne and the 7th extron junction (such as 2891st site of sequence shown in SEQ ID NO.1) single base G sport A, the mutation cause EP2 gene cDNAs shearing hair It is raw to change, and then the phenotype of erect head is formed, the sequence of the molecular labeling after mutation is as shown in SEQ ID NO.2；According to including The GU-AG rules of son and exon boundary line, two bases of beginning of each introne are GU (or GT), and most latter two is AG, i.e. the base of the 6th introne of the present invention and the 7th extron junction is AG, the base after mutation is AA.
Present invention also offers the method using above-mentioned molecular labeling quick breeding high-quality erect head rice varieties, including Following steps：
(1) using the curved fringe type rice varieties resisted high yield as female parent, by the erect panicle variety containing the molecular labeling more As male parent, by maternal and paternal hybrid, F is obtained1For seed；
(2) by F1Seedling is planted for seed, according to Heterosis, hybrid strain is removed, the excellent group of economical character is chosen Close, harvest F2For seed；
(3) by F2Begun sowing in good time for seed, individual plant is transplanted, it is that erect head or half are straight to choose within 30 days or so after heading phenotype The individual plant of vertical fringe, extracts its blade STb gene and carries out Molecular Identification, chooses the plant containing the molecular labeling and carries out individual plant room Interior species test, investigates spike length, mass of 1000 kernel, setting percentage and exterior quality, retains spike length in 17-21 centimetres, 24-28 grams of mass of 1000 kernel, knot Real rate is more than 88%, and the excellent individual plant of exterior quality, obtains F3For seed；
(4) by F3Pedigree is planted into for seed, continues to screen target variety according to the method for step (3), obtains F4In generation, plants Son；
(5) repeat step (3), (4), obtain FnFor seed, that is, it has been bred as containing the molecular labeling and has been improved through high yield High-quality erect head rice varieties.
Further, in the step (1), the curved fringe type rice varieties resisted high yield include more：Xu rice No. 3, southern round-grained rice 5055, Town rice 14, peaceful 1092, Jiahua-1, cultivate special glutinous No. 1, the erect panicle variety containing the molecular labeling is the mutation product of agriculture institute 238 Kind, it is named as F190.
Further, in the step (1), the preparation method of the erect panicle variety containing the molecular labeling lures for radiation Change method or site-directed point mutation method.
Further, in the step (3), the method for Molecular Identification is：Using rice leaf STb gene as template, for institute The mutational site design dCAPS labeled primers of molecular labeling are stated, and as specificity amplification primer, enter performing PCR amplification, with limitation Property endonuclease digestion PCR primer, identification plant DNA genomes in whether contain the molecular labeling.
Further, the dCAPS labeled primers are EP2-dCAPs-1, and its nucleotide sequence is as follows：
SEQ ID NO.3：EP2-dCAPs-1F：GACAACTTTTTTTTTTTGGGTATCCG
SEQ ID NO.4：EP2-dCAPs-1R：ATAGATTTGTTGCTGGATGCACCTT；
The restriction enzyme is HpaII；
The authentication method is：If digestion band is 189bp, the rice plant is without the pure of the molecular labeling Zoarium, if digestion band is 213bp, the rice plant is the homozygote containing the molecular labeling, if digestion band Including two characteristic bands of 189bp and 213bp, then the rice plant is the heterozygote containing the molecular labeling；
Further, in shown step (5), FnIt is >=F for seed5For seed.
Further, methods described also includes step (6), by FnAs parent carry out plus be commissioned to train for seed and be foster, obtain steady Fixed high-quality erect head rice varieties.
The present invention has advantages below compared with prior art：The present invention is dashed forward by developing paddy rice erect head gene EP2 equipotentials There is provided a kind of molecule mark of quick breeding high-quality erect head rice varieties by change and its dCAPs labeled primers EP2-dCAPs-1 Note and its method, labeled primer EP2-dCAPs-1 can be distinguished between erect head donor parents F190 and curved fringe parent Differential fragment, fragment needed for quickly and accurately importing, realizes erect head gene EP2 hereditary transformation；The molecule that the present invention is used Marking EP2-dCAPs-1 is formed according to EP2 gene internal sequences Designs, and testing result is accurate, reliable, while the molecular labeling There is polymorphism between F190 and multiple curved fringe parents, the erect head seed selection of various combination offspring is can be widely applied to；It is conventional Erect panicle variety seed selection is easily influenceed by environment and material genetic background, and this method combines tradition using molecular marker assisted selection Breeding method, it is with clearly defined objective, shorten breeding cycle, it is cost-effective, the efficiency of selection is effectively improved, can be rapider, more accurate Really select the high erect panicle variety of yield potentiality.
Brief description of the drawings
Fig. 1 is the polyacrylamide gel electrophoresis result that Single-plant selection is carried out using EP2-dCAPs-1 labeled primers.Wherein M is Marker, 1 is the parent F190 of the allele of EP2 containing erect head, and 2 be curved fringe parent Jiahua-1, and 3-12 is parent 190 and good Spend the progeny selection individual plant of No. 1；HpaII (-) does not add HpaII inscribe ferment treatments, HpaII (+) after representing EP2-dCAPs-1 amplifications HpaII inscribe ferment treatments are added after representing EP2-dCAPs-1 amplifications.
Fig. 2 is the agarose electrophoresis result that Single-plant selection is carried out using EP2-dCAPs-1 labeled primers.Wherein M is Marker, 1 is the parent F190 of the allele of EP2 containing erect head, and 2 be curved fringe parent Jiahua-1, and 3-12 is parent 190 and good Spend the progeny selection individual plant of No. 1；HpaII (-) does not add HpaII inscribe ferment treatments, HpaII (+) after representing EP2-dCAPs-1 amplifications HpaII inscribe ferment treatments are added after representing EP2-dCAPs-1 amplifications.
Fig. 3 is the high-quality erect panicle variety cultivated and the phenotype comparative result of parent.Wherein 1 is erect head parent F190,2 be curved fringe parent Jiahua-1, the offspring containing the molecular labeling that 3-6 cultivates for the present invention.
Embodiment
Embodiment 1
1st, material
The present embodiment method therefor is known to those skilled in the art the conventional method of dawn unless otherwise instructed, used The material such as reagent, unless otherwise instructed, be commercially available products, involved germ plasm resource unless otherwise instructed, is come Come from China national Germplasm Bank.
2nd, method
The acquisition of 2.1 erect panicle varieties containing the molecular labeling
Radioinduction is carried out to agriculture institute 238, the mutant F190 of an erect head phenotype, the mutant and wild type is found Become short compared to plant height, spike length and grain type shorten, grain and become close, plant type is compacter, and single plant yield declines not notable.Further utilize The mode of map based cloning find to control the gene of the erect head phenotype and EP2 genes be in allele, F190 EP2 genes at it 6th introne and the 7th extron, which couple, to have a single base G to sport A, the erect head product as containing the molecular labeling Kind, the kind is preserved by Paddy Rice Inst., Anhui Agriculture Science Academy at present, and Paddy Rice Inst., Anhui Agriculture Science Academy promises to undertake To the public kind can be provided by ad hoc fashion.
Erect panicle variety containing the molecular labeling can also be obtained by other means, such as Chinese Academy of Sciences Shanghai plant What the seminar of stress biology research center health research person Zhu leader researched and developed can be to Plant Genome locator qualification CRISPR-Cas technologies, the technology can enter edlin, researcher's direct mutagenesis paddy rice, plan south to any site in genome Multiple genes of mustard, all obtain higher mutation rate, and obtain pure and mild and chimeric mutant in the first generation, and show expection Mutant phenotype.
The preparation method of erect panicle variety containing the molecular labeling is not limited to above two mode, and other are resulted in The method of erect panicle variety containing the molecular labeling, belongs to protection scope of the present invention.
2.2 design of primers
According to the allelic variant site of the molecular labeling, online design software is marked using dCAPs, 3 couples of dCAPs are devised Labeled primer, polymorphism screening is carried out using this 3 pairs of dCAPs labeled primers between F190 and other curved fringe parents, is found only Have EP2-dCAPs-1 labeled primers F190 and Xu rice No. 3, southern round-grained rice 5055, town rice 14, peaceful 1092, Jiahua-1, cultivate special glutinous No. 1 There are polymorphic differences between kind, the seed selection of erect head rice varieties is carried out using F190 and above-mentioned 6 kinds of kinds, it is described The nucleotides sequence of EP2-dCAPs-1 labeled primers is classified as：
SEQ ID NO.3：EP2-dCAPs-1F：GACAACTTTTTTTTTTTGGGTATCCG
SEQ ID NO.4：EP2-dCAPs-1R：ATAGATTTGTTGCTGGATGCACCTT；
2.3 seed selection high-quality erect panicle varieties
(1) by curved fringe kind Xu rice No. 3 of high yield and high quality, peaceful 1092, Jiahua-1, cultivate special glutinous No. 1 and make maternal respectively, contain The erect panicle variety F190 for having the molecular labeling makees male parent, positive season in 2014 in Hefei combo, F is obtained respectively120, seed with On.
(2) 2014 year winter planted F in Hainan Lingshui1Hybrid seed, removes hybrid strain, mixes receive F respectively2For seed.
(3) 2015 years positive seasons planted F in Hefei2For more than 2000 plants of colony, heading choose within 30 days or so erect heads or Half erect head individual plant, numbering sampling, selects 132 plants of individual plant altogether；Drawn using the EP2-dCAPs-1 marks of the molecular labeling interior Thing is screened, and 97 parts of the individual plant containing homozygosis or hybrid molecule mark is detected altogether；Indoor species test is carried out to this 97 parts of individual plants, Spike length, mass of 1000 kernel, setting percentage and exterior quality are investigated, retains spike length at 17-21 centimetres, 24-28 grams of mass of 1000 kernel, setting percentage exists More than 88%, and the preferable individual plant of exterior quality, with compareing when round-grained rice 8 compares, filter out 32 parts of satisfactory individual plants, i.e. F3 For seed.
Wherein, the method that the indoor EP2-dCAPs-1 labeled primers using the molecular labeling are screened, including it is following Step：
1. rice leaf STb gene is extracted using CTAB methods, using rice leaf STb gene as template, with dCAPS as follows Labeled primer is specificity amplification primer, enters performing PCR amplification, detects and reclaim pcr amplification product；
DCAPS labeled primer sequences：
SEQ ID NO.3：EP2-dCAPs-1F：GACAACTTTTTTTTTTTGGGTATCCG
SEQ ID NO.4：EP2-dCAPs-1R：ATAGATTTGTTGCTGGATGCACCTT；
PCR reaction systems：
PCR amplification Taq polymerases are purchased from Promega companies, and reaction system is 20uL：Template DNA is 50-200ng (2- 4uL), each 1uL of front and rear primer, 10 × PCR Buffer 2uL, 25mM MgCl21.2uL, 1mM dNTP mixed liquor 0.6uL, Taq enzyme 0.2uL, plus ddH2O is mended to 20uL；
PCR reaction conditions：
94 DEG C of pre-degeneration 5min；94 DEG C of 30s, 56 DEG C of annealing 30s, 72 DEG C of 30s, 34 circulations；72 DEG C extend 5min, 4 DEG C 10min；
2. by amplified production restriction endonuclease HpaII digestions, further Zone electophoresis slitting band；Wherein：
HpaII restriction endonucleases are purchased from NEB companies；
Endonuclease reaction system is 20uL, including：PCR primer 10uL, HpaII restriction endonuclease 1uL, 10 × NEBuffer 2uL, Plus ddH2O is mended to 20uL；
Endonuclease reaction condition is：37 DEG C of 15min, 4 DEG C of preservations；
Electrophoretic detection be polyacrylamide gel electrophoresis or agarose gel electrophoresis, wherein, acrylamide gel electricity Swim gel preparation course it is complex, but its once can detect sample size it is more；Agarose gel electrophoresis gel prepares more simple It is single, but one-time detection sample is less；Therefore utilize polyacrylamide gel electrophoresis method, sample when detecting that sample number is more than 300 Number utilizes agarose gel electrophoresis method for detecting less than 300.
Electrophoresis detection result as shown in Figure 1, 2, wherein：Pcr amplification product is 213bp, and digestion products band is 189bp Rice plant be the homozygote without the molecular labeling, the rice plant that digestion products band is 213bp be containing described The homozygote of molecular labeling, the rice plant that digestion products band includes two characteristic bands of 189bp and 213bp is containing described The heterozygote of molecular labeling.
(4) 2015 year winter planted the 32 parts of strains filtered out in Hainan Lingshui, and pedigree is planted, per 72 plants of cell, 9 plants × 8 rows, individual plant sampling, (the same step of method is screened in interior using the EP2-dCAPs-1 labeled primers of the molecular labeling (3)), the mixed seed (50 seeds of every plant of receipts) for receiving the individual plant containing the molecular labeling of each cell, i.e. F4For seed.
(5) 2016 years positive seasons planted F in Hefei432 parts of strains of generation, pedigree plantation, per 72 plants of cell, 9 plants × 8 rows, heading 30 days or so field strains relatively eliminate 15 parts of strains, remaining strain field character observation, 114 parts of economical characters of final choice compared with Good individual plant, numbering sampling；The indoor EP2-dCAPs-1 labeled primers using the molecular labeling are screened, and (method is synchronous Suddenly (3)), 87 parts of the individual plant containing homozygosis or heterozygosis EP2 allele is detected altogether, further interior species test (the same step of method (3)), with compareing when round-grained rice 8 compares, 21 parts of satisfactory individual plants are filtered out, wherein 8 parts contain homozygosis EP2 allele, i.e., F5For seed.
(6) 2016 year winter planted the seed of screening in Hainan Lingshui, that is, obtained the high-quality erect head rice varieties, Plus for more stable F6 is obtained for strain, mix receive 1 jin of seed respectively, carry out the variety comparative test of next step, so far, high-quality is upright The seed selection work of fringe rice varieties is completed.
Fig. 3 is that with parent F190, curved fringe parent Jiahua-1 phenotype the high-quality erect head rice varieties of seed selection are compared into knot Really, found in combination with variety comparative test result, the rice varieties of seed selection of the present invention are compared with parent F190, Jiahua-1, individual plant production Amount and phenotype have clear improvement.
Be above a kind of detailed embodiment of the invention and specific operating process, be using technical solution of the present invention before Put and implemented, but protection scope of the present invention is not limited to the above embodiments.
SEQUENCE LISTING
<110>Paddy Rice Inst., Anhui Agriculture Science Academy
<120>The molecular labeling and its method of a kind of quick breeding high-quality erect head rice varieties
<130> /
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 7098
<212> DNA
<213> Oryza sativa
<400> 1
atggagcccg acgccccgct cgacttcgcg ctcttccagc tctccccgcg ccgctcgcgg 60
tgaggatttc gattgggggg gggggggggg gtggtgttcg tcctgtgggt gtttgctaat 120
ggtgggatgc ctccgctgca ggtgcgagct ggtggtgtcc gggaatgggc ggacggagag 180
gatcgcgtcc gggtcggtga agccgttcgt ggcgcacctg cgcgcggcgg aggagcaggc 240
ggcggcgcag ccgccgccgc cggccatccg gctgcagctg gaccgccgcg ccgcgtggtt 300
cagcaagggc accctcgaga ggtccgtttg ctgccgtggc agttattggg ttggttggtg 360
gtgtggagaa ttcggggaga aaaagaaatg atgggaattc tgagaggtgt tcttgtggtt 420
gaaggttcgt gcggttcgtg agcacgccgg aggtgctgga gatggctaac accttcgacg 480
cggagatgtc gcagctggaa ggggctagga agatttatgc acagggagtg agtggccaaa 540
gttttctttt ctatattttc tttcagttgt ggagtgtgtt taggttgtgt ggtttatggt 600
ggaatgatct tgcagttgtt ctaaaaatag tattatgctg tacgcaggtt gccggaggcg 660
ctgatggagc tggtatgcat gacaatgttt atagtgttct tttgtttgtc gaatggggtt 720
ttgagtctcg ttcgattagt tttatgcctg tttttgttca tagttcatat gtcactcagt 780
ttatctacac ttgaattgag tcgaatcgcg actcgagtgc cttcacaagt tatttgtggg 840
aacatccagg gagaactttt attattgatt ggcttgatta ctgagatgat gcattcaatg 900
ccactgtcca tattattcat gctgtgaagc tttgttaatg ggggaataca gtaaataatc 960
catttccaat tttagaaaga aatgaacaac ttaattaatt gttgcatgtg ttgaactgca 1020
atattagggt acatgtttta tcgttttaac atgccttcat tgaggcaaca tattgttctt 1080
ctcaacacaa tttgcttacc atcttacaaa tttttttttc ccgggtgaaa atgttgcaga 1140
atcagcagca gctgcagata ttacgaagta tgcttctatg ccatctctgt cattatctat 1200
ttacttcttc attgtccgat aaccttgatt taagtgagtt gaacatggtt aacccttact 1260
tcttcaggga gaaccttgat tgttatcaat ttcagtcaat gatatatgat ttgttaggac 1320
tgttctatat ataagaaatg gttggttaag aactattcat gacatcgtac taaatacgga 1380
gtggagatgc ctgtgtcaga atactttaac atgactagta tttcgggcgt tccttgatga 1440
actgtttaat gcttattctg tctcaggggc ctttcatgat cattttccct tttcggttgc 1500
ttggggtgta gcaaactgtg ttcatccttt catctgttta ctatgcttaa ggacatcttt 1560
tgtttcggct tacaacatta taaaaacttg atgttcttaa ttgaatatta gtaaaattgt 1620
tgcagtcatg tagcaatgtg atctgctgca aattttggta gacaaactca tcgcttgaat 1680
atgtagattg tagaatacta tgataattag ataaaggtga aatgcttgat ctcttttggt 1740
tatgtgggtc agtgctgtta agagccctag ttatatagct ttacacaaat gagcacttac 1800
atccacgcat gcaccaaaac cttattttat tatcgttgtg tatttctaca tcattaattc 1860
agtctcttgc ttatgcttta ctaattaaag ttgttgctaa agcatcgcta tcagtagtat 1920
aggacttaca cataatagct ggtagaatat aaatgattat actgtttcat ctgtactcag 1980
tcttaaagtt ataattcctt acaaatggca ctgtgtaaat catacaaaat atagttgtct 2040
gtactacttc atcacgtata acttgaaact tactgtaatt tgcatataaa gttagccatt 2100
tttgtattgt cagtatccaa agttgatgcc ctggcctttt tttttttcta tgcaggaagg 2160
aacttcttag agcgattgat gttcgtctaa gtgctcttaa acaagacctt gtcacggctt 2220
gtgcccgggc atcatctgca gggttcaacc ctgacagtgt ttctgagctt gttctttttg 2280
cagatcattt tggtgccaac cggctgaggt atgattggaa cttaacaagt tcataattta 2340
ggttctaggt gtcatcattt atatttactt aaagaataca tttcacagaa cttcagacac 2400
tttaatagaa aagccacata aaactataga tttagaacta aataactcac aaaactactg 2460
gtatctgtag agagaaagat tatcattaac ttttacaaat gccattatat tgcgcactaa 2520
attgtaccta gctcacctca aacttgtaca gtatgatgga aagctatgaa catacaaact 2580
tcagaattgc agtttaggac acacataaac ttcaaacacc ctaaggttat tatggaaaag 2640
tggtaaagtt tgcatgagaa gattcttcaa tgtactagga gggagatcat ttgaagtgga 2700
atcttatatc agattcagtt gtgcacacct atatgttccc aattcatcct tatactgtgg 2760
ttgccatgat agcattgcga cattgagtta ccctctgtcc cactcgtttt gtttctcgga 2820
ggatcctttt gtgacctctt gatgattatt ttttgtgcac acatgacaac tttttttttt 2880
tgggtatcca gtgaagcatg caacaaattc atgtcacttt gccagcggcg tccagacatc 2940
tgtcctcatt actcggtgtc atcaacttcg tcacaatgga agagctttga tgatggaaat 3000
gtccgtggct cctccagttc agacatgtca ctagacgaga cacaagctga tcaaggtgca 3060
tccagcaaca aatctataat tggtggtagt gtctctcata ttcacagaag caacagccaa 3120
aactcagtag atgttccacc agaacccagc gcagttcaac accctaaacc aactatacag 3180
cagtcagtag agaaacaaga aaaggaaaca gatgctcttc ctgcccctgc cccagctgga 3240
gggggttcaa gacggttgag tgtgcaagac aggataaaca tgtttgagag taagcagaag 3300
gaacaaacct caagttctgg taatagtgct gcatgtacta gtaaggtggt tccaacgaaa 3360
ggtgagcacc gcagggtgcc ttctggtgcg tccatggaca agttggtaag gaggtggagc 3420
aatgtaagtg atatgagcat tgatctaagc aacaacgata gcagcagctt aaatgaaaag 3480
agggaaattg gaacccctgt tggaacccca acatctgcca atttggaggt taattctaag 3540
gcaagagctg acggggacgc taatgggctg aagcatgcag ttacatcatg ccaaaaagat 3600
acatctgatg ccttaccctt ggattctacc actgcagatg ctttctcatc ctcaactttg 3660
aatactacct caccatcccc cttatcagcc atcgcttctt cttctcctca gaaacagacc 3720
gcacctcgtg tggaagatga catggttata acctctagca ttgagagtga gtcatccttc 3780
agaaaggagg taggggctag tcaaggaaaa ggtgacgtga ggatgtcagg gcaagctgtt 3840
tcaagtgttt ccactcgagc ccgagtaaaa acatctccaa ggccaacatg gccagaaaac 3900
aatgtaactt taagtagccc accattgtca caggagcatg tacagatgac cgatgaggaa 3960
actattccca ttgttcatga agtagcagtt aaaaaggaac agattgtaca gaaagataat 4020
agaggttctc gtctccgttc taaagagatt catgctgaag cagatgtggt tggaaggaag 4080
gaccgaccct ctcgaacaac tggaaagata tctgatacca gaacaagggc cacctccaac 4140
ccacgtgcta attttagggg ttcatctgtc agggatgaag ctgcctctac agaagctgaa 4200
gttcatgatg ttaacttgca acggaaaagt ctagcgcgga aggtagagga ttctgggaga 4260
aaggttgcag ctggctctga aatactgcct caatcagatt gttctattca tcagggaact 4320
aatttgagca gacaatcatc cagtgctgaa caggaattga gtttgcatgg aggtaaagtc 4380
aaattaatta gtgatggaaa tgctgttcct ttggagcaga ctaagagacc gacaaaaggt 4440
agtcaagatc ggcatgatga actgcaaaag aaagccaatg aattggagaa gctatttgct 4500
gcacagaagc taacctcttc taggagaggc aagtcaactg atgtgcaggt tgagaacaca 4560
cccagggtga atgaggtaaa gcctccactg gttcttccag agaggattta tacaaagcaa 4620
attgtaaagg agagtataac caatgagttc gatgccaatg agcttttaaa gatggtggat 4680
actgaagggt ataacaataa cgtaccacaa agcattatta gcttagaaga gtcaagggga 4740
aagttctatg atcaatatat gcagaagagg gatgcaaaac taaaggaaga ttggaagctg 4800
caaggagaac agaaggaagc aacaataaag gcaatgcgtg atagcctaga acgaagcaat 4860
gctgagatgc gggccaaatt ctctcggtct tcaagtgttc ctgattcaac atatatttct 4920
cgttgcgctc ataagtttcc tcctttgcaa tcagttataa aggataagga tcaggtatta 4980
aattctactt atagcagttt ttaagtagaa aacagtagta cagaaaatta cttaactaca 5040
cacccttagt gcattgatgt gatttatact gaaggttgtt tttttatgta aaaaaattta 5100
atactaaaca atcatgatat gtgtatcttg aggagcccat aaggctataa ttctacgcaa 5160
agtgaaatga tgagttgtag tttatggttg tttatatttt tgattttgcc tttcccaggg 5220
gatagattcc ttcttggtag aagaagaaat gaatagtgac tatctatctg gtgatggttc 5280
atccaggagt gctgattcca ggaagcattt ttcaaataaa gttgcctgca atcaaaagaa 5340
gtctattgct cctgttcata ggcattcatc aaggaccgta agctctggtt atgcaaaccg 5400
taggaatcta ccagataatc ctcttgcaca gtctgtcccc aatttcgcgg acttaagaaa 5460
agaaaataca aagccctcag ctggtctgag cagagctgct ccaaggaccc agccaaaaag 5520
ttttatccgt agtaagagca tcattgaaga gagtaagaat atatcaaaag atcaatcgag 5580
gaaatcacag tccatgagga agaacttaag tcctggtgaa ttaagggacg ctacatccat 5640
gaatgacgtc atatacaatt gggctccctc aaaaatttcc aatgatcaag ttgagggagt 5700
ttttgcttat atcacccata cagctggttc aaccaagtct tttctcagga aaggcaatga 5760
ggctcaccct gctgtcggta tagctggatt tgctcctcct atgtttgcaa atacctacca 5820
gaatggagat gatgacgatt ttctagatca ggaagaagac tccccagatg agaccaaaga 5880
tgaagaatat gaaagcattg aagagaatct tagggagagc gattttcctg ctgactcaga 5940
cagtgagaat ccaggaataa gtcatgaatt tggaaattca gatgacccag gatcagaaaa 6000
tggtgatgtt tcttttccaa gtgacgcacc cactcttggt ggttccaagt tcaatgcttt 6060
tgcaggaaac atgcatgata cacctggtga agtaccagca tcatggagca cacgcccaca 6120
cctattcgct tatgcaaatg ataactcaga tggtgatgct tttgctgatt caccaaatgg 6180
aagtccatca ccatggaatt ctcatacttt agatcaaata acagatgctg atgtttcccg 6240
gatgaggaag aagtggggca gcgctcagat gcctttcgtt ggtcccaatg catctcaaca 6300
gccgcggaaa gatgttacaa aaggatttaa gaagctattg aaatttggga ggaagacacg 6360
aggtgctgat ggtttaaatg attgggtatc cgcttcaact gcctcggaat gtgacgatga 6420
tatggaagat ggacgagatt tggccatggg atcttctgat gatttcagga agtcaagaat 6480
gggttatcct tctgcatatg atggttttgt tgataccgat gtttttgctg aacaaggtat 6540
tttcgcttgc cgatttatct ccactctctg tttccattgt caacaaaagt ccctacttat 6600
tggtgacgtt cgaggaaccc cctccaaagg accagaccca aaacttgaat aaaagaatat 6660
gatttcctag attgtcatat tcatgtgatc ttgaaagtat ttttttttct cattcatgtg 6720
ttttccttac ctcattcatt aactctttgc tatacacact tgtctgctta gttttgcaca 6780
cccgtttaat taatttttta atttgcagac caatcacttc gcagctccat tccaaatccc 6840
cctgcaaatt tcagattgag ggaggatcaa ctcactggaa gctcacttaa aggtacactt 6900
acagttacag atatatacta ctagtacctt atttttttta ttttaagttg ctaatgtacc 6960
acataacata tgaagttttt gcttcttatt tctgtctatc aatattaata tgttctcccc 7020
ccaaaaaatg cagcaccgcg atcgttcttc tccctctcaa cgtttcgtag caaggggggt 7080
gatgcaaggc tcaggtga 7098
<210> 2
<211> 7098
<212> DNA
<213> Oryza sativa
<400> 2
atggagcccg acgccccgct cgacttcgcg ctcttccagc tctccccgcg ccgctcgcgg 60
tgaggatttc gattgggggg gggggggggg gtggtgttcg tcctgtgggt gtttgctaat 120
ggtgggatgc ctccgctgca ggtgcgagct ggtggtgtcc gggaatgggc ggacggagag 180
gatcgcgtcc gggtcggtga agccgttcgt ggcgcacctg cgcgcggcgg aggagcaggc 240
ggcggcgcag ccgccgccgc cggccatccg gctgcagctg gaccgccgcg ccgcgtggtt 300
cagcaagggc accctcgaga ggtccgtttg ctgccgtggc agttattggg ttggttggtg 360
gtgtggagaa ttcggggaga aaaagaaatg atgggaattc tgagaggtgt tcttgtggtt 420
gaaggttcgt gcggttcgtg agcacgccgg aggtgctgga gatggctaac accttcgacg 480
cggagatgtc gcagctggaa ggggctagga agatttatgc acagggagtg agtggccaaa 540
gttttctttt ctatattttc tttcagttgt ggagtgtgtt taggttgtgt ggtttatggt 600
ggaatgatct tgcagttgtt ctaaaaatag tattatgctg tacgcaggtt gccggaggcg 660
ctgatggagc tggtatgcat gacaatgttt atagtgttct tttgtttgtc gaatggggtt 720
ttgagtctcg ttcgattagt tttatgcctg tttttgttca tagttcatat gtcactcagt 780
ttatctacac ttgaattgag tcgaatcgcg actcgagtgc cttcacaagt tatttgtggg 840
aacatccagg gagaactttt attattgatt ggcttgatta ctgagatgat gcattcaatg 900
ccactgtcca tattattcat gctgtgaagc tttgttaatg ggggaataca gtaaataatc 960
catttccaat tttagaaaga aatgaacaac ttaattaatt gttgcatgtg ttgaactgca 1020
atattagggt acatgtttta tcgttttaac atgccttcat tgaggcaaca tattgttctt 1080
ctcaacacaa tttgcttacc atcttacaaa tttttttttc ccgggtgaaa atgttgcaga 1140
atcagcagca gctgcagata ttacgaagta tgcttctatg ccatctctgt cattatctat 1200
ttacttcttc attgtccgat aaccttgatt taagtgagtt gaacatggtt aacccttact 1260
tcttcaggga gaaccttgat tgttatcaat ttcagtcaat gatatatgat ttgttaggac 1320
tgttctatat ataagaaatg gttggttaag aactattcat gacatcgtac taaatacgga 1380
gtggagatgc ctgtgtcaga atactttaac atgactagta tttcgggcgt tccttgatga 1440
actgtttaat gcttattctg tctcaggggc ctttcatgat cattttccct tttcggttgc 1500
ttggggtgta gcaaactgtg ttcatccttt catctgttta ctatgcttaa ggacatcttt 1560
tgtttcggct tacaacatta taaaaacttg atgttcttaa ttgaatatta gtaaaattgt 1620
tgcagtcatg tagcaatgtg atctgctgca aattttggta gacaaactca tcgcttgaat 1680
atgtagattg tagaatacta tgataattag ataaaggtga aatgcttgat ctcttttggt 1740
tatgtgggtc agtgctgtta agagccctag ttatatagct ttacacaaat gagcacttac 1800
atccacgcat gcaccaaaac cttattttat tatcgttgtg tatttctaca tcattaattc 1860
agtctcttgc ttatgcttta ctaattaaag ttgttgctaa agcatcgcta tcagtagtat 1920
aggacttaca cataatagct ggtagaatat aaatgattat actgtttcat ctgtactcag 1980
tcttaaagtt ataattcctt acaaatggca ctgtgtaaat catacaaaat atagttgtct 2040
gtactacttc atcacgtata acttgaaact tactgtaatt tgcatataaa gttagccatt 2100
tttgtattgt cagtatccaa agttgatgcc ctggcctttt tttttttcta tgcaggaagg 2160
aacttcttag agcgattgat gttcgtctaa gtgctcttaa acaagacctt gtcacggctt 2220
gtgcccgggc atcatctgca gggttcaacc ctgacagtgt ttctgagctt gttctttttg 2280
cagatcattt tggtgccaac cggctgaggt atgattggaa cttaacaagt tcataattta 2340
ggttctaggt gtcatcattt atatttactt aaagaataca tttcacagaa cttcagacac 2400
tttaatagaa aagccacata aaactataga tttagaacta aataactcac aaaactactg 2460
gtatctgtag agagaaagat tatcattaac ttttacaaat gccattatat tgcgcactaa 2520
attgtaccta gctcacctca aacttgtaca gtatgatgga aagctatgaa catacaaact 2580
tcagaattgc agtttaggac acacataaac ttcaaacacc ctaaggttat tatggaaaag 2640
tggtaaagtt tgcatgagaa gattcttcaa tgtactagga gggagatcat ttgaagtgga 2700
atcttatatc agattcagtt gtgcacacct atatgttccc aattcatcct tatactgtgg 2760
ttgccatgat agcattgcga cattgagtta ccctctgtcc cactcgtttt gtttctcgga 2820
ggatcctttt gtgacctctt gatgattatt ttttgtgcac acatgacaac tttttttttt 2880
tgggtatcca atgaagcatg caacaaattc atgtcacttt gccagcggcg tccagacatc 2940
tgtcctcatt actcggtgtc atcaacttcg tcacaatgga agagctttga tgatggaaat 3000
gtccgtggct cctccagttc agacatgtca ctagacgaga cacaagctga tcaaggtgca 3060
tccagcaaca aatctataat tggtggtagt gtctctcata ttcacagaag caacagccaa 3120
aactcagtag atgttccacc agaacccagc gcagttcaac accctaaacc aactatacag 3180
cagtcagtag agaaacaaga aaaggaaaca gatgctcttc ctgcccctgc cccagctgga 3240
gggggttcaa gacggttgag tgtgcaagac aggataaaca tgtttgagag taagcagaag 3300
gaacaaacct caagttctgg taatagtgct gcatgtacta gtaaggtggt tccaacgaaa 3360
ggtgagcacc gcagggtgcc ttctggtgcg tccatggaca agttggtaag gaggtggagc 3420
aatgtaagtg atatgagcat tgatctaagc aacaacgata gcagcagctt aaatgaaaag 3480
agggaaattg gaacccctgt tggaacccca acatctgcca atttggaggt taattctaag 3540
gcaagagctg acggggacgc taatgggctg aagcatgcag ttacatcatg ccaaaaagat 3600
acatctgatg ccttaccctt ggattctacc actgcagatg ctttctcatc ctcaactttg 3660
aatactacct caccatcccc cttatcagcc atcgcttctt cttctcctca gaaacagacc 3720
gcacctcgtg tggaagatga catggttata acctctagca ttgagagtga gtcatccttc 3780
agaaaggagg taggggctag tcaaggaaaa ggtgacgtga ggatgtcagg gcaagctgtt 3840
tcaagtgttt ccactcgagc ccgagtaaaa acatctccaa ggccaacatg gccagaaaac 3900
aatgtaactt taagtagccc accattgtca caggagcatg tacagatgac cgatgaggaa 3960
actattccca ttgttcatga agtagcagtt aaaaaggaac agattgtaca gaaagataat 4020
agaggttctc gtctccgttc taaagagatt catgctgaag cagatgtggt tggaaggaag 4080
gaccgaccct ctcgaacaac tggaaagata tctgatacca gaacaagggc cacctccaac 4140
ccacgtgcta attttagggg ttcatctgtc agggatgaag ctgcctctac agaagctgaa 4200
gttcatgatg ttaacttgca acggaaaagt ctagcgcgga aggtagagga ttctgggaga 4260
aaggttgcag ctggctctga aatactgcct caatcagatt gttctattca tcagggaact 4320
aatttgagca gacaatcatc cagtgctgaa caggaattga gtttgcatgg aggtaaagtc 4380
aaattaatta gtgatggaaa tgctgttcct ttggagcaga ctaagagacc gacaaaaggt 4440
agtcaagatc ggcatgatga actgcaaaag aaagccaatg aattggagaa gctatttgct 4500
gcacagaagc taacctcttc taggagaggc aagtcaactg atgtgcaggt tgagaacaca 4560
cccagggtga atgaggtaaa gcctccactg gttcttccag agaggattta tacaaagcaa 4620
attgtaaagg agagtataac caatgagttc gatgccaatg agcttttaaa gatggtggat 4680
actgaagggt ataacaataa cgtaccacaa agcattatta gcttagaaga gtcaagggga 4740
aagttctatg atcaatatat gcagaagagg gatgcaaaac taaaggaaga ttggaagctg 4800
caaggagaac agaaggaagc aacaataaag gcaatgcgtg atagcctaga acgaagcaat 4860
gctgagatgc gggccaaatt ctctcggtct tcaagtgttc ctgattcaac atatatttct 4920
cgttgcgctc ataagtttcc tcctttgcaa tcagttataa aggataagga tcaggtatta 4980
aattctactt atagcagttt ttaagtagaa aacagtagta cagaaaatta cttaactaca 5040
cacccttagt gcattgatgt gatttatact gaaggttgtt tttttatgta aaaaaattta 5100
atactaaaca atcatgatat gtgtatcttg aggagcccat aaggctataa ttctacgcaa 5160
agtgaaatga tgagttgtag tttatggttg tttatatttt tgattttgcc tttcccaggg 5220
gatagattcc ttcttggtag aagaagaaat gaatagtgac tatctatctg gtgatggttc 5280
atccaggagt gctgattcca ggaagcattt ttcaaataaa gttgcctgca atcaaaagaa 5340
gtctattgct cctgttcata ggcattcatc aaggaccgta agctctggtt atgcaaaccg 5400
taggaatcta ccagataatc ctcttgcaca gtctgtcccc aatttcgcgg acttaagaaa 5460
agaaaataca aagccctcag ctggtctgag cagagctgct ccaaggaccc agccaaaaag 5520
ttttatccgt agtaagagca tcattgaaga gagtaagaat atatcaaaag atcaatcgag 5580
gaaatcacag tccatgagga agaacttaag tcctggtgaa ttaagggacg ctacatccat 5640
gaatgacgtc atatacaatt gggctccctc aaaaatttcc aatgatcaag ttgagggagt 5700
ttttgcttat atcacccata cagctggttc aaccaagtct tttctcagga aaggcaatga 5760
ggctcaccct gctgtcggta tagctggatt tgctcctcct atgtttgcaa atacctacca 5820
gaatggagat gatgacgatt ttctagatca ggaagaagac tccccagatg agaccaaaga 5880
tgaagaatat gaaagcattg aagagaatct tagggagagc gattttcctg ctgactcaga 5940
cagtgagaat ccaggaataa gtcatgaatt tggaaattca gatgacccag gatcagaaaa 6000
tggtgatgtt tcttttccaa gtgacgcacc cactcttggt ggttccaagt tcaatgcttt 6060
tgcaggaaac atgcatgata cacctggtga agtaccagca tcatggagca cacgcccaca 6120
cctattcgct tatgcaaatg ataactcaga tggtgatgct tttgctgatt caccaaatgg 6180
aagtccatca ccatggaatt ctcatacttt agatcaaata acagatgctg atgtttcccg 6240
gatgaggaag aagtggggca gcgctcagat gcctttcgtt ggtcccaatg catctcaaca 6300
gccgcggaaa gatgttacaa aaggatttaa gaagctattg aaatttggga ggaagacacg 6360
aggtgctgat ggtttaaatg attgggtatc cgcttcaact gcctcggaat gtgacgatga 6420
tatggaagat ggacgagatt tggccatggg atcttctgat gatttcagga agtcaagaat 6480
gggttatcct tctgcatatg atggttttgt tgataccgat gtttttgctg aacaaggtat 6540
tttcgcttgc cgatttatct ccactctctg tttccattgt caacaaaagt ccctacttat 6600
tggtgacgtt cgaggaaccc cctccaaagg accagaccca aaacttgaat aaaagaatat 6660
gatttcctag attgtcatat tcatgtgatc ttgaaagtat ttttttttct cattcatgtg 6720
ttttccttac ctcattcatt aactctttgc tatacacact tgtctgctta gttttgcaca 6780
cccgtttaat taatttttta atttgcagac caatcacttc gcagctccat tccaaatccc 6840
cctgcaaatt tcagattgag ggaggatcaa ctcactggaa gctcacttaa aggtacactt 6900
acagttacag atatatacta ctagtacctt atttttttta ttttaagttg ctaatgtacc 6960
acataacata tgaagttttt gcttcttatt tctgtctatc aatattaata tgttctcccc 7020
ccaaaaaatg cagcaccgcg atcgttcttc tccctctcaa cgtttcgtag caaggggggt 7080
gatgcaaggc tcaggtga 7098
<210> 3
<211> 26
<212> DNA
<213>Artificial sequence
<400> 3
gacaactttt tttttttggg tatccg 26
<210> 4
<211> 25
<212> DNA
<213>Artificial sequence
<400> 4
atagatttgt tgctggatgc acctt 25

Claims (8)

1. a kind of molecular labeling of quick breeding high-quality erect head rice varieties, it is characterised in that the molecular labeling is water Rice erect head gene EP2 the 6th introne and the single base G of the 7th extron junction sport A, the paddy rice erect head base Because EP2 nucleotide sequence is as shown in SEQ ID NO.1, the nucleotide sequence such as SEQ ID NO.2 of the molecular labeling after mutation It is shown.
2. a kind of method using molecular labeling quick breeding high-quality erect head rice varieties as claimed in claim 1, its It is characterised by, comprises the following steps：
(1) using the curved fringe type rice varieties resisted high yield as female parent more, will contain the erect panicle variety of the molecular labeling as Male parent, by maternal and paternal hybrid, obtains F1For seed；
(2) by F1Seedling is planted for seed, F is harvested2For seed；
(3) by F2Begun sowing in good time for seed, individual plant is transplanted, it is erect head or half erect head that 30 days or so after heading, which choose phenotype, Individual plant, extract its blade STb gene and carry out Molecular Identification, choose the plant containing the molecular labeling and examined in individual plant room Kind, spike length, mass of 1000 kernel, setting percentage and exterior quality are investigated, retains spike length in 17-21 centimetres, 24-28 grams of mass of 1000 kernel, setting percentage More than 88%, and the excellent individual plant of exterior quality, obtain F3For seed；
(4) by F3Pedigree is planted into for seed, continues to screen target variety according to the method for step (3), obtains F4For seed；
(5) repeat step (3), (4), obtain FnFor seed, that is, it is bred as the high-quality for containing the molecular labeling and being improved through high yield Erect head rice varieties.
3. a kind of method of quick breeding high-quality erect head rice varieties according to claim 2, it is characterised in that institute State in step (1), the curved fringe type rice varieties resisted high yield include more：Xu rice No. 3, southern round-grained rice 5055, town rice 14, peaceful 1092, good spend 1 Number, cultivate special glutinous No. 1, the erect panicle variety containing the molecular labeling is the mutating variety F190 of agriculture institute 238.
4. a kind of method of quick breeding high-quality erect head rice varieties according to claim 2, it is characterised in that institute State in step (1), the preparation method of the erect panicle variety containing the molecular labeling is radioinduction method or gene site-directed prominent Change method.
5. a kind of method of quick breeding high-quality erect head rice varieties according to claim 2, it is characterised in that institute State in step (3), the method for Molecular Identification is：Using rice leaf STb gene as template, for the mutational site of the molecular labeling DCAPS labeled primers are designed, and as specificity amplification primer, enters performing PCR amplification, uses digestion with restriction enzyme PCR primer, Identify in plant DNA genomes and whether contain the molecular labeling.
6. a kind of method of quick breeding high-quality erect head rice varieties according to claim 5, it is characterised in that institute DCAPS labeled primers are stated for EP2-dCAPs-1, its nucleotide sequence is as follows：
SEQ ID NO.3：EP2-dCAPs-1F：GACAACTTTTTTTTTTTGGGTATCCG
SEQ ID NO.4：EP2-dCAPs-1R：ATAGATTTGTTGCTGGATGCACCTT；
The restriction enzyme is HpaII；
The authentication method is：If digestion band is 189bp, the rice plant is the homozygosis without the molecular labeling Body, if digestion band is 213bp, the rice plant is the homozygote containing the molecular labeling, if digestion band bag Two characteristic bands of 189bp and 213bp are included, then the rice plant is the heterozygote containing the molecular labeling；
7. a kind of method of quick breeding high-quality erect head rice varieties according to claim 2, it is characterised in that institute State in step (5), FnIt is >=F for seed5For seed.
8. a kind of method of quick breeding high-quality erect head rice varieties according to claim 2-7, it is characterised in that Methods described also includes step (6)：By FnCarry out plus be commissioned to train as parent for seed foster, the stable high-quality erect head water of acquisition Rice varieties.
CN201710616190.3A 2017-07-26 2017-07-26 The molecular labeling and its method of a kind of quick breeding high-quality erect head rice varieties Pending CN107267638A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710616190.3A CN107267638A (en) 2017-07-26 2017-07-26 The molecular labeling and its method of a kind of quick breeding high-quality erect head rice varieties

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710616190.3A CN107267638A (en) 2017-07-26 2017-07-26 The molecular labeling and its method of a kind of quick breeding high-quality erect head rice varieties

Publications (1)

Publication Number Publication Date
CN107267638A true CN107267638A (en) 2017-10-20

Family

ID=60079147

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710616190.3A Pending CN107267638A (en) 2017-07-26 2017-07-26 The molecular labeling and its method of a kind of quick breeding high-quality erect head rice varieties

Country Status (1)

Country Link
CN (1) CN107267638A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102304587A (en) * 2011-09-27 2012-01-04 江苏省农业科学院 Method for rapidly identifying erect panicle of rice
CN103314842A (en) * 2013-06-26 2013-09-25 江苏（武进）水稻研究所 Cultivation method for half-erect panicle high-yield rice variety

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102304587A (en) * 2011-09-27 2012-01-04 江苏省农业科学院 Method for rapidly identifying erect panicle of rice
CN103314842A (en) * 2013-06-26 2013-09-25 江苏（武进）水稻研究所 Cultivation method for half-erect panicle high-yield rice variety

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
程朝平等: "分子标记辅助选择籼型直立恢复系", 《分子植物育种》 *
胡运高等: "直立密穗基因DEP2-1388的遗传分析及在杂交稻中的育种利用", 《遗传》 *

Similar Documents

Publication Publication Date Title
CN101138313B (en) Maize inbred line resistant to MRDV bred by using molecule making
CN107201404A (en) A kind of molecular biology identification method and its application for Asparagus dioecian plant sex
CN113151553B (en) Molecular marker coseparated with watermelon plant few lateral branch gene Clbl and application
CN107805673A (en) A kind of SNP marker related to Wheat Seedling root traits and application
CN107012243A (en) A kind of molecular labeling for identifying the true hybrid of lichee and its application
CN105543222B (en) The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application
JP2023505138A (en) Physical and chemical mutagenesis Methods for identifying M1 generation mutations in plants and methods for obtaining mutants and typing primers, mutant genes and uses for mutation identification in rice
CN109652412A (en) The method and application of a kind of SNP marker, detection muskmelon flower property type
CN104313155A (en) Floral character associated molecular marker screening method of amenone form chrysanthemum and application of method
CN110463599B (en) Breeding method of direct-seeding rice
CN108486273B (en) Excavation and application of SSR (simple sequence repeat) markers on chromosome 5 and closely linked with salt-tolerant QTL (quantitative trait locus) of rice
CN112375840B (en) Major QTL for regulating and controlling resistance of rice sogatella furcifera, molecular marker and application
CN112760402B (en) KASP primer group for detecting wheat spike number and biomass density and application thereof
CN110079629A (en) A kind of SNP marker, detection method and the application of the short climing close linkage of watermelon
CN104946644B (en) The molecular labeling of corn friction standing grain monosomic addition line genic male sterile gene and its application
CN109006456B (en) Breeding method of pimento nuclear male sterile dual-purpose line
CN107586874A (en) For identifying primer pair and its application of capsicum yellow flower pesticide character
CN102690811B (en) Molecular marker SIsv1363 closely linked with millet leaf color gene
CN104762298B (en) A kind of rice seedling resistant gene of salt qST11 and its molecule labelling method
CN106399498A (en) Molecular marker assisted selection method for cauliflower flower ball pedicel length
CN116732219A (en) Method for identifying variety of F1 generation by interspecific hybridization of fraxinus mandshurica and white wax
CN111073991A (en) Rice blast resistance gene Pi67(t), codominant molecular marker closely linked with same and application
CN105624277B (en) Method for obtaining molecular marker closely linked with tobacco plant height development character
CN107267638A (en) The molecular labeling and its method of a kind of quick breeding high-quality erect head rice varieties
CN114277175A (en) Rapid and efficient wheat scab-resistant molecular design breeding method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20171020

RJ01 Rejection of invention patent application after publication