CN107267618A - The genetic marker related to sheep wool fineness and its application - Google Patents

The genetic marker related to sheep wool fineness and its application Download PDF

Info

Publication number
CN107267618A
CN107267618A CN201710534576.XA CN201710534576A CN107267618A CN 107267618 A CN107267618 A CN 107267618A CN 201710534576 A CN201710534576 A CN 201710534576A CN 107267618 A CN107267618 A CN 107267618A
Authority
CN
China
Prior art keywords
base
sheep
allele
wool
fineness
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710534576.XA
Other languages
Chinese (zh)
Other versions
CN107267618B (en
Inventor
李少斌
罗玉柱
胡江
王继卿
刘秀
赵芳芳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gansu Agricultural University
Original Assignee
Gansu Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gansu Agricultural University filed Critical Gansu Agricultural University
Priority to CN201710534576.XA priority Critical patent/CN107267618B/en
Publication of CN107267618A publication Critical patent/CN107267618A/en
Application granted granted Critical
Publication of CN107267618B publication Critical patent/CN107267618B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides the genetic marker related to sheep wool fineness, and it is located on the genes of KRTAP26 1, and specific nucleotides sequence is classified as SEQ ID No.1 in sequence table；When allele is C, wool is thinner, and when allele is B, wool is thicker；The present invention also provides application of the above-mentioned genetic marker in sheep molecular mark.The present invention is using sheep as research object, the genes of KRTAP26 1 of sheep are identified first with bioinformatics technique, and then utilize the nucleotide sequence variation and amino acid characteristics of the PCR SSCP technique studies gene, influence of the gene pleiomorphism to sheep wool traits has finally been inquired into, has provided fundamental basis and instructs to the genetic improvement for sheep.

Description

The genetic marker related to sheep wool fineness and its application
Technical field
The invention belongs to genetic engineering and technical field of molecular biology, and in particular to the something lost related to sheep wool fineness Pass mark and its apply.
Background technology
Wool refers to the hair on chimera, is one kind of natural fiber, is one of main textile raw material.Wool be human use most One of early natural fiber, its history can trace back to the Neolithic Age.Wool is due to good, heat-insulated, fire-retardant with soft, elasticity Favored (Leeder, 1984) by people with the good characteristic such as good permeability.But as other textile fabrics are particularly The appearance of synthetic fibers, the market position of wool receives the competition of excitation.From 1994 to 2004 years, wool was fine in whole weaving Proportion in dimension have dropped nearly 30% (Cottle, 2010).In order to tackle this awkward situation, Wool Industry need to improve individual yield and Quality, improves its market competitiveness.In Animal husbandry production contribution rate, hereditary influence factor (kind) accounts for 40%, raises pipe Reason accounts for 20%, and disease prevention and cure account for 15%, and other environmental factors account for 5%.Therefore, breed improvement and cultivation be improve production of wool and The most direct effective measures of quality.
Compared with traditional breeding work, molecular breeding can accelerate breeding process, greatly shorten the time limit needed for breeding, together When can also overcome the influence of sex, age and environmental factor so that molecular level to inhereditary material carry out operation be possibly realized, So as to realize the selection of the different production traits of animal.Have now been found that some are closely related with Stock genetics and breeding and disease resistance Gene, such as significantly affect the Callipyge (CLPG) and MSTN genes (Wang, 2015 of sheep meat production；Othman Deng 2016), wherein CLPG mainly promotes sheep rump muscle Overgrowth, so as to improve meat yield and carcass grade.New Zealand Lincoln university will detect foundation of the DQA2 genes as the anti-foot rot seed selection of sheep, and enter the commercialized services stage.Some are supported The flourishing country of ox industry, has been developed that the molecular detection technology of genetic defect gene about breeding oxen and supporting breeding side Case, seed selection applied to breeding oxen, apolegamy work, effectively reduce recessive deleterious alleles harmful effect (Li Yanhua etc., 2007).If traditional breeding way binding molecule breeding technique, the degree of accuracy of selection can be improved, shortens the seed selection time.
One of Animal molecular breeding method is that assisted Selection is marked based on molecular labeling.Molecular labeling auxiliary choosing The characteristics of (marker-assisted selection, MAS) is using molecular labeling and objective trait gene close linkage is selected, Pass through Markers for Detection, you can detect the presence of target gene, reach the purpose of selection target character.For wool traits For molecular labeling, on the one hand its yield and fineness etc. belong to high heritability character, and the constituent of another aspect wool is complicated, Its development is regulated and controled (stone etc., 2011 by polygenes；Safari etc., 2007).Therefore, the premise of wool molecular marker assisted selection is Find wool important economical trait seat or DNA marker chain therewith.
The content of the invention
Based on problem above, the invention provides the genetic marker related to sheep wool fineness, genetic marker is located at On KRTAP26-1, the molecule seed selection available for sheep fineness.
The present invention provides the genetic marker related to sheep wool fineness, and it is located on KRTAP26-1 genes, specific core Nucleotide sequence is SEQ ID No.1 in sequence table；When allele be C when, wool is thinner, when allele be B when, wool compared with Slightly；
The allele C is：In sequence table SEQ ID No.1 nucleotide sequence, the base at 102bp is C, Base at 141bp is that the base at T, 153bp is that the base at C, the 245th is that the base at G, the 307th is G, the 366th The base at place is that the base at G, the 579th is C；
The allele B is：In sequence table SEQ ID No.1 nucleotide sequence, the base at 102bp is T, Base at 141bp is that the base at C, 153bp is that the base at G, the 245th is that the base at A, the 307th is A, the 366th The base at place is that the base at G, the 579th is T.
The present invention also provides the primer pair for detecting the above-mentioned genetic marker related to sheep wool fineness, described to draw Thing to for：
Sense primer：5’-CAGACGACAACCTGCTCCTG-3’；
Anti-sense primer：5’-GTCTGGGATCTTCAGCGTG-3’.
The present invention also provides application of the above-mentioned genetic marker in identification sheep wool fineness, and the application includes following step Suddenly：(1) genomic DNA of sheep to be measured is extracted；
(2) using the genomic DNA of sheep to be measured as template, performing PCR amplification is entered using the primer pair described in claim 2；
(3) pcr amplification product is detected, if in extension increasing sequence, allele is C, wool is thinner；Allele is B, sheep Hair is thicker；
The allele C is：In sequence table SEQ ID No.1 nucleotide sequence, the base at 102bp is C, Base at 141bp is that the base at T, 153bp is that the base at C, the 245th is that the base at G, the 307th is G, the 366th The base at place is that the base at G, the 579th is C；
The allele B is：In sequence table SEQ ID No.1 nucleotide sequence, the base at 102bp is T, Base at 141bp is that the base at C, 153bp is that the base at G, the 245th is that the base at A, the 307th is A, the 366th The base at place is that the base at G, the 579th is T.
Preferably, in step (2), the amplification system that the PCR reactions are used is calculated as with 15 μ l：1.2mm DNA disk Template 1,1.5 μ L10 × buffer buffer solutions, 1.5 μ L 5 × Q solution, 0.6 μ L 2.5mM MgCl2, the μ of 0.9 μ L 150 MdNTPs, each 0.4 μ L of upstream and downstream primer, 0.06 μ L 0.5U Taq polymerases and 9.64 μ LddH2O。
Preferably, in step (2), the condition of the PCR reactions is：94 DEG C of pre-degenerations 2 minutes, 94 DEG C are denatured 30 seconds, 61 DEG C of annealing 30s, 72 DEG C extend 30 seconds, and totally 35 circulations finally extend 5 minutes, 4 DEG C of preservations.
Preferably, in step (3), the detection pcr amplification product is detected using SSCP, while positive control is set, Gel electrophoresis poststaining, obtains SSCP electrophoresis banding pattern figures, test sample is treated according to the type of band in collection of illustrative plates and positive control result This wool fineness character is judged.
The present invention also provides the kit for being used for containing above-mentioned primer pair detecting sheep wool fineness.
Preferably, also including PCR reaction reagents in the kit, the PCR reaction reagents are calculated as with 15 μ l： 1.2mm DNA disk templates 1,1.5 μ L10 × buffer buffer solutions, 1.5 μ L 5 × Q solution, 0.6 μ L 2.5mM MgCl2, 0.9 μ L150 μM dNTPs, each 0.4 μ L of upstream and downstream primer, 0.06 μ L 0.5U Taq polymerases and 9.64 μ LddH2O。
The present invention also provides the above-mentioned genetic marker related to sheep wool fineness in sheep molecular mark Application.
The present invention identifies the KRTAP26-1 genes of sheep first with bioinformatics technique using sheep as research object, And then the nucleotide sequence variation and amino acid characteristics of the PCR-SSCP technique studies gene are utilized, finally inquire into gene polymorphic Influence of the property to sheep wool traits, provides fundamental basis and instructs to the genetic improvement for sheep.
Brief description of the drawings
Accompanying drawing is used for providing a further understanding of the present invention, and constitutes a part for specification, the reality with the present invention Applying example is used to explain the present invention together, is not construed as limiting the invention.In the accompanying drawings：
Fig. 1 is that sheep KRTAP26-1PCR-SSCP detect banding pattern result.
Embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method, is conventional method unless otherwise specified.Test material used, is city unless otherwise specified in following embodiments Sell.
Embodiment 1
1 test material
1.1 sample source
1.1.1 gene pleiomorphism and correlation sample are detected
Merino (Merino) 383.
Lamb birth is worn overbit within 12 hours and recorded, mark records ewe overbit, date of birth, sex, birth Grade (lamb is single lamb, twin lamb(s) or triplet), while the blood sample of every lamb is collected with FTA cards, for subsequent gene Group DNA analysis of experiments.
1.1.2 the measure of wool correlated traits
When 12 monthly age of sheep, wool samples are gathered in sheep side centre position.Wool avarage fiber diameter (mean Fibre diameter, fineness) send and Co., Ltd (New Zealand Wool Testing are detected by New Zealand wool Authority Ltd, Ahuriri, Napier, NZ) determine.
1.2 experiment main agents
1.2.1 main molecules biological reagent used is tested
Main molecules biological reagent selected by correlation test is shown in Table 1.
Table 1 tests main molecules biological reagent used
1.2.2 other reagents
Boric acid, Tris alkali, EDTA, sodium hydroxide (NaOH), silver nitrate (AgNO3), absolute ethyl alcohol, formaldehyde, deionization first Acid amides, bromophenol blue, dimethylbenzene green grass or young crops, acetic acid, ammonium persulfate and triglycerides.
1.2.3 main solution formula in testing
10×TBE：216gTris, 110g boric acid, 14.8gEDTA are completely dissolved in 2L distilled water, autoclaving.
1×TBE：10 × the TBE prepared that sterilizes presses 1 with distilled water：9 configurations.
0.5×TBE：10 × the TBE prepared that sterilizes presses 1 with distilled water：9 configurations.
1M Tris-HCl (pH=8.0)：Tris 121.1g, concentrated hydrochloric acid 42mL, sterilizing ultra-pure water 800mL.
20mM NaOH solutions：0.8gNaOH is dissolved in 600mL distilled water, and 1000mL is settled to after being completely dissolved, and high pressure is gone out Bacterium.
1 × TE (10mM Tris-HCl, 0.1mM EDTA)：5mL 1M Tris-HCl, 0.1mL 0.5M EDTA, distillation Water is settled to 500mL, and autoclaving is standby.
10% ammonium persulfate solution：0.1g ammonium persulfates are dissolved in 1mL distilled water, and 4 DEG C save backup.
SSCP denaturation buffers：980 μ L deionized formamides, 20 μ L0.5M EDTA, a small amount of dimethylbenzene green grass or young crops and bromophenol blue (generally 7-8 μ L), is fully mixed, 4 DEG C save backup.
Fixer：100mL absolute ethyl alcohols, 5mL glacial acetic acids are dissolved in distilled water and are settled to 1000mL, save backup.
Dyeing liquor：2g silver nitrates are dissolved in 1L fixers, preserve into brown bottle lucifuge standby.
Nitrite ion：30gNaOH is dissolved in 1L distilled water, is heated to 45 DEG C or so, adds 1mL formaldehyde, now-making-now-using.
14% polyacrylamide gel (30mL)：10.5mL 40%PA solution, 1.5mL 10 × TBE, 160mL 10% APS, 16mL TEMED, distilled water are mended to 30mL.
12% polyacrylamide gel (30mL)：9mL 40%PA solution, 1.5mL 10 × TBE, 160mL10%APS, 16mL TEMED, distilled water is mended to 30mL.
10% polyacrylamide gel (30mL)：7.5mL 40%PA solution, 1.5mL 10 × TBE, 160mL 10% APS, 16mL TEMED, distilled water are mended to 30mL.
1.2.4 key instrument equipment in testing
Experiment main pertinent instruments used are shown in Table 2.
Table 2 tests key instrument equipment used
2 test methods
2.1 poba gene group DNA are extracted
Sheep ear is punctured, it is natural by droplet of blood in (Whatman Bioscience, Middlesex, UK) on FTA cards It is In Shade after airing to preserve stand-by.Extracting genome DNA for expanding PCR is carried using the two-step method described by Zhou etc. Take.From punching sampling (aperture 1.2mm) is placed in PCR pipe on FTA, 200 μ L 20mM NaOH, 60 DEG C of heating 30min are added left Right (being changed into white by FTA to be defined), exhaust liquid in pipe, adds 200 μ 1 × TE of L, is stored at room temperature 5 minutes, exhaustion TE liquid every PCR after night for related gene is expanded.
2.2 PCR are expanded
2.2.1 PCR primer is designed
Sense primer：up5’-CAGACGACAACCTGCTCCTG-3’
Anti-sense primer：dn5’-GTCTGGGATCTTCAGCGTG-3’.
Primer is synthesized by Integrated DNA Technologies (Coralville, IA, USA).
2.2.2 PCR amplification system and condition
All gene PCR fragment amplifications use 15 μ L systems in this experiment.Including 1.2mm DNA disk templates 1,1.5 μ L10 × buffer buffer solutions, 1.5 μ L 5 × Q solution, 0.6 μ L 2.5mM MgCl2, 0.9 150 μM of μ L dNTPs, upstream and downstream draws Each 0.4 μ L of thing, 0.06 μ L 0.5U Taq polymerases and 9.64 μ LddH2O。
PCR amplification conditions：94 DEG C of pre-degenerations 2 minutes, 94 DEG C are denatured 30 seconds, 61 DEG C of annealing 30s, and 72 DEG C extend 30 seconds, altogether 35 circulations, finally extend 5 minutes, 4 DEG C of preservations.
2.2.3 PCR primer agarose gel electrophoresis is detected
0.3g agaroses are dissolved in 1 × TBE of 30mL, are heated to being completely dissolved, are added when being cooled to 60-70 DEG C 200ng/ml EB solution, is configured to 1% Ago-Gel.After after agarose completely solidification, 2 μ LPCR products and loading buffer are taken By in sample loading to glue hole after liquid mixing, voltage 110V electrophoresis 15min are expanded PCR after terminating using ultraviolet gel imager Volume increase thing result is detected.
2.3 SSCP gel analysis
2.3.1 SSCP electrophoresis
100 μ LSSCP denaturants (10mMEDTA, 98% formamide, 0.025% formyls are added in 15 μ L PCR primer Amine and 0.025% dimethylbenzene are blue or green).Ice bath 5min in mixture of ice and water is immediately placed on after sample is denatured into 5min in 105 DEG C, then 8-10 μ L denatured products are splined in the polyacrylamide gel of various concentrations, 0.5 × TBE is added in vertical slab electrophoresis groove Electrophoresis is carried out to sample.SSCP conditions：The glycerine of 14% polyacrylamide gel+1%, 32.5 DEG C, 290v, 19h.
2.3.2 silver staining
Polyacrylamide gel silver staining is terminated to electrophoresis according to Byun etc. method and steps.Polyacrylamide is coagulated first Glue, which is placed in dyeing liquor, dyes 8min, then uses distilled water immersion 2min, is subsequently placed in developer solution until the band in gel is clear Untill clear, then gel is placed in fixer fixes 2min, gel is placed on A4 paper and genotype is judged, gel dryer is finally used Preserved after drying.
2.4 allelic sequences are sequenced
The sequencing of allele is divided into two classes：Homozygous allele and heterozygous allele.If SSCP partings judge For homozygous sample, sample PCR primer purifying is fed directly to Lincoln university DNA sequence analysis room (Lincoln University DNA Sequencing Facility) it is sequenced.If SSCP partings be heterozygous and in all samples all The allele is not homozygous, then is carried out cutting glue sequencing according to the method for the descriptions such as Gong.In brief, this method is first The higher single slice of concentration on polyacrylamide gel is cut, is placed in 1.5mL PCR pipes, with 60 μ L distilled water flushings 2 times, is inhaled Glue is ground with pipette tips after distilled water to the greatest extent, 60 μ L distilled water are then added, water-bath 2-3h in 70 DEG C of water-baths is placed in, terminated rearmounted 1min is centrifuged in centrifuge, enters performing PCR amplification using supernatant as allele pcr template to be measured, amplified production is carried out SSCP detections confirm as banding pattern to be measured, finally send the sequencing of sequencing room after purification by the PCR primer.
2.4.1 PCR primer is purified
By the PCR primer MinElute of required sequencing@Make after PCR Purification kit Purification Kits For sequencing pcr template, the single-stranded PCR amplifications of special upstream and downstream are carried out.Pcr amplification reaction system is shown in Table 3.
PCR reaction systems are sequenced in table 3
PCR reacts amplification program：95 DEG C of pre-degenerations 2 minutes, 95 DEG C are denatured 20 seconds, and 50 DEG C are annealed 5 seconds, 60 DEG C of extensions 3min, totally 29 circulations, 10 DEG C of extensions.
2.5 data statistic analysis
2.5.1 nucleotide sequence analysis
Design of primers is carried out using DANMAN softwares, analysis allelic sequences mutational site and amino acid variation letter is compared Breath；Searched online with Genbank series of variation information and Blast functions (http://www.ncbi.nlm.nih.goc/) compare Purpose fragment information.
2.5.2 gene frequency and genotype frequency
Gene frequency refers to shared hundred in specific gene seat of a certain allele in colony where all allele Divide ratio.If a certain gene has two allele of A and B, its respective frequency is p and q, and the statistical model of result of calculation is as follows：
P=(2X+Z)/2N q=(2Y+Z)/2N p+q=1
Wherein, X is AA type number of individuals, and Y is BB type number of individuals, and Z is AB type number of individuals, and N is total number of samples.
Genotype frequency refers to the percentage shared by a certain genotype in colony.
The total quantity of genotype frequency=a certain genotype individuals number/Suo Ce colonies.
2.6 genetic mutations and wool traits correlation analysis
Using MINTABLE (Version 17, Minitab Inc., Pennsylavania) general linear melange effect mould Type (General Liner Mixed-effect Models, GLMMs) assesses presence/missing, the genotype of specific allele Whether exist to wool traits related.When analyzing influence of the genotype to character, the genotype that 5% is only more than to frequency is carried out Analysis.All analysis results are with " average value ± standard error " expression, P<0.05 is the level of signifiance, P<0.2 is has an impact trend, P>0.2 is without influence.
3 results
3.1 sheep KRTAP26-1 polymorphism analysis
3.1.1 sheep KRTAP26-1 variations detection
Sheep KRTAP26-1 detects 4 kinds of bands and constitutes 10 kinds of banding patterns (Fig. 1) altogether.Sequencing shows these PCR-SSCP bars Band represents 4 kinds of different nucleotide sequences (A, B, C and D) (table 4).These sequences are committed to NCBI and obtain following sequence number： KX644903-644906.Sequence alignment finds there are 7 SNPs.All SNP are respectively positioned on code area, wherein 2 are non-synonymous prominent Become.
Fig. 1 is that sheep KRTAP26-1PCR-SSCP detect banding pattern result.
The sheep KRTAP26-1 sequence variations of table 4
When allele is the A in table 1, the nucleotides sequence of amplified fragments is classified as：
CAGACGACAACCTGCTCCTGAAACCTCACCATGTCTTGCCACAACTACTGCTCCGGAAACTACACCTTG GGGTCTCTCAGGAGTCCCTGTCACATTCCCGTCGCCTCCTCCGTCGGCCTCTACACTCCGAGTGTGAGCGTAGGAGA TGGTCTCTGCTTGCCCAGCAGCTGTCAGGACCGAACCTGGATCCTGAGCAATGGCCAGGAGACCTGCAGTGAACCTA CCAGCTGCCAGCCAGCCAACTGCGAGCCCAGCAGCTGTGAAACTTCCAGCTACCCTTCTTCTGGTTGCTATGTGCCA AGACCCAGCCAAGGAACGAGTTTTCTTCCCGCTTCTTCTTACCTCTCTGGATCCTGCCTCTCAGTGTCTTATAGACC GCTGGCCTATGTGTCCAGCAGCTCGCGACCCTTGAGCCTTCTCCCTTGTGGATATCGCCCCTCGGGTTCTTTGCCCT GTGGTCTTCAACCCATCAGCATTGTGTCCAGCGGCCTCAGACCTCTACGCCCTGTCTTCAGTGGATGCCAAACTCTG CCTTATGTGTTCAGTCCTTACCGTCCATCTTACTCTACCTGCGGAGGCCTGTAGCTTCTTTATTCCGGGCAATGATC ACGCTGAAGATCCCAGAC
When allele is the B in table 1, the nucleotides sequence of amplified fragments is classified as：
CAGACGACAACCTGCTCCTGAAACCTCACCATGTCTTGCCACAACTACTGCTCCGGAAACTACACCTTGGGGTCTCT CAGGAGTCCCTGTCACATTCCCGTTGCCTCCTCCGTCGGCCTCTACACTCCGAGTGTGAGCGTCGGAGATGGTCTGT GCTTGCCCAGCAGCTGTCAGGACCGAACCTGGATCCTGAGCAATGGCCAGGAGACCTGCAGTGAACCTACCAGCTGC CAGCCAGCCAACTACGAGCCCAGCAGCTGTGAAACTTCCAGCTACCCTTCTTCTGGTTGCTATGTGCCAAGACCCAG CCAAGGAACGAGTTTTCTTCCCGCTTCTTCTTACCTCTCTGGATCCTGCCTCTCAGTGTCTTATAGACCGCTGGCCT ATGTGTCCAGCAGCTCGCGACCCTTGAGCCTTCTCCCTTGTGGATATCGCCCCTCGGGTTCTTTGCCCT GTGGTCTTCAACCCATCAGCATTGTGTCCAGCGGCCTCAGACCTCTACGCCCTGTCTTCAGTGGATGCCAAACTCTG CCTTATGTGTTCAGTCCTTACCGTCCATCTTACTCTACCTGCGGAGGTCTGTAGCTTCTTTATTCCGGGCAATGATC ACGCTGAAGATCCCAGAC
When allele is the C in table 1, the nucleotides sequence of amplified fragments is classified as：
CAGACGACAACCTGCTCCTGAAACCTCACCATGTCTTGCCACAACTACTGCTCCGGAAACTACACCTTG GGGTCTCTCAGGAGTCCCTGTCACATTCCCGTCGCCTCCTCCGTCGGCCTCTACACTCCGAGTGTGAGCGTTGGAGA TGGTCTCTGCTTGCCCAGCAGCTGTCAGGACCGAACCTGGATCCTGAGCAATGGCCAGGAGACCTGCAGTGAACCTA CCAGCTGCCAGCCAGCCAACTGCGAGCCCAGCAGCTGTGAAACTTCCAGCTACCCTTCTTCTGGTTGCTATGTGCCA AGACCCGGCCAAGGAACGAGTTTTCTTCCCGCTTCTTCTTACCTCTCTGGATCCTGCCTCTCAGTGTCTTATAGACC GCTGGCCTATGTGTCCAGCAGCTCGCGACCCTTGAGCCTTCTCCCTTGTGGATATCGCCCCTCGGGTTCTTTGCCCT GTGGTCTTCAACCCATCAGCATTGTGTCCAGCGGCCTCAGACCTCTACGCCCTGTCTTCAGTGGATGCCAAACTCTG CCTTATGTGTTCAGTCCTTACCGTCCATCTTACTCTACCTGCGGAGGCCTGTAGCTTCTTTATTCCGGGCAATGATC ACGCTGAAGATCCCAGAC
When allele is the D in table 1, the nucleotides sequence of amplified fragments is classified as：
CAGACGACAACCTGCTCCTGAAACCTCACCATGTCTTGCCACAACTACTGCTCCGGAAACTACACCTTG GGGTCTCTCAGGAGTCCCTGTCACATTCCCGTCGCCTCCTCCGTCGGCCTCTACACTCCGAGTGTGAGCGTAGGAGA TGGTCTCTGCTTGCCCAGCAGCTGTCAGGACCGAACCTGGATCCTGAGCAATGGCCAGGAGACCTGCAGTGAACCTA CCAGCTGCCAGCCAGCCAACTGCGAGCCCAGCAGCTGTGAAACTTCCAGCTACCCTTCTTCTGGTTGCTATGTGCCA AGACCCAGCCAAGGAACGAGTTTTCTTCCCGCTTCTTCTTACCTCTCTGGATCCTGCCTCTCAGTATCTTATAGACC GCTGGCCTATGTGTCCAGCAGCTCGCGACCCTTGAGCCTTCTCCCTTGTGGATATCGCCCCTCGGGTTCTTTGCCCT GTGGTCTTCAACCCATCAGCATTGTGTCCAGCGGCCTCAGACCTCTACGCCCTGTCTTCAGTGGATGCCAAACTCTG CCTTATGTGTTCAGTCCTTACCGTCCATCTTACTCTACCTGCGGAGGCCTGTAGCTTCTTTATTCCGGGCAATGATC ACGCTGAAGATCCCAGAC
Wherein, the SNPs of underscore mark partly to occur in allele.
The correlation of 3.2 KRTAP26-1 gene pleiomorphisms and wool traits
In merino hybrid sheep, 4 kinds of allele of KRTAP26-1 genes are detected altogether, allele D is in group Ratio in body is very low, it is impossible to carry out related type analysis.Therefore correlation analysis only is carried out to remaining 3 allele.Missing/ When depositing in a model, in the presence of allele B, fineness can be improved, but allele C being introduced into analysis, shadows of the B to these characters Ring and weaken, but fineness (P=0.081) effect tendency is remained unchanged substantially.In it there is deletion analysis in allele, allele C presence can cause fineness to reduce, and when multivariate model is analyzed, the influence to fineness remains unchanged presence.
The genotype (AA, AB, AC, BB and BC) higher to five kinds of frequencies carries out correlation analysis with wool traits.Gene Type is AB and BB lamb fineness ratio AC and BC high 5.8% to 11.2% (P<0.01).Refer to table 5.
There is the influence to wool fineness in the 4KRTAP26-1 deletion alleles of table 5
Influence of the KRTAP26-1 genotype of table 6 to wool fineness
4 discuss
In merino hybrid sheep, KRTAP26-1 detects 4 allele of 7 SNPs formation.At this 7 In SNPs, there are 2 changes that amino acid is caused for nonsynonymous mutation, be B respectively:C.245G/A (p.72C/Y) and C: c.307A/G(p.93S/G).The quantity that allele B causes cysteine changes, and this may influence the albumen and centre fine The crosslinking of dimension or other KAP albumen.The quantity that allele C causes serine changes, and then may influence the phosphorus of the albumen Acidifying.The change of amino acid may finally influence the characteristic of wool caused by these mutation.
Sheep KRTAP26-1 variation is related to fineness, and gene delection has modal analysis results and genotype point Analyse result consistent.From the point of view of analysis result, the more other sheep of its wool quality of the sheep containing allele C it is more preferable, these The fineness of sheep is relatively low.Influences of the allele B to wool traits is with allele C on the contrary, the sheep table containing allele B It is now higher fineness, and its character of the sheep containing allele A is between allele B and C.
5 conclusions
Sheep KRTAP26-1 detects 4 allele of 7 SNPs formation, has 2 to cause ammonia for nonsynonymous mutation The change of base acid.Sheep KRTAP26-1 variation is related to fineness.Sheep containing allele C shows as relatively low fineness. Sheep containing allele B shows as higher fineness.Prompting, in breeding work, if improving allele C and reduction B Content in Sheep Populations, can improve fineness correlated traits.
Embodiment 2
Sheep wool fineness detection kit, including：
1st, primer pair：
Sense primer：up5’-CAGACGACAACCTGCTCCTG-3’；
Anti-sense primer：dn5’-GTCTGGGATCTTCAGCGTG-3’.
2nd, PCR detection reagents
PCR amplifications use 15 μ L systems.Including 1.2mm DNA disk templates 1,1.5 μ L10 × buffer buffer solutions, 1.5 μ L 5 × Q solution, 0.6 μ L 2.5mM MgCl2, 0.9 150 μM of μ L dNTPs, upstream and downstream primer each 0.4 μ L, 0.06 μ L0.5U Taq polymerases and 9.64 μ LddH2O。
3rd, positive control
Positive control A：Its nucleotides sequence is classified as sequence table SEQ ID No.1；
Positive control B：Its nucleotides sequence is classified as sequence table SEQ ID No.2；
Positive control C：Its nucleotides sequence is classified as sequence table SEQ ID No.3；
Positive control D：Its nucleotides sequence is classified as sequence table SEQ ID No.4.
4th, SSCP working reagents：Including SSCP denaturants and developer solution etc..
The application method of the kit is with reference to embodiment 1.
Finally it should be noted that：The preferred embodiments of the present invention are the foregoing is only, are not intended to limit the invention, Although the present invention is described in detail with reference to the foregoing embodiments, for those skilled in the art, it still may be used To be modified to the technical scheme described in foregoing embodiments, or equivalent substitution is carried out to which part technical characteristic. Within the spirit and principles of the invention, any modification, equivalent substitution and improvements made etc., should be included in the present invention's Within protection domain.
Sequence table
<110>Gansu Agriculture University
<120>The genetic marker related to sheep wool fineness and its application
<170> PatentIn version 3.5
<210> 1
<211> 626
<212> DNA
<213>Sheep KRTAP26-1 allele A
<400> 1
cagacgacaa cctgctcctg aaacctcacc atgtcttgcc acaactactg ctccggaaac 60
tacaccttgg ggtctctcag gagtccctgt cacattcccg tcgcctcctc cgtcggcctc 120
tacactccga gtgtgagcgt aggagatggt ctctgcttgc ccagcagctg tcaggaccga 180
acctggatcc tgagcaatgg ccaggagacc tgcagtgaac ctaccagctg ccagccagcc 240
aactgcgagc ccagcagctg tgaaacttcc agctaccctt cttctggttg ctatgtgcca 300
agacccagcc aaggaacgag ttttcttccc gcttcttctt acctctctgg atcctgcctc 360
tcagtgtctt atagaccgct ggcctatgtg tccagcagct cgcgaccctt gagccttctc 420
ccttgtggat atcgcccctc gggttctttg ccctgtggtc ttcaacccat cagcattgtg 480
tccagcggcc tcagacctct acgccctgtc ttcagtggat gccaaactct gccttatgtg 540
ttcagtcctt accgtccatc ttactctacc tgcggaggcc tgtagcttct ttattccggg 600
caatgatcac gctgaagatc ccagac 626
<210> 2
<211> 626
<212> DNA
<213>Sheep KRTAP26-1 allele B
<400> 2
cagacgacaa cctgctcctg aaacctcacc atgtcttgcc acaactactg ctccggaaac 60
tacaccttgg ggtctctcag gagtccctgt cacattcccg ttgcctcctc cgtcggcctc 120
tacactccga gtgtgagcgt cggagatggt ctgtgcttgc ccagcagctg tcaggaccga 180
acctggatcc tgagcaatgg ccaggagacc tgcagtgaac ctaccagctg ccagccagcc 240
aactacgagc ccagcagctg tgaaacttcc agctaccctt cttctggttg ctatgtgcca 300
agacccagcc aaggaacgag ttttcttccc gcttcttctt acctctctgg atcctgcctc 360
tcagtgtctt atagaccgct ggcctatgtg tccagcagct cgcgaccctt gagccttctc 420
ccttgtggat atcgcccctc gggttctttg ccctgtggtc ttcaacccat cagcattgtg 480
tccagcggcc tcagacctct acgccctgtc ttcagtggat gccaaactct gccttatgtg 540
ttcagtcctt accgtccatc ttactctacc tgcggaggtc tgtagcttct ttattccggg 600
caatgatcac gctgaagatc ccagac 626
<210> 3
<211> 626
<212> DNA
<213>Sheep KRTAP26-1 allele C
<400> 3
cagacgacaa cctgctcctg aaacctcacc atgtcttgcc acaactactg ctccggaaac 60
tacaccttgg ggtctctcag gagtccctgt cacattcccg tcgcctcctc cgtcggcctc 120
tacactccga gtgtgagcgt tggagatggt ctctgcttgc ccagcagctg tcaggaccga 180
acctggatcc tgagcaatgg ccaggagacc tgcagtgaac ctaccagctg ccagccagcc 240
aactgcgagc ccagcagctg tgaaacttcc agctaccctt cttctggttg ctatgtgcca 300
agacccggcc aaggaacgag ttttcttccc gcttcttctt acctctctgg atcctgcctc 360
tcagtgtctt atagaccgct ggcctatgtg tccagcagct cgcgaccctt gagccttctc 420
ccttgtggat atcgcccctc gggttctttg ccctgtggtc ttcaacccat cagcattgtg 480
tccagcggcc tcagacctct acgccctgtc ttcagtggat gccaaactct gccttatgtg 540
ttcagtcctt accgtccatc ttactctacc tgcggaggcc tgtagcttct ttattccggg 600
caatgatcac gctgaagatc ccagac 626
<210> 4
<211> 626
<212> DNA
<213>Sheep KRTAP26-1 allele D
<400> 4
cagacgacaa cctgctcctg aaacctcacc atgtcttgcc acaactactg ctccggaaac 60
tacaccttgg ggtctctcag gagtccctgt cacattcccg tcgcctcctc cgtcggcctc 120
tacactccga gtgtgagcgt aggagatggt ctctgcttgc ccagcagctg tcaggaccga 180
acctggatcc tgagcaatgg ccaggagacc tgcagtgaac ctaccagctg ccagccagcc 240
aactgcgagc ccagcagctg tgaaacttcc agctaccctt cttctggttg ctatgtgcca 300
agacccagcc aaggaacgag ttttcttccc gcttcttctt acctctctgg atcctgcctc 360
tcagtatctt atagaccgct ggcctatgtg tccagcagct cgcgaccctt gagccttctc 420
ccttgtggat atcgcccctc gggttctttg ccctgtggtc ttcaacccat cagcattgtg 480
tccagcggcc tcagacctct acgccctgtc ttcagtggat gccaaactct gccttatgtg 540
ttcagtcctt accgtccatc ttactctacc tgcggaggcc tgtagcttct ttattccggg 600
caatgatcac gctgaagatc ccagac 626

Claims (9)

1. the genetic marker related to sheep wool fineness, it is characterised in that：It is located on KRTAP26-1 genes, specific core Nucleotide sequence is SEQ ID No.1 in sequence table；When allele be C when, wool is thinner, when allele be B when, wool compared with Slightly；
The allele C is：In sequence table SEQ ID No.1 nucleotide sequence, the base at 102bp is C, the Base at 141bp is that the base at T, 153bp is that the base at C, the 245th is that the base at G, the 307th is at G, the 366th Base be G, the base at the 579th is C；
The allele B is：In sequence table SEQ ID No.1 nucleotide sequence, the base at 102bp is T, the Base at 141bp is that the base at C, 153bp is that the base at G, the 245th is that the base at A, the 307th is at A, the 366th Base be G, the base at the 579th is T.
2. the primer pair for the genetic marker related to sheep wool fineness described in test right requirement 1, it is characterised in that： The primer pair is：
Sense primer：5’-CAGACGACAACCTGCTCCTG-3’；
Anti-sense primer：5’-GTCTGGGATCTTCAGCGTG-3’.
3. application of the genetic marker in identification sheep wool fineness described in claim 1, it is characterised in that：The application bag Include following steps：
(1) genomic DNA of sheep to be measured is extracted；
(2) using the genomic DNA of sheep to be measured as template, performing PCR amplification is entered using the primer pair described in claim 2；
(3) pcr amplification product is detected, if in extension increasing sequence, allele is C, wool is thinner；Allele is B, wool compared with Slightly；
The allele C is：In sequence table SEQ ID No.1 nucleotide sequence, the base at 102bp is C, the Base at 141bp is that the base at T, 153bp is that the base at C, the 245th is that the base at G, the 307th is at G, the 366th Base be G, the base at the 579th is C；
The allele B is：In sequence table SEQ ID No.1 nucleotide sequence, the base at 102bp is T, the Base at 141bp is that the base at C, 153bp is that the base at G, the 245th is that the base at A, the 307th is at A, the 366th Base be G, the base at the 579th is T.
4. application according to claim 3, it is characterised in that：In step (2), the amplification system that the PCR reactions are used It is calculated as with 15 μ l：1.2mm DNA disk templates 1,1.5 μ L10 × buffer buffer solutions, 1.5 μ L 5 × Q solution, 0.6 μ L 2.5mM MgCl2, 0.9 150 μM of μ L dNTPs, each 0.4 μ L of upstream and downstream primer, 0.06 μ L 0.5U Taq polymerases and 9.64 μ LddH2O。
5. application according to claim 3, it is characterised in that：In step (2), the condition of the PCR reactions is：94 DEG C pre- Denaturation 2 minutes, 94 DEG C are denatured 30 seconds, 61 DEG C of annealing 30s, and 72 DEG C extend 30 seconds, and totally 35 circulations finally extend 5 minutes, 4 DEG C Preserve.
6. application according to claim 3, it is characterised in that：In step (3), the detection pcr amplification product is used SSCP is detected, while setting positive control, gel electrophoresis poststaining obtains SSCP electrophoresis banding pattern figures, according to band in collection of illustrative plates Type and positive control result are judged the wool fineness character of sample to be tested.
7. being used for containing primer pair described in claim 2 detects the kit of sheep wool fineness.
8. kit according to claim 7, it is characterised in that：Also include PCR reaction reagents in the kit, it is described PCR reaction reagents are calculated as with 15 μ l：1.2mm DNA disk templates 1,1.5 μ L10 × buffer buffer solutions, 1.5 μ L5 × Q is molten Liquid, 0.6 μ L 2.5mM MgCl2, 0.9 150 μM of μ L dNTPs, each 0.4 μ L of upstream and downstream primer, 0.06 μ L 0.5U Taq polymerases With 9.64 μ LddH2O。
9. the answering in sheep molecular mark of the genetic marker related to sheep wool fineness described in claim 1 With.
CN201710534576.XA 2017-07-03 2017-07-03 Genetic marker related to fineness of sheep wool and application thereof Active CN107267618B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710534576.XA CN107267618B (en) 2017-07-03 2017-07-03 Genetic marker related to fineness of sheep wool and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710534576.XA CN107267618B (en) 2017-07-03 2017-07-03 Genetic marker related to fineness of sheep wool and application thereof

Publications (2)

Publication Number Publication Date
CN107267618A true CN107267618A (en) 2017-10-20
CN107267618B CN107267618B (en) 2020-10-09

Family

ID=60071104

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710534576.XA Active CN107267618B (en) 2017-07-03 2017-07-03 Genetic marker related to fineness of sheep wool and application thereof

Country Status (1)

Country Link
CN (1) CN107267618B (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107815497A (en) * 2017-11-13 2018-03-20 甘肃农业大学 A kind of related genetic marker of Gansu Province east Cashmere Goat character and its application
CN107988389A (en) * 2017-12-14 2018-05-04 铜仁学院 The relevant SNP marker of sheep growth characteristics, the primer for expanding it and the kit including the primer and application
CN109825598A (en) * 2018-11-01 2019-05-31 天津奥群牧业有限公司 It is a kind of to the extremely significant relevant SNP marker of the white sheep hair thickness in Australia, molecular labeling and application
CN110734984A (en) * 2019-10-15 2020-01-31 甘肃农业大学 Genetic marker related to diameter of fine-wool sheep wool fiber and application thereof
CN113278716A (en) * 2021-07-23 2021-08-20 中国农业大学 Gene chip for analyzing characters for sheep wool, molecular probe combination, kit and application

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002000016A1 (en) * 2000-06-28 2002-01-03 Luminis Pty Ltd Altered wool and hair fibres
CN102363813A (en) * 2011-11-18 2012-02-29 新疆农垦科学院 Method for selecting molecular marker for indicating and identifying sheep wool fiber diameters
CN103243167A (en) * 2013-05-15 2013-08-14 新疆农垦科学院 Molecular marker related to diameter of sheep wool fiber and application thereof
CN104099371A (en) * 2014-07-18 2014-10-15 辽宁师范大学 Application of KAP26.1 gene as exogenous gene introduced into cashmere goat cells and used for improving wool fineness

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002000016A1 (en) * 2000-06-28 2002-01-03 Luminis Pty Ltd Altered wool and hair fibres
CN102363813A (en) * 2011-11-18 2012-02-29 新疆农垦科学院 Method for selecting molecular marker for indicating and identifying sheep wool fiber diameters
CN103243167A (en) * 2013-05-15 2013-08-14 新疆农垦科学院 Molecular marker related to diameter of sheep wool fiber and application thereof
CN104099371A (en) * 2014-07-18 2014-10-15 辽宁师范大学 Application of KAP26.1 gene as exogenous gene introduced into cashmere goat cells and used for improving wool fineness

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LI，S.等: "Ovis aries keratin-associated protein KAP26-1 (KRTAP26-1) gene", 《GENEBANK》 *
何军敏等: "KAP16基因对细毛羊重要经济性状的遗传效应分析", 《西南农业学报》 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107815497A (en) * 2017-11-13 2018-03-20 甘肃农业大学 A kind of related genetic marker of Gansu Province east Cashmere Goat character and its application
CN107815497B (en) * 2017-11-13 2020-11-17 甘肃农业大学 Molecular marker related to cashmere characters of Longdong cashmere goat and application thereof
CN107988389A (en) * 2017-12-14 2018-05-04 铜仁学院 The relevant SNP marker of sheep growth characteristics, the primer for expanding it and the kit including the primer and application
CN109825598A (en) * 2018-11-01 2019-05-31 天津奥群牧业有限公司 It is a kind of to the extremely significant relevant SNP marker of the white sheep hair thickness in Australia, molecular labeling and application
CN109825598B (en) * 2018-11-01 2022-05-31 天津奥群牧业有限公司 SNP (Single nucleotide polymorphism) marker remarkably related to Australian white sheep hair thickness, molecular marker and application
CN110734984A (en) * 2019-10-15 2020-01-31 甘肃农业大学 Genetic marker related to diameter of fine-wool sheep wool fiber and application thereof
CN110734984B (en) * 2019-10-15 2023-02-03 甘肃农业大学 Genetic marker related to diameter of fine-wool sheep wool fiber and application thereof
CN113278716A (en) * 2021-07-23 2021-08-20 中国农业大学 Gene chip for analyzing characters for sheep wool, molecular probe combination, kit and application

Also Published As

Publication number Publication date
CN107267618B (en) 2020-10-09

Similar Documents

Publication Publication Date Title
CN107267618A (en) The genetic marker related to sheep wool fineness and its application
Zhang et al. Multi-strategy genome-wide association studies identify the DCAF16-NCAPG region as a susceptibility locus for average daily gain in cattle
CA2556911C (en) Leptin promoter polymorphisms and uses thereof
Tahmoorespur et al. Assessment relationship between leptin and ghrelin genes polymorphisms and estimated breeding values (EBVs) of growth traits in Baluchi sheep
CN104651356B (en) A kind of SNP marker related to Erhualian sow litter trait and its detection method and application
CN105087820A (en) FSHR (follicle stimulating hormone receptor) gene based molecular marker related to porcine reproduction traits as well as detection method and application of molecular marker
CA2600677A1 (en) Association between markers in the leptin gene and carcass traits in commercial feedlot steer and heifers
KR100653400B1 (en) Method for Distinguishing Korean Beef from Non-Korean Beef and Probe and Primer therefor
CN106947826B (en) Method for detecting single nucleotide polymorphism of cattle SERPINA3 gene and application thereof
CN112342301B (en) Method for detecting CNV (CNV) mark of NSMF (NSMF) gene of Hu sheep and application of CNV mark
CN104818326A (en) SNP marker related to erhualian sow littering traits
CN107400712A (en) A kind of related genetic marker of sheep wool fiber length and its application
CN104726577B (en) A kind of SNP marker related to Erhualian sow litter trait and its detection method
CN110964839B (en) Method for auxiliary detection of cattle growth traits through SERPINA3-1 gene CNV labeling and application thereof
CN109371032B (en) Xuefeng silky fowl pectoral muscle melanin deposition pmel17 gene and genetic marking method
CN109913464B (en) Pmel17 gene related to melanin deposition of pectoralis muscles of Xuefeng silky fowl and genetic marking method
CN113774154A (en) Method for screening related molecular markers of bovine body hypervariability and application thereof
CN108841971B (en) Method for detecting cattle SH3PXD2B gene insertion/deletion marker
JP5281775B2 (en) Single nucleotide polymorphisms involved in bovine marbling and their use
CA2660490A1 (en) Leptin and growth hormone receptor gene markers associated with rearing, carcass traits and productive life in cattle
CN104651526B (en) A kind of SNP marker related to Erhualian sow litter trait and its application
CN111455063A (en) Method for detecting duck colored feather character genotype, primer pair and kit
CN104694651A (en) SNP (single nucleotide polymorphism) marker related to Erhualian sow litter traits and detection method and application thereof
CN112458183B (en) Copy number variation molecular marker on pig No. 3 chromosome and related to daily gain and weight and age on market of pig and application thereof
CN110117667B (en) Method for identifying density of pig muscle fibers and primer pair used by method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant