CN107261135A - Application of the gold nano grain as adjuvant in virus sample particle vaccines are prepared - Google Patents
Application of the gold nano grain as adjuvant in virus sample particle vaccines are prepared Download PDFInfo
- Publication number
- CN107261135A CN107261135A CN201710553111.9A CN201710553111A CN107261135A CN 107261135 A CN107261135 A CN 107261135A CN 201710553111 A CN201710553111 A CN 201710553111A CN 107261135 A CN107261135 A CN 107261135A
- Authority
- CN
- China
- Prior art keywords
- gold nano
- vlps
- mouth disease
- particle
- foot
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5258—Virus-like particles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55505—Inorganic adjuvants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/32011—Picornaviridae
- C12N2770/32111—Aphthovirus, e.g. footandmouth disease virus
- C12N2770/32134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Application the invention discloses gold nano grain as adjuvant in virus sample particle vaccines are prepared.The present invention attempts to be used to gold nano grain as adjuvant prepare virus-like particle (VLPs) vaccine, wherein, the gold nano grain is preferably gold nanometer cage or gold nano star.As a result show, after gold nano grain enters in animal body with VLPs combinations injections, can effectively discharge the VLPs of delivery, finally induce special antibody mediated immunity to react and reacted with T lymphocyte immunities.These results indicate that gold nano grain can effective stimulus body produces special immune response in animal body as VLPs adjuvant.The proposition of the present invention provides a kind of adjuvant that can effectively improve foot and mouth disease virus VLPs immune effect, preferably promote VLPs vaccines generation cellular immunity and humoral immunity for the preparation of VLPs vaccines.
Description
Technical field
The present invention relates to the new application of gold nano grain, more particularly to gold nano grain is preparing virus sample particle vaccines assistant
Application in agent, the invention belongs to veterinary drug studying technological domain.
Background technology
Virus-like particle (virus like particles, VLPs) is by having that viral capsid proteins are self-assembly of
With the nano-scale particle of complete virus particle same shape, due to its be free of viral genome, without replication capacity, therefore not
With infectivity.VLPs vaccines have safe, and preparation method is simple and low cost and other advantages become international vaccine and ground
Study carefully the focus in field, and multiple infectious disease in humans and animals, it is antitumor in terms of make progress.Commercialization
VLPs vaccines have hepatitis B vaccine, people's papilloma vaccine and viral hepatitis type E vaccine.But because virus-like particle is compared with inactivation of viruses, carefully
Born of the same parents' immune level is relatively low, easily degraded, and immune duration is undesirable etc..Therefore need to seek a kind of good adjuvant raising VLPs
The immunodominance of vaccine, promotes its popularization and application.
Standard adjuvant has an Alum adjuvant, oil emulsion adjuvant, liposome and immunostimulating complex etc., but due to these adjuvants or
Many or few existing defects, its optimization is also underway.In recent years, nano particle is increasingly becoming the research heat of vaccine carrier and adjuvant
Point.Nano material refer to scantling or its component units in three dimensions at least one dimension be in 0.1nm~
100nm, it has unique physicochemical property etc. due to small-size effect, surface-interface effect and quantum tunneling effect, and
And it or macrophageThe preferred phagocytosis target of BMDC (DC), contributes to antigen to process in the cell, energy
With major histocompatibility complex (MHC) specific binding, transport and submission on-effect cell, enhancing body, which is produced, naturally exempts from
Epidemic disease response and no autoantigenic.
Maiden attempt of the present invention using gold nanometer cage (AuNC) and gold nano star (AuNS) as foot and mouth disease virus VLPs assistant
Agent is applied, and has carried out a series of checkings and condition is groped, it was demonstrated that AuNC and AuNS can be used as foot and mouth disease virus VLPs
Adjuvant, produce and be directed to the high immune response of foot and mouth disease virus, proposition of the invention carries for the application of foot and mouth disease virus VLPs vaccines
New advantage adjuvant is supplied.
The content of the invention
The technical problems to be solved by the invention, which are to provide, a kind of can effectively improve the immune of foot and mouth disease virus VLPs
Effect, preferably promotes VLPs vaccines to produce the adjuvant of cellular immunity and humoral immunity.
In order to achieve the above object, the present invention makes full use of the advantage of gold nano-material, attempts with gold nanometer cage (AuNC)
Or gold nano star (AuNS) is entered as foot and mouth disease virus VLPs adjuvant by experiment in vitro, cell experiment and experiment in vivo
Row checking, determines that cytotoxicity is not present in gold nano grain under finite concentration, can be combined with VLPs, and promote macrophage
The phagocytic activity of cell, improves the immune effect of VLPs vaccines.
Therefore, on this basis, the present invention proposes gold nano grain as adjuvant in virus sample particle vaccines are prepared
Application.
Wherein, it is preferred that described gold nano grain is gold nanometer cage or gold nano star.
Wherein, it is preferred that described virus sample particle vaccines are foot and mouth disease virus particle vaccines.
Wherein, it is preferred that in described virus sample particle vaccines, the mass ratio of virus-like particle and gold nano grain is
1.5-3:1, more preferably 2.5:1.
Further, the invention also provides a kind of foot and mouth disease virus particle vaccines, O-shaped foot and mouth disease virus sample particle is contained
And adjuvant, wherein, described O-shaped foot and mouth disease virus sample particle be by O-shaped foot and mouth disease virus capsid protein VP0, VP1 and
VP3 assembles, and described adjuvant is gold nano grain.
Wherein, it is preferred that coding VP1 gene order is the gene that the VP0 is encoded shown in SEQ ID NO.1
Sequence is shown in SEQ ID NO.2, to encode the gene order of the VP3 for shown in SEQ ID NO.3.
Wherein, it is preferred that described gold nano grain is gold nanometer cage or gold nano star.
Wherein, it is preferred that described foot and mouth disease virus particle vaccines, which are prepared by the following method, to be obtained：
(1) aftosa capsid protein VP0, VP1 and VP3 expression and purifying
VP1 gene order is encoded for shown in SEQ ID NO.1, coding VP0 gene order is SEQ ID NO.2 institutes
Show, coding VP3 gene order is shown in SEQ ID NO.3；
(2) assembled in vitro of foot and mouth disease virus sample particle
Aftosa capsid protein VP0, VP1 and the VP3 of step (1) after purification are subjected to assembled in vitro, O-shaped mouth hoof is obtained
Epidemic disease virus-like particle；
(3) combination of gold nano grain and foot and mouth disease virus sample particle
According to mass ratio it is 1.5-3 by O-shaped foot and mouth disease virus sample particle and gold nanometer cage or gold nano star:1 ratio is mixed
Close, preferably according to 2.5:1 ratio mixing, 12-24h is combined under the conditions of 4 DEG C, then will be centrifuged, and discarded with reference to product
Supernatant, precipitation is the O-shaped foot and mouth disease virus sample particle for being combined with gold nano grain.
Further, the invention also provides described foot and mouth disease virus particle vaccines are preparing prevention or treatment mouth hoof
Purposes in epidemic disease medicine.
The present invention attempt using gold nano grain as foot and mouth disease virus VLPs adjuvant, using its potential carrying capacity,
The characteristic that protected protein swallows from the ability of degraded and beneficial to macrophage, VLPs is successfully delivered and can be in animal body
Release, it is final to stimulate body to produce effective immune response.As a result show, gold nano grain enters with VLPs combination injections
After entering in animal body, the VLPs of delivery can be effectively discharged, finally induces special antibody mediated immunity to react and exempts from T- lymphocytes
Epidemic disease is reacted.These results indicate that gold nano grain can effective stimulus body be produced in animal body as VLPs adjuvant
Special immune response.The proposition of the present invention finds novel adjuvant for VLPs vaccines and has carried out once new trial and innovation.
Brief description of the drawings
VP0, VP1 and the VP3 of Fig. 1 for induced expression and after purification SDS-PAGE results；
Note：Swimming lane 1：Marker, swimming lane 2：Buffer A eluents, swimming lane 3：Buffer B eluents, swimming lane 4-7：It is pure
The destination protein of change.
Fig. 2 is VP0, VP1 and the VP3 for the label protein for removing small ubiquitination SDS-PAGE results；
Swimming lane 1：Marker swimming lanes 2：Swimming lane 3 before digestion：His is removed after digestion.
The Nano-size measurement results for the VLPs that Fig. 3 obtains for assembling；
Measurement result shows that VLPs hydrated diameter 4.826nm accounts for 3.7%, 32.71nm and accounts for 96.3%.
Fig. 4 is the result that the VLPs that assembling is obtained is observed using liquid chromatograph；
Fig. 5 is the grain-size graph of gold nanometer cage and gold nano star；
1：AuNC transmission electron microscope Fig. 2：The AuNC particle diameters 3 measured by Nano-size：AuNS transmission electron microscope Fig. 4：It is logical
Cross the AuNS particle diameters of Nano-size measurements；
The SDS-PAGE results of Fig. 6 combination products；
First swimming lane：Marker, the second swimming lane：AuNC-VLPs conjugate, the 3rd swimming lane：AuNS-VLP combination production
Thing.
Fig. 7 is that the particle diameter for combining preceding gold nano grain and VLPs and the particle diameter for combining rear product are measured by Nano-size；
Wherein figure A is gold nanometer cage and VLPs combination product；It is gold nano star and VLPs combination product to scheme B；
Fig. 8 is cytotoxicity result of the gold nano grain under finite concentration；
1：AuNC is to bhk cell toxicity 2：AuNC is to RAW264.7 cytotoxicities 3：AuNS is to bhk cell toxicity 4：AuNS
To RAW264.7 cytotoxicities.
Fig. 9 is that macrophage swallows experimental result；
Figure 10 is the ELISA testing results of guinea pig serum antibody titer；
Figure 11 is T lymphocyte proliferation assay results.
Embodiment：
The invention will now be further described with reference to specific embodiments, advantages of the present invention and feature will be with description and
It is apparent.But these embodiments are only exemplary, do not constitute any limitation to the scope of the present invention.People in the art
Member to the details and form of technical solution of the present invention it should be understood that can enter without departing from the spirit and scope of the invention
Row modifications or substitutions, but these are changed and replacement is each fallen within protection scope of the present invention.
The preparation of embodiment 1O type foot and mouth disease virus sample particle vaccines
1st, aftosa capsid protein VP0, VP1 and VP3 expression and purifying
(1) small ubiquitin sample modified protein fusion expression vector pSMA and pSMK structure：
A. using saccharomyces cerevisiae genome DNA as template, smt3 genes, primer sequence are expanded by primer of smt3F and smt3R
It is as follows：
smt3F：5 ' GCCATGGGTCATCACCATCATCATCACGGGTCGGACTCAGAAGTCAATCAA3 ',
smt3R：5 ' GGATCCGAGACCTTAAGGTCTCAACCTCCAATCTGT TCGCGGTG3 ',
B. smt3 genes are inserted into the pET-28a carriers with same inscribe ferment treatment after NcoI and BamHI double digestions
In, resulting vehicle is pSMK, and pSMK kalamycin resistance gene is replaced with into ampicillin resistance gene, carrier is obtained
pSMA；
(2) structure of aftosa structural protein gene recombinant expression carrier
According to sequence (the GenBank numbers of logging in for the O-shaped foot and mouth disease virus announced：JN998085.1), with reference to Hoover
Deng method (Hoover DM1, Lubkowski J.DNAWorks:an automated method for designing
oligonucleotides for PCR-based gene synthesis.Nucl.Acids Res.(2002)30(10):
E43. codon optimization and composite structure GFP VP0, VP3 and VP1) are carried out.
Using the gene of synthesis as template, VP0, VP1 and VP3 genetic fragments are expanded respectively with following primer pair：
VP1F：5’GGTCTCTAGGTACCACCAGCACGGGCGAA 3’
VP1R：5’CGCGGATCCTCACAGACTTTGTTTGACCGG 3’
VP0F：5’GGTCTCTAGGTGGTGCGGGCCAGTCATCTCC 3’
VP0R：5’CGCGGATCCTCATTCTTTACTCGGAAATTC 3’
VP3F：5’GGTCTCTAGGT GGTATCTTCCCGGTGGCGTG 3’
VP3R：5’CGCGGATCCTCA TTGCTGACGGGCATCAACC 3’
Using PCR (PCR) method, respectively with primer VP1F/VP1R, VP3F/VP3R and VP0F/VP0R
Amplification obtains coding VP1, VP0 and VP3 genetic fragment, wherein, coding VP1 gene order is shown in SEQ ID NO.1, to compile
Code VP0 gene order is shown in SEQ ID NO.2, coding VP3 gene order is shown in SEQ ID NO.3；Amplification is obtained
VP1, VP0 and VP3 genetic fragment inserted respectively after BsmBI/BamH I double digestions through BsaI digestions handle pSMK or
PSMA, constructed recombinant expression carrier is respectively designated as pSMK/VP0, pSMK/VP1 and pSMA/VP3, using pSMK/VP1 as mould
Plate, by primer of T7BamHI/VP1XhoI, amplification obtains the DNA fragmentation of the prokaryotic expression elements such as promoter containing T7 and VP1 genes,
After BamHI/XhoI double digestions in pSMK/VP0 of the insertion with same digestion processing, gained double expression recombinant vector is named as
pSMK/VP0-VP1；The T7BamHI/VP1XhoI primer sequences are：
T7BamHI：5’GCAATTGGATCCCGTCCGGCGTAGAGGATCGA 3’
VP1XhoI：5’GCGCACCTCGAGTCACAGAGTCTGTTTCTCAGG 3’
(3) expression and purifying of capsid protein
By expression vector pSMK/VP0-VP1 and pSMA/VP3 cotransformation to expression bacterium BL21 (DE3).With kanamycins and
Ampicillin screening positive clone.Select positive colony bacterium 37 DEG C of 220rpm incubated overnights in Double LB culture mediums.Will
Above-mentioned bacterium solution is with 1:100 inoculation LB culture mediums, are cultivated to the OD of bacterium solution in 37 DEG C, 220rpm600Up to 0.6 or so, with final concentration of
1mM IPTG, 25 DEG C overnight induced expression, bacterial sediment is then collected by centrifugation with 5000rpm, 30min, -20 DEG C store for future use.
With the buffer As of 10-20mL ice baths (5mM Tris-HCl, 500mM NaCl, 20mM Imidazol, 0.1%
Tritonx-100, pH=8.5) resuspension bacterial precipitation, ultrasonication somatic cells (ultrasonic time 3s, interval time 3s, altogether
24min, power 200W).12,000rpm centrifugation 20min, take supernatant, abandon precipitation, after being repeated once, by supernatant and Ni-
NTAHisBind Resins are mixed, and 4 DEG C combine 1h.Washed with buffer A five times, the buffer solution of five times of column volumes added every time,
Then 2ml buffer Bs (20mM Tris-HCl, 500mM NaCl, 45mM Imidazol, 0.1%Tritonx-100, pH are added
=8.5) elute, it is therefore an objective to the foreign protein of non-specific binding is washed away, finally with buffer solution C (20mM Tris-HCl, 500mM
NaCl, 500mMImidazol, 0.1%Tritonx-100, pH=8.5) elution destination protein, the destination protein of elution is carried out
SDS-PAGE detects that as a result display obtains the protein (such as Fig. 1) of expected size.Destination protein is added into 10% glycerine, -70
DEG C save backup.
2nd, foot and mouth disease virus VLPs assembled in vitro
The destination protein that purifying is obtained is placed on enzyme cutting buffering liquid (50mM Tris-HCl, 150mM NaCl, pH=
8.0,0.2%Tritonx-100,1mM DTT) in, 37 DEG C of digestion 2h in EP pipes.Digestion mixture is passed through into Ni-
NTAHisBind Resins remove the label protein of small ubiquitination, and collection flows through liquid (such as containing VP0, VP1 and VP3
Fig. 2).Liquid will be flowed through to be placed in assembling buffer solution (20mM Tris-HCl, 500mMNaCl, 1mM CaCl, pH=8.0), group
Whole buffer system is placed on stirring instrument during dress, makes buffer solution mild agitation, and 4 DEG C assemble VLPs overnight.
The VLPs assembled overnight is measured by Nano-size：1mL VLPs assembles concentrations are passed through into 0.22 μm of filter screen
Filtered, the liquid after filtering is added in measuring cup and measured.As shown in figure 3, the virus-like assembled on this condition
Particle hydrated diameter measurement result is main between 30-40nm.VLPs is determined further across sucrose density gradient centrifugation：Will not
Sucrose (45% sucrose 3g, 35% sucrose 2.88g, 25% sucrose 2.76g, 5% sucrose 2.64g) with concentration is added
Into density gradient centrifugation pipe, and be placed on 4 DEG C of standing stay-over demixions, by the VLPs loadings assembled, 38000rpm, 4 DEG C from
Heart 3.5h, is then observed by liquid chromatograph, as a result shows that foot and mouth disease virus sample particle is assembled (such as Fig. 4).
3rd, the pattern of gold nanometer cage and gold nano star
Gold nanometer cage synthesized by Suzhou Institute of Nano-tech. and Nano-bionics, Chinese Academy of Sciences is led to gold nano star
Transmission electron microscope observing is crossed, and is measured by Nano-size.As shown in figure 5, the particle diameter of gold nanometer cage is main in 60-70nm
Between, the particle diameter of gold nano star is main between 70-80nm.
4th, gold nano grain and VLPs combination
According to mass ratio it is 2.5 by O-shaped foot and mouth disease virus VLPs and AuNC or AuNS:1 ratio, is combined under the conditions of 4 DEG C
12h, obtains gold nano grain and VLPs combination product, is respectively designated as AuNC-VLPs and AuNS-VLPs.Then will knot
Product 13000rpm is closed, 4 DEG C of centrifugation 10min, abandoning supernatant will be precipitated with PBS water and be resuspended, carries out SDS-PAGE.As a result table
Bright gold nano grain can be combined (such as Fig. 6) with VLPs.The particle diameter for combining preceding gold nano grain and VLPs is measured by Nano-size
And the particle diameter of the rear product of combination further determines that gold nano grain can be combined (such as Fig. 7) with VLPs.
The cytotoxicity experiment of the gold nano grain of embodiment 2
In 37 DEG C, 5%CO2The hamster kidney cell (BHK) of culture 2 days, Turnover of Mouse Peritoneal Macrophages in incubator
(RAW264.7), digested with pancreatin, discard the DMEM nutrient solutions added after pancreatin containing 10% calf serum, gently will be thin
Born of the same parents' piping and druming is got up, and carries out cell count, cell is diluted into 106Individual/mL, is added in 96 orifice plates, and 100 μ L cells are added per hole
Liquid, in 37 DEG C, 5%CO224h is cultivated in incubator, control wells are reserved, original nutrient solution is discarded, various concentrations (5 μ g/ are added
ML, 10 μ g/mL, 20 μ g/mL, 40 μ g/mL, 60 μ g/mL, 80 μ g/mL, 100 μ g/mL, 200 μ g/mL, 400 μ g/mL) AuNC
With AuNS, each concentration sets 3 repetitions, is then placed within 37 DEG C, 5%CO224h, 48h and 72h are cultivated in incubator respectively,
Culture terminates to add 20 μ L MTS in backward every hole, and 4h is placed in incubator, the absorbance at 490nm is determined with ELIASA.
Cytoactive thinks no cytotoxicity more than 75%.Experiment proves to reach 400 μ g/mL, culture 72 in AuNC, AuNS concentration
The survival rate of cell is all more than 75% in the case of small, it is taken as that gold nano grain is at this concentration without cytotoxicity
(such as Fig. 8).
Influence of the gold nano grain of embodiment 3 to macrophage phagocytosis
Will be in 37 DEG C, 5%CO2The RAW264.7 cells of culture 2 days, are digested with pancreatin, will be digested in incubator
Cell discard pancreatin, add the DMEM nutrient solutions containing 10% calf serum, gently blow and beat cell, progress cell count,
Cell is diluted to 106Individual/mL, is added in 96 orifice plates, 100 μ L is added per hole, in 37 DEG C, 5%CO224h is cultivated in incubator,
It is separately added into various concentrations (5 μ g/mL, 10 μ g/mlL, 20 μ g/mL) PBS, Flagelin, VLPs, AuNC, AuNS, AuNC-
VLPs and AuNS-VLPs.In 37 DEG C, 5%CO224h is cultivated in incubator, the μ of 0.072% neutral red solution 200 is added per hole
Neutral red solution is removed after L, culture 30min, is washed with PBS 3 times, adds cytolysate (0.01M glacial acetic acid and absolute ethyl alcohol
Isometric mixed liquor) 200 μ L, after after cell dissolving, the absorbance at 570nm is determined with ELIASA, reacts huge with OD values
The phagocytic activity of phagocyte.Experimental result shows that AuNC, AuNS and AuNC-VLPs, AuNS-VLPs have and promotes macrophage
The effect (such as Fig. 9) of phagocytosis.
The ELISA detections of the valence of vaccine antibody of embodiment 4
The cavy of 49 4 week old is divided into 7 groups, first group is immune as control with PBS, and second group is immune with VLPs, the
Three groups of aftosa vaccines with inactivation are immunized, and the 4th group is immunized with AuNC-VLPs (50 μ g) with reference to product, the 5th group
It is immunized with AuNC-VLPs (25 μ g) with reference to product, the 6th group is immunized with AuNS-VLPs (50 μ g) with reference to product, the
Seven groups are immunized with AuNS-VLPs (25 μ g) with reference to product.Started respectively before immune with immune latter first week weekly to each
Group cavy is taken a blood sample, and determines immune rear antibody production.
O-shaped foot and mouth disease virus rabbit anti-serum is diluted to working concentration (1 with coating buffer solution:1000), and in 96 hole ELISA
Add 50 μ L per hole on plate, vibrate, shrouding, 4 DEG C overnight.Liquid is discarded, PBST is cleaned 3 times, patted dry on blotting paper, is added per hole
Dilution (1:8) antigen (O-shaped aftosa inactivation poison) 50 μ L, 37 DEG C of reaction 1h.Liquid is discarded, PBST is cleaned 3 times, in blotting paper
On pat dry, per hole add 50 μ L yin and yang attributes serum with dilution (1:32) good immune rear guinea pig serum, 37 DEG C of incubation 1h.Discard liquid
Body, PBST is cleaned 3 times, is patted dry on blotting paper, and rabbit-anti cavy enzyme conjugates is diluted to working concentration (1 with PBST:1000), often
Hole adds 50 μ L, shrouding, 37 DEG C of incubation 1h.Liquid is discarded, PBST is cleaned 3 times, patted dry on blotting paper, adds 50 μ L substrates molten per hole
Liquid (must add hydrogen peroxide, add 100 μ L hydrogen peroxide per 10mL), 37 DEG C of incubation 15min.Then terminated per the μ L terminate liquids of Kong Zaijia 50
Reaction, in 490nm detection optical density (OD values).As a result show, compared with the cavy of PBS control group, VLPs groups, inactivated vaccine
The guinea pig serum antibody level that group and gold nano grain-VLPs combine product immune group is persistently raised, and gold nano grain-
The level of the antibody level immune group more independent than VLPs of VLPs compound immune groups is high.This explanation gold nano grain has to VLPs
Protective effect, and gold nano grain can further enhance VLPs immune effect, produce animal body higher levels of
Specific antibody (Figure 10).
The T- lymphocyte proliferation assays of the vaccine of embodiment 5
The cavy of 49 4 week old is divided into 7 groups, first group is immune as control with PBS, and second group is immune with VLPs, the
Three groups of aftosa vaccines with inactivation are immunized, and the 4th group is immunized with AuNC-VLPs (50 μ g) with reference to product, the 5th group
It is immunized with AuNC-VLPs (25 μ g) with reference to product, the 6th group is immunized with AuNS-VLPs (50 μ g) with reference to product, the
Seven groups are immunized with AuNS-VLPs (25 μ g) with reference to product.
1 cavy is collected at random in first time immune rear 4th week each group and is taken off neck execution, is put into alcohol and is soaked 5min
Sterilization, it is sterile to take spleen, 1mL serum-free RPMI 1640 culture mediums are added, is ground on 200 mesh copper mesh, uses serum-free RPMI
1640 culture medium rinses copper mesh, the splenocyte suspension for grinding acquisition is inserted in 2mL centrifuge tubes, 4 DEG C, 1000rpm centrifugations
10min, often adds 1.5mL erythrocyte cracked liquids, 4 DEG C, 1000rpm centrifugation 10min, abandoning supernatant, with without Ca in pipe2+With
Mg2+Hanks liquid wash down twice and with RPMI 1640 culture mediums mix, after cell count, with the RPMI containing 10%FBS
1640 culture medium is diluted to 106Individual/mL cell concentrations.The lymphocyte suspension diluted is added into (100 μ in 96 porocyte plates
L/ holes), each sample sets 3 multiple holes, and final concentration of 8 μ g/mL ConA differential stimulus things are added per hole, while to be not added with thorn
It is control to swash the lymphocyte of thing, and culture plate is containing 5%CO237 DEG C of constant incubator culture 72h after, per hole add 20 μ L
MTS reagent, 4h is cultivated in 37 DEG C, and the OD value for being 490nm with ELIASA Detection wavelength calculates stimulus index
(stimulation index,SI).SI=(ConA stimulates the average OD490nm- in hole not stimulate the average OD490nm of group)/
(the average OD490nm for not stimulating the average OD490nm- blank 1640 culture medium group of group).As a result show, gold nano grain-
After the lymphocyte of the cavy of VLPs combination product immune groups is stimulated through ConA stimulants, the cultivation effect of T- lymphocytes is higher than
Independent VLPs immune groups.This explanation gold nano grain can deliver VLPs and enter after cell, can stimulate as VLPs vaccine carriers
Body produces the cellullar immunologic response (Figure 11) more stronger than independent VLPs.
Sequence table
<110>Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences
Suzhou Institute of Nano-tech. and Nano-bionics, Chinese Academy of Sciences
<120>Application of the gold nano grain as adjuvant in virus sample particle vaccines are prepared
<130> KLPI170133
<160> 3
<170> PatentIn 3.5
<210> 1
<211> 639
<212> DNA
<213> VP1
<400> 1
accaccagca cgggcgaatc ggcagatccg gttacggcaa cggtcgaaaa ctacggcggc 60
gaaacgcagg ttcaacgtcg tcatcatacc gatgttagct ttattctgga ccgtttcgtg 120
aaagttacgc cgaaggattc tatcaacgtc ctggacctga tgcagacccc gccgcatacc 180
ctggtgggcg cactgctgcg caccgccacg tattactttg cagatctgga agtcgctgtg 240
aaacacgaag gcgacctgac ctgggtcccg aatggtgcac cggaagcagc actggataac 300
accacgaatc cgacggcata tcataaagct ccgctgaccc gtctggcact gccgtacacg 360
gccccgcacc gtgttctggc aaccgtctat aacggcaatt gcaaatacgc tggcggtagt 420
ctgccgaacg tgcgtggtga tctgcaggtt ctggcccaaa aggcagcttg gccgctgccg 480
accagcttca attatggtgc gattaaagcc acccgtgtga cggaactgct gtatcgtatg 540
aagcgtgcag aaacctactg tccgcgtccg ctgctggcag tccacccgtc cgcagcacgc 600
cataagcaaa aaatcgtcgc cccggtcaaa caaagtctg 639
<210> 2
<211> 909
<212> DNA
<213> VP0
<400> 2
ggtgcgggcc agtcatctcc ggcgacgggt tcccagaatc aatcaggcaa cacgggttcc 60
atcatcaaca actactacat gcaacagtat cagaacagtg tggataccca actgggcgac 120
aacgcggttt caggcggttc gaatgaaggt agtaccgaca ccacgtccac gcataccacg 180
aatacccaga acaatgattg gtttagcaaa ctggcaagct ctgctttttc tggcctgttc 240
ggtgcgctgc tggccgacaa aaagaccgaa gaaaccacgc tgctggaaga tcgtattctg 300
accacgcgca acggccatac cacgagtacc acgcagagtt ccgtcggcat cacgcacggt 360
tacgcgaccg ccgaagattt cgtgtcaggc ccgaatacgt cgggtctgga aacccgtgtg 420
gttcaagccg aacgcttttt caaaacgcac ctgtttgatt gggtgacctc cgacccgttc 480
ggtcgttgct atctgctgga actgccgacg gatcacaagg gcgtttacgg tagcctgacc 540
gactcttatg cgtacatgcg caacggctgg gatgtggaag ttaccgccgt gggtaaccag 600
tttaatggcg gttgcctgct ggttgcaatg gtcctggaac tgtgttctat tgaacgtcgc 660
gaactgttcc agctgaccct gtttccgcat caattcatta acccgcgtac caatatgacg 720
gctcacatca aagttccgtt tgtcggcgtg aaccgctatg atcagtacaa agtccacaag 780
ccgtggaccc tggtcgtgat ggttgtcgca ccgctgaccg ttaatacgga aagcgctccg 840
caaatcaagg tgtatgccaa tatcgccccg acgaatgtcc acgttgctgg tgaatttccg 900
agtaaagaa 909
<210> 3
<211> 660
<212> DNA
<213> VP3
<400> 3
ggtatcttcc cggtggcgtg tagcgatggt tacggtggcc tggtgacgac ggacccgaaa 60
acggcagacc cggtgtatgg caaagttttt aacccgccgc gtaatctgct gccgggtcgc 120
ttcaccaacc tgctggatgt tgccgaagca tgcccgacgt ttctgcattt cgatggcgac 180
gtgccgtatg ttaccacgaa aaccgattcg gaccgtgtcc tggcccagtt tgacctgtcc 240
ctggcggcca agcatatgtc aaacaccttc ctggctggcc tggcgcagta ttacacccaa 300
tacagcggta cggtgaatct gcactttatg ttcaccggcc cgacggatgc taaagcgcgc 360
tatatgattg cctacgcacc gccgggtatg gaaccgccaa agaccccgga agcagctgcg 420
cattgcattc acgcggaatg ggacaccggc ctgaacagca aatttacgtt ctctatcccg 480
tatctgagtg ccgcagatta tgcctacacc gcaagtgacg ctgcggaaac cacgaatgtc 540
cagggttggg tgtgtctgtt tcaaatcacg cacggcaagg ctgaaggtga tgcactggtt 600
gtgatggcgt cggcgggtaa agattttgaa ctgcgtctgc cggttgatgc ccgtcagcaa 660
Claims (10)
1. application of the gold nano grain as adjuvant in virus sample particle vaccines are prepared.
2. application as claimed in claim 1, it is characterised in that described gold nano grain is gold nanometer cage or gold nano star.
3. application as claimed in claim 1, it is characterised in that described virus sample particle vaccines are foot and mouth disease virus particle epidemic disease
Seedling.
4. the application as described in claim any one of 1-3, it is characterised in that in described virus sample particle vaccines, virus-like
The mass ratio of particle and gold nano grain is 1.5-3:1.
5. application as claimed in claim 4, it is characterised in that in described virus sample particle vaccines, virus-like particle and gold
The mass ratio of nano particle is 2.5:1.
6. a kind of foot and mouth disease virus particle vaccines, it is characterised in that containing O-shaped foot and mouth disease virus sample particle and adjuvant, wherein,
Described O-shaped foot and mouth disease virus sample particle is assembled by capsid protein VP0, VP1 and VP3 of O-shaped foot and mouth disease virus, institute
The adjuvant stated is gold nano grain.
7. foot and mouth disease virus particle vaccines as claimed in claim 6, it is characterised in that coding VP1 gene order is
Shown in SEQ ID NO.1, encode the gene order of the VP0 shown in SEQ ID NO.2, to encode the gene order of the VP3
Shown in SEQ ID NO.3.
8. foot and mouth disease virus particle vaccines as claimed in claim 6, it is characterised in that described gold nano grain is gold nano
Cage or gold nano star.
9. foot and mouth disease virus particle vaccines as claimed in claim 6, it is characterised in that be prepared by the following method and obtain：
(1) aftosa capsid protein VP0, VP1 and VP3 expression and purifying
VP1 gene order is encoded for shown in SEQ ID NO.1, coding VP0 gene order is shown in SEQ ID NO.2, to compile
Code VP3 gene order is shown in SEQ ID NO.3；
(2) assembled in vitro of foot and mouth disease virus sample particle
Aftosa capsid protein VP0, VP1 and the VP3 of step (1) after purification are subjected to assembled in vitro, O-shaped hoof-and-mouth disease is obtained
Malicious sample particle；
(3) combination of gold nano grain and foot and mouth disease virus sample particle
According to mass ratio it is 1.5-3 by O-shaped foot and mouth disease virus sample particle and gold nanometer cage or gold nano star:1 ratio mixing, it is excellent
Choosing is according to 2.5:1 ratio mixing, 12-24h is combined under the conditions of 4 DEG C, then will be centrifuged with reference to product, supernatant discarding
Liquid, precipitation is the O-shaped foot and mouth disease virus sample particle for being combined with gold nano grain.
10. the foot and mouth disease virus particle vaccines described in claim any one of 6-9 are in prevention or treatment aftosa medicine is prepared
Purposes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710553111.9A CN107261135B (en) | 2017-07-07 | 2017-07-07 | Application of gold nanoparticles as adjuvant in preparation of virus-like particle vaccine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710553111.9A CN107261135B (en) | 2017-07-07 | 2017-07-07 | Application of gold nanoparticles as adjuvant in preparation of virus-like particle vaccine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107261135A true CN107261135A (en) | 2017-10-20 |
| CN107261135B CN107261135B (en) | 2020-11-10 |
Family
ID=60073058
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710553111.9A Active CN107261135B (en) | 2017-07-07 | 2017-07-07 | Application of gold nanoparticles as adjuvant in preparation of virus-like particle vaccine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107261135B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110393797A (en) * | 2019-05-27 | 2019-11-01 | 南开大学 | The preparation method and application of glycopeptide vaccine based on glycolipid adjuvant |
| CN113182528A (en) * | 2021-03-15 | 2021-07-30 | 西北工业大学宁波研究院 | Gold nanocage material capable of photoresponse releasing NO and resisting MRSA biofilm as well as preparation method and application of gold nanocage material |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104404074A (en) * | 2014-11-03 | 2015-03-11 | 斯澳生物科技（苏州）有限公司 | Foot-and-mouth disease virus capsid protein tandem coexpressions and virus-like particle preparation method |
| CN106479986A (en) * | 2016-10-31 | 2017-03-08 | 中国农业科学院兰州兽医研究所 | A kind of O-shaped foot and mouth disease viruses sample granule and its production and use |
-
2017
- 2017-07-07 CN CN201710553111.9A patent/CN107261135B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104404074A (en) * | 2014-11-03 | 2015-03-11 | 斯澳生物科技（苏州）有限公司 | Foot-and-mouth disease virus capsid protein tandem coexpressions and virus-like particle preparation method |
| CN106479986A (en) * | 2016-10-31 | 2017-03-08 | 中国农业科学院兰州兽医研究所 | A kind of O-shaped foot and mouth disease viruses sample granule and its production and use |
Non-Patent Citations (1)
| Title |
|---|
| JORGE ALBERTO SALAZAR-GONZÁLEZ ET AL: "Gold nanoparticles and vaccine development", 《EXPERT REV VACCINES》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110393797A (en) * | 2019-05-27 | 2019-11-01 | 南开大学 | The preparation method and application of glycopeptide vaccine based on glycolipid adjuvant |
| CN113182528A (en) * | 2021-03-15 | 2021-07-30 | 西北工业大学宁波研究院 | Gold nanocage material capable of photoresponse releasing NO and resisting MRSA biofilm as well as preparation method and application of gold nanocage material |
| CN113182528B (en) * | 2021-03-15 | 2022-05-17 | 西北工业大学宁波研究院 | Gold nanocage material capable of photoresponse releasing NO and resisting MRSA biofilm as well as preparation method and application of gold nanocage material |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107261135B (en) | 2020-11-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Steele et al. | Synthetic plant virology for nanobiotechnology and nanomedicine | |
| CN112076315A (en) | Nano antigen particle fused with new coronavirus S protein and ferritin subunit, new coronavirus vaccine, and preparation method and application thereof | |
| Pumpens et al. | The true story and advantages of RNA phage capsids as nanotools | |
| WO2021147025A1 (en) | Anti 2019-ncov vaccine | |
| US20130236491A1 (en) | Spherical nano and microparticles derived from plant viruses for the display of foreign proteins or epitopes | |
| CN104710515B (en) | Human mammilla tumor virus L 1 protein mutant and preparation method thereof | |
| WO2014183548A1 (en) | Ev71 virus-like particles and preparation method and application thereof | |
| CN106421770B (en) | Nanoparticle containing EV71VP1 protein and preparation method thereof | |
| CN113736801B (en) | mRNA and novel coronavirus mRNA vaccine comprising same | |
| CN110156896B (en) | Recombinant foot-and-mouth disease virus-like particle and preparation method and application thereof | |
| CN109689862B (en) | Purification of recombinant EV71 virus-like particle and vaccine preparation method thereof | |
| CN113354740B (en) | Classical swine fever virus self-assembly protein nanoparticle, preparation method and application | |
| Alemzadeh et al. | Generation of recombinant protein shells of Johnson grass chlorotic stripe mosaic virus in tobacco plants and their use as drug carrier | |
| CN112979826B (en) | Encephalitis B virus nanoparticle vaccine and preparation method and application thereof | |
| WO2023246621A1 (en) | Coxsackievirus a10 strain and use thereof | |
| CN109536460A (en) | A kind of CV-A10 virus seed culture of viruses and its inactivated vaccine for human | |
| WO2023246639A1 (en) | Coxsackievirus a6 type strain, and immunogenic composition and use thereof | |
| CN107261135A (en) | Application of the gold nano grain as adjuvant in virus sample particle vaccines are prepared | |
| CN112641935B (en) | Subunit vaccine containing particle carrier and application thereof | |
| CN109966483B (en) | Multi-antigen universal influenza vaccine based on ferritin and preparation method and application thereof | |
| WO2021169768A1 (en) | Method for in vitro assembly of virus-like particles of foot-and-mouth disease and use thereof | |
| Yuan et al. | Virus-like particle-based nanocarriers as an emerging platform for drug delivery | |
| CN107029226A (en) | Application of the foot and mouth disease virus sample particle in as recombinant plasmid delivery vehicle | |
| CN102839159A (en) | CoxA16 virus strain and human CoxA16 inactivated vaccine | |
| CN107475207B (en) | Mineralized foot-and-mouth disease virus-like particles and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |