CN107236714B - Method for separating porcine parvovirus - Google Patents
Method for separating porcine parvovirus Download PDFInfo
- Publication number
- CN107236714B CN107236714B CN201710640851.6A CN201710640851A CN107236714B CN 107236714 B CN107236714 B CN 107236714B CN 201710640851 A CN201710640851 A CN 201710640851A CN 107236714 B CN107236714 B CN 107236714B
- Authority
- CN
- China
- Prior art keywords
- porcine parvovirus
- solution
- virus
- berberine
- mixing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14311—Parvovirus, e.g. minute virus of mice
- C12N2750/14351—Methods of production or purification of viral material
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A method for separating porcine parvovirus belongs to the technical field of biological products for animals. Which comprises the following steps: 1) preparing a CEF primary cell; 2) collecting and processing pathological materials; 3) cell inoculation of the virus; 4) and (5) virus identification. The invention has the following beneficial effects: according to the separation method of the porcine parvovirus, the treatment method of the pathological materials does not need freeze thawing, the mechanization degree is high, and time and labor are saved; the primary CEF cells are simple and quick to prepare and low in cost, the virus separation period is greatly shortened, and the timely diagnosis and research of porcine parvovirus diseases are facilitated.
Description
Technical Field
The invention belongs to the technical field of biological products for livestock, and particularly relates to a separation method of porcine parvovirus.
Background
Porcine Parvovirus (PPV) belongs to a member of the genus parvovirus of the family parvoviridae, and is a self-replicating virus. PPV is one of the important pathogens causing the reproductive disorders of sows and can cause the abortion, premature birth, stillbirth, mummy, weak piglets and the sterility of the sows and the mass death of newborn piglets of the sows. PPV mainly passes through alimentary canal and respiratory tract infection, and the infection of boars, fattening pigs and sows is mostly caused by contacting with polluted feed and drinking water, and the PPV can also be transmitted through reproductive tract. The infected pigs are the main source of infection for PPV, and the virus in their secretions and excretions can remain infected for months, and the houses contaminated with them remain infected for at least 4 months, mainly because PPV is stable to heat and resistant to many common disinfectants, and therefore, contaminated houses are the main reservoir of PPV. Pigs are the only susceptible animals of PPV, and domestic and wild pigs of different ages and sexes can be infected, and antibodies specific to PPV are also present in the serum of animals such as cattle, sheep, cats, guinea pigs, mice and rats. Since the PPV was determined by separation in the middle of the 60's in the 20 th century, the virus was isolated in Europe, Asia, America, etc., and has now become distributed worldwide, resulting in serious economic loss in the pig industry worldwide.
In view of the fact that the porcine parvovirus is epidemic in the world and seriously harms the pig industry, the rapid separation and identification of the porcine parvovirus plays an important role in controlling the porcine parvovirus, but the traditional virus separation method has a long period, the virus sample treatment process is complicated, the pollution is easy, the purity of the separated virus is not high, and the timely diagnosis of the porcine parvovirus is not facilitated, so that the invention provides the rapid separation and identification method of the porcine parvovirus, which has important significance in rapid diagnosis and research of the porcine parvovirus.
Disclosure of Invention
Aiming at the problems in the prior art, the invention aims to design and provide a technical scheme of a porcine parvovirus rapid separation and identification method, and the method provides a basis for diagnosis and research of porcine parvovirus diseases.
The porcine parvovirus separation method is characterized by comprising the following steps:
1) collecting SPF chick embryo with abundant blood vessel and vigorous activity of 9-10 days, rinsing embryo in PBS solution containing berberine at pH of 7.0-7.4, removing limbs, head and viscera of embryo, and cutting the rest embryo into 1mm3Rinsing the small blocks with PBS solution, respectively adding PBS solution and 2.5% pancreatin solution according to the volume ratio of 80:1-120:1, fully mixing, standing for 3-5min, adding 2-5% fetal calf serum to stop digestion, centrifuging at 1200r/min for 8-10min at 800-2Culturing in an incubator;
2) aseptically taking dead fetus bred by sow and parenchymal organs such as heart, liver, spleen, lung and kidney of mummy fetus, mincing in a mincing machine, adding D-Hanks liquid with the mass of 1-3 times of the total mass of minced meat into minced meat, fully grinding by a colloid mill, uniformly mixing, placing the obtained mixed solution in a high-pressure homogenizer, controlling the temperature below 25 ℃ in the homogenization treatment process to obtain homogenate treatment liquid, adding the D-Hanks liquid into the homogenate treatment liquid according to the ratio of 1:1-1:3, uniformly mixing, standing for 20-30min, performing split charging centrifugation, centrifuging at 3000 frequency of 5000r/min, centrifuging for 8-15min, taking supernatant for later use, performing microfiltration treatment on the obtained supernatant by a hollow fiber membrane microfiltration system with the pore diameter of 150KD-200KD, collecting microfiltrate, adding the D-Hanks liquid according to the ratio of 1:8-1:10 for dilution, filtering the diluted micro-filtrate by a 0.22um microporous filter membrane, and collecting the filtrate, namely the porcine parvovirus stock solution;
3) discarding cell culture solution from primary CEF cells cultured for 24h, adding porcine parvovirus stock solution and cell culture solution at a volume ratio of 1:8-1:10, placing the cell bottle at 37 deg.C and 5% CO2Incubating for 1h in an incubator, discarding virus solution, adding virus maintaining solution containing 2% fetal calf serum, culturing for 90-96h, observing cytopathic effect every day, collecting cell sap with obvious pathological changes, and storing at-20 deg.C.
The porcine parvovirus separation method is characterized in that the PBS solution containing berberine with the pH of 7.0-7.4 in the step 1) is composed of the following components in every 1000 ml: 6-10 g of sodium chloride,
0.05-0.5 g of potassium chloride, 1-1.2 g of disodium hydrogen phosphate, 0.05-0.5 g of monopotassium phosphate, 0.05-0.2 g of calcium chloride,
0.05-0.2 g of magnesium chloride containing 6 crystal water and 1-3 mg of berberine; mixing the above components, dissolving in 1000ml double distilled water, filtering with 0.22um filter membrane, and storing at 4 deg.C.
The porcine parvovirus separation method is characterized in that the PBS solution containing berberine with the pH of 7.0-7.4 in the step 1) is composed of the following components in every 1000 ml: 6-10 g of sodium chloride, 0.05-0.5 g of potassium chloride, 1-1.2 g of disodium hydrogen phosphate, 0.05-0.5 g of monopotassium phosphate, 0.05-0.2 g of calcium chloride,
0.05-0.2 g of magnesium chloride containing 6 crystal water and 1-3 mg of berberine; mixing the above components, dissolving in 1000ml double distilled water, filtering with 0.22um filter membrane, and storing at 4 deg.C.
The porcine parvovirus separation method is characterized in that in the step 1), every 1000ml of D-Hanks liquid comprises the following components: 8 to 10 g of sodium chloride, 0.4 to 0.6g of potassium chloride, 0.04 to 0.08g of disodium hydrogen phosphate containing 1 crystal water, 0.04 to 0.06g of monopotassium phosphate, 0.3 to 0.5 g of sodium bicarbonate,
0.01-0.02g of phenol red; mixing the above components, dissolving in 1000ml double distilled water, filtering with 0.22um filter membrane, and storing at 4 deg.C.
The invention has the following beneficial effects:
1. according to the separation method of the porcine parvovirus, provided by the invention, the treatment method of the diseased material does not need freeze thawing, and the diseased material passes through a meat grinder, a high-pressure homogenizer, a hollow fiber membrane filtration system and the like, so that the mechanization degree is high, the integrity of the virus is ensured, and the separation method is time-saving and labor-saving.
2. Compared with the preparation of porcine cells, the separation method of porcine parvovirus provided by the invention has the advantages that the preparation of primary CEF cells is simple and rapid, the cost is low, the virus separation period is greatly shortened, and the timely diagnosis and research of porcine parvovirus diseases are facilitated.
3. The separation method of porcine parvovirus provided by the invention directly inoculates the separated virus in the separated CEF cell of avian origin, obtains the virus with obvious pathological changes and high virus content, and finds a new susceptible cell for the culture of porcine parvovirus.
Drawings
FIG. 1 shows the result of PCR identification of PPV;
FIG. 2 is a graph of an indirect immunofluorescence assay using murine anti-PPV immune serum on virus-inoculated cell cultures;
FIG. 3 is a graph of an indirect immunofluorescence assay using murine anti-PPV immune serum against inoculated normal cell cultures.
In fig. 1:1, negative control; 2: a positive control; 3: the isolated strain; m: DL1000 bp.
Detailed Description
In order that the invention may be more readily understood, reference will now be made to the following examples which are intended to illustrate the invention. It is to be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention, and that specific experimental procedures not mentioned in the following examples are generally conducted in accordance with conventional experimental procedures.
Example 1: preparation of CEF Primary cells
Collecting SPF chick embryo with abundant blood vessel and vigorous activity of 9-10 days, sterilizing, gently breaking the chick embryo in air chamber with big-end tweezers to expose the embryo, carefully picking out the embryo, and placing in PBS solution (each 1000ml contains sodium chloride 6-10 g, chlorine) containing berberine at pH 7.00.05-0.5 g of potassium chloride, 1-1.2 g of disodium hydrogen phosphate, 0.05-0.5 g of monopotassium phosphate, 0.05-0.2 g of calcium chloride, 0.05-0.2 g of magnesium chloride containing 6 crystal water and 1-3 mg of berberine; mixing the above components, dissolving in 1000ml double distilled water, filtering with 0.22um filter membrane, and storing at 4 deg.C; or sodium chloride 6-10 g, potassium chloride 0.05-0.5 g, disodium hydrogen phosphate 1-1.2 g, potassium dihydrogen phosphate 0.05-0.5 g, calcium chloride 0.05-0.2 g, magnesium chloride containing 6 crystal water 0.05-0.2 g, berberine 1-3 mg) rinsing once, removing limbs, head and viscera of embryo, and cutting the rest embryo into 1mm pieces3Rinsing the small blocks with PBS solution, adding PBS solution and 2.5% pancreatin solution at a ratio of 80:1, 90:1 or 120:1 (V: V), mixing, standing for 5min, adding 2% fetal calf serum to stop digestion, centrifuging at 1000r/min for 8min, discarding supernatant, resuspending the precipitate with 2% fetal calf serum, filtering with cell filter, counting, packaging in cell bottles, placing at 37 deg.C and 5% CO2Culturing in an incubator.
EXAMPLE 2 Collection and treatment of disease Agents
Aseptically collecting dead fetus of breeding sow and parenchymal organs of mummy fetus, such as heart, liver, spleen, lung and kidney, mincing in a meat mincer, adding D-Hanks liquid 2 times of total mass of meat mince, fully grinding by a colloid mill, and mixing uniformly. Placing the obtained mixed solution in a high-pressure homogenizing machine, and controlling the temperature below 25 ℃ in the homogenizing process to obtain the homogenizing treatment solution. Adding D-Hanks solution (each 1000ml comprises 8-10 g of sodium chloride, 0.4-0.6g of potassium chloride, 0.04-0.08g of disodium hydrogen phosphate containing 1 crystal water, 0.04-0.06g of potassium dihydrogen phosphate, 0.3-0.5 g of sodium bicarbonate and 0.01-0.02g of phenol red) into the homogenate treatment solution according to the ratio of 1:1, 1:2 or 1:3, fully mixing the above components, dissolving in 1000ml of double distilled water, filtering with a 0.22um filter membrane, storing at 4 ℃ for later use, mixing uniformly, standing for 25min, performing centrifugation according to 3000r/min, centrifuging for 10min, and taking supernatant for later use. Performing microfiltration treatment on the obtained supernatant by a hollow fiber membrane microfiltration system (purchased from Tianjin membrane and Tianmu Membrane engineering technology Co., Ltd.) with the aperture of 200KD, collecting the micro-filtrate, adding D-Hanks solution according to the ratio of 1:8, 1:9 or 1:10 for dilution, passing the diluted micro-filtrate through an ultrafiltration system with the aperture, collecting the filtrate, filtering the filtrate by a microfiltration membrane with the aperture of 0.22um, and collecting the filtrate, namely the porcine parvovirus stock solution.
Example 3: cell inoculation of viruses
Removing cell culture solution from primary CEF cells cultured for 24 hr, adding virus stock solution and cell culture solution at 1:8, 1:9 or 1:10 (V: V), setting PPV positive control and blank control, placing at 37 deg.C and 5% CO2Incubating for 1h in an incubator, discarding virus solution, adding virus maintaining solution containing 2% fetal calf serum, continuing culturing for 90h, observing cytopathic effect every day, establishing negative and positive control groups, collecting cell sap with obvious pathological changes, and storing at-20 deg.C.
Isolation and identification of porcine parvovirus in test example
1 Material
1.1 isolation of porcine parvovirus
The isolation was carried out according to examples 1 to 3 of the present invention.
1.2 DMEM basal medium, fetal bovine serum was purchased from GIBCO.
1.30.5% guinea pig erythrocytes were prepared by research and development center of Meibao Longong Biotechnology Limited, Zhejiang.
1.4 porcine parvovirus positive serum and porcine parvovirus indirect immunofluorescence detection kit, which is purchased from the Chinese veterinary medicine inspection institute.
1.5 porcine parvovirus positive strains, which are preserved by the research and development center of Mei Baolong biotechnology Limited company in Zhejiang.
1.6 PCR-related reagents, purchased from Dalibao Biopsis.
2 method
2.1 measurement of Virus content
PPV cell virus solution harvested in example 3 was diluted 10-fold in DMEM base medium, transferred to 96-well CEF cell culture plates with a full monolayer at 0.1 m L/well, cultured in a 5% incubator at 37 ℃ for 4 days, observed and recorded every day, and TCID50 was calculated according to the Reed-Muench method.
2.2 micro neutralization test
Respectively carrying out 10-fold gradient dilution on porcine parvovirus standard positive serum and swine fever positive serum, uniformly mixing with 200 TCID50 cell virus solutions, placing at 37 ℃, neutralizing for 1h, inoculating into a 96-well cell plate, wherein each dilution has 8 wells and 100 ul per empty, and a positive control without serum treatment and a normal cell negative control are arranged, and continuously observing for 5 days.
2.3 hemagglutination assay
The harvested virus cell culture was diluted with PBS at 1:2, 1:4, 1:8 … equal fold ratio on a 96-well U plate, and hemagglutination test was performed with 0.5% guinea pig erythrocytes, 50ul of erythrocytes were added to each well, 50% of erythrocytes were used as an end point, and the highest dilution at which the sample showed an end point of agglutination was HA titer, while erythrocyte control was used.
2.4 PCR identification
In the test, a pair of primers and an upstream primer (P1) are designed according to the nucleotide sequence of a porcine parvovirus reference strain NADL-2 strain VP2 gene published by GenBank by using software such as Oligo 6.0, Primer5.0 and the like: TGGTCTCCTTCTGTGGTAGG, downstream primer (P2): CAGAATCAGCAACCTCAC, the amplified fragment is 445 bp. Extracting virus DNA by using a DNA extraction kit, taking the virus DNA as a template, and adopting a 25 ul PCR reaction system: PCR Master Mix 12.5ul, upstream and downstream primers 1 ul, template DNA 1 ul, ddH2O 8.5.5 ul, the reaction program is: 5min at 95 ℃; 30 cycles of 95 ℃ for 30s, 58 ℃ for 30s and 72 ℃ for 1 min; and 5min at 72 ℃, performing agarose gel electrophoresis on the product, and taking a picture by using a gel imaging system to record the result, and setting a negative and positive control.
2.5 immunofluorescence assay
And taking cell cultures inoculated with the virus and not inoculated with the virus for 60 hours, discarding culture supernatant, performing tests according to the instructions of the porcine parvovirus indirect immunoassay kit, reacting the cell cultures with mouse anti-PPV serum for 1 hour at 37 ℃, performing immunofluorescence staining, observing by microscopic examination, and taking pictures for recording.
3 results
3.1 measurement of TCID50 content
Half of the detail of the isolated strains by the Reed-Muench methodThe amount of cell infection was determined and the results for each dilution of viral CPE are shown in Table 1 and calculated to give TCID50=10-5.375/0.1ml
TABLE 1 determination of viral titer
3.2 results of the microneutralization test
The result shows that the PPV standard positive serum can obviously inhibit the CPE of the cells and can specifically neutralize the separated virus; the results show that the separated virus is porcine parvovirus, wherein CPE appears in the swine fever positive serum control hole and the positive control hole, and no CPE appears in the negative cell control hole.
3.3 hemagglutination test results
The separated parvovirus cultured by CEF cells can agglutinate 0.5% guinea pig red blood cells, the virus solution is diluted in a multiple ratio, a hemagglutination test is carried out according to a conventional micro-method, and the hemagglutination titer is detected to be 1: 256,
TABLE 2 hemagglutination test results
Note: "+ ++" indicates a strong positive; "+ + + +" indicates positive; "+ -" indicates a weak positive; "-" indicates negative
3.4 PCR identification results
And (3) taking the separated porcine parvovirus DNA as a template, carrying out agarose gel electrophoresis after PCR amplification, observing under ultraviolet light, and taking a picture by using a gel imaging system. As can be seen from FIG. 1, the amplification results of the isolated viruses agreed with the expected results, and are all 455 bp.
3.5 immunofluorescence assay
The indirect immunofluorescence test is carried out on the cell culture inoculated with the virus and the control cell culture not inoculated with the virus by using the immune serum of the mouse anti-PPV, and the result shows that most cells of the cell culture inoculated with the virus have a green flashing fluorescence picture 2 on the cytoplasm and the cell membrane; the green fluorescence was not observed in normal cells as shown in FIG. 3.
4 conclusion
In conclusion, the separation method of the porcine parvovirus provided by the invention has the advantages of high degree of mechanization, simplicity, convenience and rapidness, greatly shortens the virus identification time, can obtain the virus with high virus content and high purification level, and finds a new susceptible cell for the culture of the porcine parvovirus.
Claims (4)
1. A porcine parvovirus separation method is characterized by comprising the following steps:
1) collecting SPF chick embryo with abundant blood vessel and vigorous activity of 9-10 days, rinsing embryo in PBS solution containing berberine at pH of 7.0-7.4, removing limbs, head and viscera of embryo, and cutting the rest embryo into 1mm3Rinsing the small blocks with PBS solution, respectively adding PBS solution and 2.5% pancreatin solution according to the volume ratio of 80:1-120:1, fully mixing, standing for 3-5min, adding 2-5% fetal calf serum to stop digestion, centrifuging at 1200r/min for 8-10min at 800-2Culturing in an incubator;
2) aseptically taking dead fetus bred by sow and parenchymal organs such as heart, liver, spleen, lung and kidney of mummy fetus, mincing in a mincing machine, adding D-Hanks liquid with the mass of 1-3 times of the total mass of minced meat into minced meat, fully grinding by a colloid mill, uniformly mixing, placing the obtained mixed solution in a high-pressure homogenizer, controlling the temperature below 25 ℃ in the homogenization treatment process to obtain homogenate treatment liquid, adding the D-Hanks liquid into the homogenate treatment liquid according to the ratio of 1:1-1:3, uniformly mixing, standing for 20-30min, performing split charging centrifugation, centrifuging at 3000 frequency of 5000r/min, centrifuging for 8-15min, taking supernatant for later use, performing microfiltration treatment on the obtained supernatant by a hollow fiber membrane microfiltration system with the pore diameter of 150KD-200KD, collecting microfiltrate, adding the D-Hanks liquid according to the ratio of 1:8-1:10 for dilution, filtering the diluted micro-filtrate by a 0.22um microporous filter membrane, and collecting the filtrate, namely the porcine parvovirus stock solution;
3) discarding cell culture solution from primary CEF cells cultured for 24h, adding porcine parvovirus stock solution and cell culture solution at a volume ratio of 1:8-1:10, placing the cell bottle at 37 deg.C and 5% CO2Incubating for 1h in an incubator, discarding virus solution, adding virus maintaining solution containing 2% fetal calf serum, culturing for 90-96h, observing cytopathic effect every day, collecting cell sap with obvious pathological changes, and storing at-20 deg.C.
2. The method for isolating porcine parvovirus as set forth in claim 1, wherein the pH of the berberine-containing PBS solution of step 1) is 7.0 to 7.4 and each 1000ml thereof is composed of the following components: 6-10 g of sodium chloride,
0.05-0.5 g of potassium chloride, 1-1.2 g of disodium hydrogen phosphate, 0.05-0.5 g of monopotassium phosphate, 0.05-0.2 g of calcium chloride,
0.05-0.2 g of magnesium chloride containing 6 crystal water and 1-3 mg of berberine; mixing the above components, dissolving in 1000ml double distilled water, filtering with 0.22um filter membrane, and storing at 4 deg.C.
3. The method for isolating porcine parvovirus as set forth in claim 1, wherein the pH of the berberine-containing PBS solution of step 1) is 7.0 to 7.4 and each 1000ml thereof is composed of the following components: 6-10 g of sodium chloride, 0.05-0.5 g of potassium chloride, 1-1.2 g of disodium hydrogen phosphate, 0.05-0.5 g of monopotassium phosphate, 0.05-0.2 g of calcium chloride, 0.05-0.2 g of magnesium chloride containing 6 crystal water and 1-3 mg of berberine; mixing the above components, dissolving in 1000ml double distilled water, filtering with 0.22um filter membrane, and storing at 4 deg.C.
4. The method for isolating porcine parvovirus as set forth in claim 1, wherein the D-Hanks solution in step 1) comprises the following components per 1000 ml: 8-10 g of sodium chloride, 0.4-0.6g of potassium chloride, 0.04-0.08g of disodium hydrogen phosphate containing 1 crystal water, 0.04-0.06g of monopotassium phosphate, 0.3-0.5 g of sodium bicarbonate and 0.01-0.02g of phenol red; mixing the above components, dissolving in 1000ml double distilled water, filtering with 0.22um filter membrane, and storing at 4 deg.C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710640851.6A CN107236714B (en) | 2017-07-31 | 2017-07-31 | Method for separating porcine parvovirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710640851.6A CN107236714B (en) | 2017-07-31 | 2017-07-31 | Method for separating porcine parvovirus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107236714A CN107236714A (en) | 2017-10-10 |
| CN107236714B true CN107236714B (en) | 2020-11-17 |
Family
ID=59988300
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710640851.6A Active CN107236714B (en) | 2017-07-31 | 2017-07-31 | Method for separating porcine parvovirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107236714B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101759773A (en) * | 2008-12-23 | 2010-06-30 | 天津瑞普生物技术股份有限公司 | Porcine parvnvirus resisting transfer factor and method for preparing same |
-
2017
- 2017-07-31 CN CN201710640851.6A patent/CN107236714B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN107236714A (en) | 2017-10-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111454878B (en) | Construction method and application of organoid virus infection model | |
| Ali et al. | Detection and expression of hepatitis B virus X gene in one and two‐cell embryos from golden hamster oocytes in vitro fertilized with human spermatozoa carrying HBV DNA | |
| Ariel et al. | Propagation and isolation of ranaviruses in cell culture | |
| CN107184969A (en) | A kind of A types Sai Nika paddy viral inactivation vaccines and its preparation method and application | |
| Bergmann et al. | Goldfish (Carassius auratus auratus) is a susceptible species for koi herpesvirus (KHV) but not for KHV disease (KHVD) | |
| CN112410290B (en) | Lateolabrax japonicus myocardial fibroblast line and application thereof | |
| CN106540249A (en) | A kind of bird flu (H5N1) or the antigen concentrating and purifying process of Porcine reproductive and respiratory syndrome (PRRS) viral vaccine | |
| CN111000993A (en) | Bivalent inactivated vaccine for duck viral hepatitis and duck reovirus disease and preparation method thereof | |
| JPH09176043A (en) | Vaccine and diagnostic agent for iridovirus infectious disease for fish and production of the same and the like | |
| CN103205511A (en) | Primer pair for detecting pigeon torque teno viruses and application of primer pair | |
| TW201704467A (en) | Methods for purification of a virus produced in vitro and clearance assay for the virus | |
| CN107236714B (en) | Method for separating porcine parvovirus | |
| CN110036976B (en) | Method for blocking vertical transmission of avian leukosis virus and application thereof | |
| CN107267467B (en) | Method for separating porcine reproductive and respiratory syndrome virus | |
| CN112341539A (en) | Yolk antibody for preventing and treating novel goose astrovirus with cross-species transmission capability and preparation method thereof | |
| CN104293736B (en) | A kind of telomerase immortalized bovine thyroid cell line and application thereof | |
| CN101220072A (en) | Method for extracting virus genome RNA from animal tissue | |
| RU2708335C1 (en) | Strain "privolzhsky" of a virus of nodular dermatitis in cattle dermatitis nodularis bovum, a genus capripoxvirus for manufacturing biopreparations for diagnostics and specific prevention of infectious dermatitis of bovine animals | |
| CN108707589B (en) | Bovine viral diarrhea virus SMU-Z6/1a/SC/2016 isolate and application thereof | |
| CN107400719B (en) | Tussah microsporidian detection primers and application thereof | |
| CN110452854A (en) | A method of separation mycoplasma ovine pneumoniae | |
| CN111044494B (en) | Rapid detection method for swine fever | |
| CN102703392A (en) | Preparation method of transgenically cloned pig integrating O-type foot and mouth disease virus shRNA (Short Hairpin Ribonucleic Acid) | |
| CN108060139B (en) | Isolation culture method of porcine epidemic diarrhea virus | |
| CN116098973B (en) | Traditional Chinese medicine composition and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |