CN107233567B

CN107233567B - RSV-PCV vaccine and preparation method thereof

Info

Publication number: CN107233567B
Application number: CN201710599996.6A
Authority: CN
Inventors: 吴克; 艾智武; 闫利明; 陈煜�
Original assignee: Bravovax Co ltd
Current assignee: Bravovax Co ltd; SHANGHAI BOWO BIOTECHNOLOGY CO Ltd
Priority date: 2017-03-30
Filing date: 2017-07-21
Publication date: 2020-09-08
Anticipated expiration: 2037-07-21
Also published as: CN107961372B; CN108653726B; CN108653726A; CN107961372A; CN107233567A

Abstract

The invention discloses an RSV-PCV vaccine and a preparation method thereof, comprising the following steps: an RSV (respiratory syncytial virus) immune intermediate, wherein the antigen of the RSV immune intermediate is RSV membrane surface fusion protein F and/or attachment protein G which can cause the immune response of the body, and the nucleic acid sequence of the expression protein antigen is recombined on a nucleic acid vector, and the nucleic acid sequence of the recombination protein takes the attenuated intracellular bacteria as a bacterial vector; the PCV (pneumococcus) immune intermediate comprises a pneumococcal polysaccharide antigen and a protein carrier, wherein the protein carrier is a recombinant protein carrier and is obtained by recombining escherichia coli heat-labile enterotoxin B subunit (LTB) protein and vibrio cholerae enterotoxin B subunit protein (CTB), an LTB nucleic acid sequence and a CTB nucleic acid sequence are bridged through a primer sequence, and the coded carrier protein sequence is shown as a sequence table SEQ ID NO: 8 is shown in the specification; the immune intermediates of the components are prepared respectively and mixed for use.

Description

RSV-PCV vaccine and preparation method thereof

Technical Field

The invention relates to an RSV-PCV vaccine and a preparation method thereof, belonging to the technical field of biology.

Background

Respiratory syncytial virus and epidemiology thereof

Respiratory infectious diseases are still one of the leading causes of death in the world to date, and Influenza Virus (FLU) and Respiratory Syncytial Virus (RSV) are important Respiratory pathogens. At present, different types of safe and effective vaccines for influenza exist, and guarantee is provided for prevention and control of influenza. Due to the autoimmune property, the RSV is rarely used in clinical vaccines, and provides a challenge for the prevention and control of the RSV. Up to now only the trivalent attenuated live influenza vaccine developed and produced by MedImmune company in the United states

Approved by FDA. RSV is the most important etiological agent of lower respiratory tract infections in infants and young children, and is also a significant cause of hospitalization and pneumonia deaths in the elderly and immunodeficient adults. Statistically, infants within 6 months are hospitalized with RSV infection to 70%, and children within 2 years of age are even up to 99%. Due to the wide pathogenic range of RSV,the disease condition is high, and serious complications and the like can be caused, thereby causing serious threats to human health and life safety. The world health organization has set the RSV vaccine as one of the vaccines that are preferentially developed.

RSV is a paramyxoviridae pneumovirus, is a non-segmented single-stranded RNA virus, and contains A, B serotypes. The total length of RSV genome is about 15Kb, and it encodes 10 major proteins, and they are respectively composed of three transmembrane proteins (G, F and SH), two matrix proteins (M and M2), three nucleocapsid proteins (N, P and L) and two non-structural proteins (NS1 and NS2), in which Fusion protein F and attachment protein G are the most important viral proteins for RSV to stimulate the organism to produce protective antibody. The G protein is highly variable and is not essential for infection and cell fusion; is highly conserved, mediates fusion of the viral envelope and host cell membrane, allows successful viral invasion of the host cell and may also cause fusion between adjacent cytoplasmic membranes to promote formation of syncytia in vitro. Systemic neutralizing antibodies against RSV F and G glycoproteins are effective in preventing RSV reinfection and thus RSV F and G proteins have been recognized as protective antigens and virulence causative molecules.

In the case of RSV, in the 60's of the 20 Th century, the formalin inactivated vaccine (FI-RSV) developed by Fulgini VA et al resulted in death of 2 children and 80% hospitalization due to induction of Th2 type immune overstimulation, culminating in failure. Research on RSV vaccines is currently focused mainly on vectored vaccines, attenuated live vaccines, subunit vaccines, DNA vaccines, VLP vaccines, and a variety of vaccine types are being developed, but no licensed RSV vaccine is available to date. Research on RSV vaccine is always the focus of international social attention, and it is seen from the existing RSV vaccine developed, the bottleneck problems that injection immunization cannot generate effective mucosal and cellular immune response and has limited immune protection effect, potential safety exists in DNA vaccine, potential imbalance between Th1 and Th2 exists in full-length F, G protein vaccine and the like are urgently solved. The main obstacles impeding RSV vaccine development are the following: one is that most animal models, including chimpanzees and the like, are semi-permissive infection/replication models and thus it is difficult to fully reproduce the pathogenicity of RSV; secondly, the immune system of the newborn as the main target population of the vaccine is immature, and the maternal antibody existing in the body can mediate immune interference; third, RSV has two different antigen subtypes, and the natural infection is difficult to generate effective immune protection effect; fourthly, the formalin inactivated vaccine (FI-RSV) can not prevent the infection of infants, and the vaccinated children are aggravated in disease (namely disease enhancement effect) and even die in the subsequent natural infection.

Recent studies have shown that RSV live vector vaccines constructed on a vector basis are RSV vaccine candidates currently expected for use in newborns. The types of live vector vaccines include mainly viral vector vaccines and bacterial vector vaccines. The RSV viral vector vaccine mainly comprises: vaccinia virus (vaccinia virus) vector vaccines, adenovirus (Ad) vector and paramyxovirus (paramyxovirus) vector vaccines, etc., and recently, adenovirus vector vaccines and paramyxovirus vector vaccines have been receiving attention.

Pneumococcus and epidemiology thereof

Streptococcus pneumoniae (Streptococcus pneumoniae) is abbreviated as Pneumococcus (Pneumococcus) and is a main pathogenic bacterium of bacterial lobar pneumonia, meningitis, otitis media, pneumonia and bronchitis, and the Pneumococcus is inhabited in the nasopharyngeal cavity of normal people. Pneumococcal disease has been a serious public health problem worldwide with high morbidity and mortality worldwide, especially for children under 2 years of age and the elderly. Pneumococcal capsular saccharide vaccines and capsular saccharide protein conjugate vaccines currently on the market, both of which are based on pneumococcal capsular saccharides, cover the most common serotypes that cause pneumococcal disease. However, pneumococcal capsular saccharide is Thymus independent antigen (TI-Ag), antibody reaction mainly depends on a linear epitope composed of repeating units of the capsular saccharide, the capsular saccharide is directly crosslinked with an IgM receptor on the surface of a B lymphocyte under the condition of no assistance of T lymphocytes, induced antibodies mainly comprise IgM and IgG2, the induced antibodies lack good complement activation capacity, the antibody level cannot be maintained for a long time, and the induced immune memory cannot generate immune protection in children under the age of 2 years. The complex structure of capsular saccharides results in a difference in immunogenicity for each serotype, failing to generate an effective immune response. Pneumococcal conjugate vaccines include many serogroups, and each type has a different specific structure for binding, resulting in a different binding method for each type. The modification of capsular saccharide and the combination with carrier protein are carried out on the premise of ensuring that specific groups of capsular saccharide are not lost and antigenicity and immunogenicity are not affected, and the sizes of capsular saccharide and conjugate molecules are controlled to a certain extent in order to avoid the requirements of excessive cross-linking of sugar chains and sterilization and filtration of conjugates. The 7-valent vaccine was approved for use in the united states 2 months in 2000. Since there are many types of pneumococcus, a binding protein component is required in the production process of the conjugate vaccine, and the protein component may cause a local reaction, it is difficult to produce a conjugate vaccine containing 12 or more types of pneumococcus. The live antibody concentration of the conjugate vaccine after the initial immunization can only be maintained for a few months, and then the live antibody concentration can be reduced to a pre-immunization level; and various chemical reagents are required to be added to participate in the reaction in the whole process of the conjugate vaccine, and the low serotype coverage rate of the capsular glycoprotein conjugate vaccine and the increase of non-vaccine serotype pneumococcal infectious diseases enable more researchers to start focusing on the development of pneumococcal vaccines in other directions.

The pneumococcal combined vaccine using the recombinant carrier protein has become the mainstream of the research and development of the pneumonia vaccine in the last decade, and the vaccine with species-specific antigen as the basis is widely regarded by research and development personnel, thereby attracting a great deal of attention. However, due to the limitations of the structure and physicochemical properties of the protein itself, many pneumococcal proteins cannot be directly used for human immunity, and a large amount of manpower and material resources are required for research and clinical verification. The protein vaccine utilizes a biological engineering technology to synthesize a protein antigen, and the protein antigen is selected from highly conserved pneumococcal specific proteins, so that the immune difference between different serotypes is eliminated, and the obstacle that the conventional pneumococcal vaccine cannot be used together with the vaccine of the same type of the general carrier protein at the same time is eliminated because other types of general protein carriers are not needed; the protein antigen can also be used as a carrier protein to be spontaneously combined with pneumococcal capsular saccharide, so that the immune effect is better, and the combined realization of specific immunity and wide immunity is realized.

Third, overview of live bacterial vector vaccine

The live bacteria carrier vaccine is a new vaccine for preventing one or several diseases by inserting heterogenous antigen gene into chromosome or plasmid carrier of live bacteria to excite immune system to present heterogenous antigen and produce immune protection. Live attenuated bacterial vaccine vectors have: the production is relatively cheap; the operation method is simple and easy; can carry larger gene segments, and is easy to construct multivalent vaccines; and the activity of immunological adjuvant, etc., and is widely used for vaccine research. The salmonella is a research hotspot in the aspect of the current bacterial vector, the salmonella is an invasive intracellular bacterium, can be used as a vaccine vector to carry prokaryotic expression plasmids and eukaryotic expression plasmids, and the recombinant attenuated salmonella vaccine has the advantages of simple preparation, convenient immunization, stronger immunogenicity, capability of inducing a lasting immune response and particularly stronger mucosal immune response. However, salmonella is a very important zoonosis, mainly causing enteritis, septicemia and the like of human and animals. Therefore, the salmonella is used as a bacterial vector and needs to be attenuated, and the attenuated salmonella causes certain specific genes of the salmonella to undergo irreversible mutation by methods such as physical, chemical or genetic engineering and the like, so that the toxicity of the salmonella is greatly reduced, and the salmonella can grow and propagate in vivo after infecting host cells. Studies have shown that the invasion mechanism of attenuated salmonella in the gut mainly includes both epithelial and non-epithelial cell pathways. After attenuated salmonella carrying plasmid DNA is phagocytized by cells such as macrophage and dendritic cell, the phagocyte is activated and activated to begin to differentiate and migrate to tissues such as spleen and lymph node, during which the attenuated salmonella dies, the eukaryotic plasmid carried by the attenuated salmonella is released by cracking, enters cytoplasm of the phagocyte through specific transport and leakage, and then enters nucleus to be transcribed and express exogenous antigen in the cytoplasm.

Because salmonella has great advantages as a vector presentation vaccine and is easy to ensure immune balance in vivo, and an RSV virus vaccine has the defects, the research of researchers in the field on the RSV vaccine is a new direction by making good for the deficiency and focusing attention on the combination of a novel vector and the RSV virus.

The pneumococcus has a large antigen structure and poor stability due to a plurality of serotypes, and is difficult to be used together with other vaccines, but the pneumococcus has a plurality of inducing causes of lower respiratory tract infection diseases such as pneumonia, and is difficult to realize all-round immunoprophylaxis through a single vaccine. Therefore, the research of a combined vaccine which has enough good autoimmunity and can stably exist becomes urgent in the field of vaccine research and development.

Disclosure of Invention

The applicant aims to expand another application of the recombinant protein carrier based on prior applications CN2017102214206, CN2017102598140 and CN2017105857749 so as to solve the technical blank that no respiratory syncytial virus-pneumococcal combined vaccine exists in the existing product.

The invention mainly aims to provide an RSV-PCV vaccine, which is characterized in that the combined vaccine comprises:

an RSV (respiratory syncytial virus) immune intermediate, wherein the antigen of the RSV immune intermediate is RSV membrane surface fusion protein F and/or attachment protein G which can cause the immune response of the body, and the nucleic acid sequence of the expression protein antigen is recombined on a nucleic acid vector, and the nucleic acid sequence of the recombination protein takes an attenuated intracellular bacterium as a bacterial vector;

PCV (pneumococcus) immune intermediate, which comprises pneumococcus polysaccharide antigen and protein carrier, wherein the protein carrier is recombinant protein carrier, and is obtained by recombining escherichia coli heat-labile enterotoxin B subunit (LTB) protein and vibrio cholerae enterotoxin B subunit protein (CTB), the LTB nucleic acid sequence and the CTB nucleic acid sequence are bridged through primer sequence, and the coded carrier protein sequence is shown as sequence table SEQ ID NO: 8 is shown in the specification;

the immune intermediates of the components are prepared respectively and mixed for use.

The RSV specific protein is a protein which can specifically cause RSV immune response, preferably F protein, and the gene sequence of the expression F protein sequence is shown in a sequence table SEQ ID NO: 1, designing a specific primer according to a nucleic acid sequence of an expression protein, wherein the primer sequence is shown as a sequence table SEQ ID NO: 2 and SEQ ID NO: 3, the sequence to be amplified after the primer is combined is shown as the sequence table SEQID NO: 4, respectively.

The recombinant RSV protein antigen is pcDNA3.1-F.

The attenuated intracellular bacterial vector is selected from the group consisting of: l3261, SL7207 or ty21 a. Preferably, the RSV antigen transfected into the bacterial vector is SL 7207/pcDNA3.1-F.

The gene sequence of the recombinant carrier protein coded in the PCV immune intermediate is shown in a sequence table SEQ ID NO: 7, shown as SEQ ID NO: 7, the C end of the LTB protein is connected with the N end of the CTB protein, the LTB gene is connected with the CTB gene through a primer, and the R end primer sequence of the LTB gene is shown as a sequence table SEQ ID NO: 12, the sequence of the F-end primer of the CTB gene is shown as the sequence table SEQ ID NO: 13 is shown in the figure; the sequence of the primer at the F end of the LTB gene is shown as a sequence table SEQ ID NO: 11, the R-end primer sequence of the CTB gene is shown as a sequence table SEQ ID NO: as shown at 14.

The pneumococcal polysaccharide antigen is polysaccharide on the capsule of the pneumococcus of separated and purified serotypes, wherein the serotypes of the pneumococcus comprise 4, 6B, 9V, 14, 18, 19F and 23F.

Preferably, the mass ratio of each serotype of pneumococcal capsular saccharide to each serotype of pneumococcal protein is 1.5-4.5: 1.

The RSV immune intermediate and the PCV immune intermediate are both freeze-dried powder and are suspended for clinical use.

The preparation method of the RSV immune intermediate comprises the following steps:

a. culturing RSV, respectively extracting the somatic RNAs of the RSV and the influenza virus by adopting a virus RNA/DNA rapid purification kit, carrying out Reverse Transcription (RT) on the extracted somatic RNAs, and carrying out F protein gene sequence amplification by taking a reverse transcribed cDNA product as a template;

b. designing a specific primer according to an RSV (respiratory syncytial virus) protein expression sequence, wherein the specific primer sequence is shown in a sequence table SEQ ID NO: 2 and SEQ ID NO: 3, connecting the primer with the sequence to be amplified and an expression vector pcDNA3.1-F;

c. the connected expression vector is transfected into attenuated salmonella SL7207 to construct antigen SL 7207/pcDNA3.1-F.

Preferably, step b is specifically:

designing a specific primer according to an RSV virus protein expression sequence, wherein the sequence of an upstream specific primer is shown in a sequence table SEQID NO: 2, the restriction endonuclease site is Hind III, and the downstream specific primer sequence is shown in a sequence table SEQ ID NO: 3, the restriction endonuclease site is Xho I primer connected with the sequence to be amplified and the expression vector pcDNA3.1-F.

The preparation method of the PCV immune intermediate comprises the following steps:

a. designing two pairs of primers according to CDS region nucleic acid sequences of LTB and CTB to construct pET28a-LTB-CTB plasmid, carrying out double enzyme digestion through BamH I and Xho I after PCR amplification, and recovering LTB-CTB fragment and expression vector pET28a through gel;

b. connecting and transforming Escherichia coli DH5 alpha strain, screening positive clone, performing monoclonal amplification, and identifying after IPTG induction;

c. taking prepared pneumococcal capsular polysaccharide and recombinant carrier protein, and mixing the recombinant LTB-CTB carrier protein and polysaccharide in a ratio of 1: 2, mixing and reacting.

The vaccine of the invention can be processed into various preparations for clinical use by using the known technology, wherein the preparation is selected from one of liquid dosage forms, freeze-dried dosage forms, capsule dosage forms, tablets and pills, the preferred dosage forms are liquid dosage forms, freeze-dried dosage forms and capsule dosage forms, and the liquid dosage forms and the freeze-dried dosage forms are more preferred.

The vaccination routes of the invention include intramuscular injection, subcutaneous injection, intradermal injection and oral administration, and also include nasal cavity, oral cavity, anus and vaginal mucosa routes.

In summary, the main advantages of the RSV-PCV vaccine provided by the present invention are:

1. the RSV live vector vaccine constructed based on the vector can be synthesized in a human cell from the beginning, the formed protein conformation is completely the same as the expression of RSV after natural infection, attenuated salmonella can carry prokaryotic expression plasmid and eukaryotic expression plasmid, the loss or change of epitope can not be caused, and the formed immunity is more beneficial to resisting subsequent natural infection;

2. the problems of low in vitro propagation titer and poor stability of RSV are avoided, the production process of the recombinant attenuated salmonella vaccine is simple, and the vaccine is easy to store and transport, so that the cost of the vaccine is relatively low, and the large-scale preparation and transportation of the vaccine are facilitated;

3. the recombinant attenuated bacteria vaccine can be immunized by various ways such as oral immunization, intranasal immunization, rectal immunization and the like, the vaccine can be directly presented to APC cells, the delivery efficiency is high, the cellular immunity and the humoral immunity can be effectively stimulated, the disease enhancement effect cannot be generated by the mucosal route immunization, and the interference of maternally transmitted antibodies can be broken through;

4. the vector adopted by the RSV live vector vaccine is an attenuated intracellular bacterial vector, so that the vaccine has the advantages of high immune efficacy, low cost, good safety of an inactivated vaccine and the like of a conventional live vaccine, attenuated salmonella has the function of an immune adjuvant and has persistence of immunity, and foreign proteins expressed by the attenuated salmonella serving as the vector continuously stimulate a host without repeatedly strengthening immunity;

5. the invention adopts the recombinant carrier protein to connect various capsular saccharides of pneumococcus, the carrier protein also has the adjuvant effect of activating mucosal immunity, and after being combined with pneumococcus antigen, the carrier protein not only can cause high-titer serum antibody, but also can rapidly cause mucosal serum antibody for a long time;

6. the pneumococcal antibody can be selected from pneumococcal protein and pneumococcal capsular polysaccharide, and when the vaccine has a higher valence state, a recombinant protein carrier and pneumococcal homologous protein can be used in combination, so that the immune response caused by the conventional pneumococcal serotype can be enhanced, and the mucosal immunity of the lung can be caused;

7. the pneumococcal vaccine using the recombinant carrier protein has certain structural elasticity and combination of multiple polysaccharide proteins, the carrier protein promotes an organism to generate a specific antigen, but does not cause diseases per se, does not generate cross immune influence, is easy to combine with other vaccines, and has small side effect and good safety;

8. the pneumococcal vaccine and the RSV vaccine are combined to be used, so that immune response can be caused to a great extent at the same time, and the incidence rate of lower respiratory tract infection of an vaccinee is greatly reduced.

Drawings

FIG. 1 is an electrophoretogram of PCR amplification products of F protein provided by the embodiments of the present invention.

FIG. 2 is an insertion site diagram of the positive plasmid construction provided in the examples of the present invention.

FIG. 3 is an electrophoresis diagram of the PCR amplification product of F protein infected in mice provided by the embodiment of the present invention.

FIG. 4 is a schematic diagram of the plasmid for constructing pET28a-LTB-CTB plasmid provided by the present invention.

FIG. 5 is a schematic diagram showing the result of induction purification of the recombinant LTB-CTB carrier protein provided by the present invention.

Detailed Description

The present invention will be described more fully hereinafter with reference to the following examples.

Plasmid construction, expression and purification of Respiratory Syncytial Virus (RSV)

In this example, CDS region gene of RSV F protein (GeneID: 1489825) was selected for amplification, and the CDS region gene of F protein is shown in SEQ ID NO: 1, designing an upstream primer and a downstream primer according to the specificity of the F gene, wherein the upstream primer has a sequence shown in a sequence table SEQ ID NO: 2, the downstream primer is shown as a sequence table SEQ ID NO: 3, the fragment to be amplified after the primer is combined is shown as a sequence table SEQ ID NO: 4, respectively.

1. Culture of respiratory syncytial virus

1.1 culture of RSV Using Vero cells

Taking the recovered Vero cells subjected to subculture, washing, inoculating diluted viruses, adsorbing at 37 ℃ for 1h, and shaking the inoculated cells once every 15min to ensure that the viruses fully infect the cells; pouring out virus diluent of the virus receiving cell bottle and culture solution of the virus receiving cell bottle, respectively adding 6-8 mL of DMEM maintenance solution containing 2% serum and CO at 37 DEG C₂Incubated in an incubator, and cytopathic effects were observed daily from the next day according to controls. Collecting toxic materials when 75% of cells have pathological changes (about 7 days), repeatedly freezing and thawing the culture solution at-80 deg.C for 3 times, centrifuging at 10000r/min for 10min, collecting supernatant under aseptic condition, packaging, and storing in-80 deg.C refrigerator for a long time.

1.2 Total extraction of RSV viral RNA

And (3) performing RNA removal treatment on a centrifuge tube, a gun head and a PCR tube required for RNA extraction by using DEPC (diethyl cokeoate), and extracting RSV DNA by using an RNA/DNA kit. The extraction kit adopted in the embodiment is a TaKaRa small-amount virus RNA/DNA extraction kit, and the operation is carried out according to the instruction. The extracted RNA is used immediately or stored in a refrigerator at-80 ℃ for later use.

1.3RT-PCR

The transcription system adopts a 25 mu L system, 12 mu L of RNA and a universal primer Olingo (d) T181 mu L are added and mixed gently, and the mixture is incubated for 5min at 70 ℃ and ice-cooled for 2 min. mu.L of AMV, 5 mu.L of AMV Buffer, 5 mu.L of dNTP and 1 mu.L of RNaseInhibitor are added into the centrifuge tube, mixed evenly and incubated for 60min at 42 ℃. The transcriptase was inactivated at 70 ℃ for 10 min. The resulting product cDNA is used immediately or stored at-20 ℃ for a long period of time.

Designing a specific primer according to the CDS fragment of the RSV F protein, wherein a primer sequence sequentially comprises a protective base, a restriction enzyme site and a connecting primer from a 5 'end to a 3' end, an upstream restriction enzyme site is a Hind III restriction enzyme site, a downstream restriction enzyme site is an Xho I restriction enzyme site, and the primer sequence specifically comprises the following steps:

F:：5'-ccc-AAGCTT-CAGAAAACCGTGACCTATCAAG-3'

R：5'-cc-CTCGAG-ACATGAAGTTTTGCCTCACTAGTA-3'

the PCR system adopts a 25 mul system, and is added with 2.5 mul of 10 XrTaq buffer, 2 mul of dNTP, 0.25 mul of rTaq, 1 mul of upstream primer, 1 mul of downstream primer, 17.25 mul of water and 1 mul of cDNA of RT-PCR product; reaction conditions for amplification of full-length fragment of F: 5min at 94 ℃, 50s at 55 ℃, 1.5min at 72 ℃, 25 cycles, 10min at 72 ℃ and 4 ℃ after finishing; reaction conditions for amplification of full-length G fragment: 5min at 94 ℃, 45s at 58 ℃, 1min at 72 ℃ for extension, 25 cycles, 7min at 72 ℃ for extension, and finishing at 4 ℃.

1.4 product inspection and purification

And (3) carrying out electrophoresis detection on the PCR product by adopting 1% agarose gel electrophoresis, and confirming the PCR amplified fragment with the F gene fragment size of 524bp after detection. The electrophoresis pattern of the amplified product is shown in FIG. 1, in which the band at position 1F gene, the band M1 are standard DNAmarker, the band is clear, and the expected theoretical value is met.

And recovering and purifying the PCR product by adopting a DNA gel recovery kit. Storing at-20 deg.C.

The fragments to be amplified after primer ligation are specifically as follows:

CTTAGTTATTCAAAAACTACATCTTAGCAGAAAACCGTGACCTATCAAGCAAGAACGAAATTAAACCTGGGGCAAATAACCATGGAGCTGCTGATCCACAGGTTAAGTGCAATCTTCCTAACTCTTGCTATTAATGCATTGTACCTCACCTCAAGTCAGAACATAACTGAGGAGTTTTACCAATCGACATGTAGTGCAGTTAGCAGAGGTTATTTTAGTGCTTTAAGAACAGGTTGGTATACCAGTGTCATAACAATAGAATTAAGTAATATAAAAGAAACCAAATGCAATGGAACTGACACTAAAGTAAAACTTATAAAACAAGAATTAGATAAGTATAAGAATGCAGTGACAGAATTACAGCTACTTATGCAAAACACACCAGCTGCCAACAACCGGGCCAGAAGAGAAGCACCACAGTATATGAACTATACAATCAATACCACTAAAAACCTAAATGTATCAATAAGCAAGAAGAGGAAACGAAGATTTCTGGGCTTCTTGTTAGGTGTAGGATCTGCAATAGCAAGTGGTATAGCTGTATCCAAAGTTCTACACCTTGAAGGAGAAGTGAACAAGATCAAAAATGCTTTGTTATCTACAAACAAAGCTGTAGTCAGTCTATCAAATGGGGTCAGTGTTTTAACCAGCAAAGTGTTAGATCTCAAGAATTACATAAATAACCAATTATTACCCATAGTAAATCAACAGAGCTGTCGCATCTCCAACATTGAAACAGTTATAGAATTCCAGCAGAAGAACAGCAGATTGTTGGAAATCAACAGAGAATTCAGTGTCAATGCAGGTGTAACAACACCTTTAAGCACTTACATGTTAACAAACAGTGAGTTACTATCATTGATCAATGATATGCCTATAACAAATGATCAGAAAAAATTAATGTCAAGCAATGTTCAGATAGTAAGGCAACAAAGTTATTCTATCATGTCTATAATAAAGGAAGAAGTCCTTGCATATGTTGTACAGCTACCTATCTATGGTGTAATAGATACACCTTGCTGGAAATTACACACATCACCTCTATGCACCACCAACATCAAAGAAGGATCAAATATTTGTTTAACAAGGACTGATAGAGGATGGTATTGTGATAATGCAGGATCAGTATCCTTCTTTCCACAGGCTGACACTTGTAAAGTACAGTCCAATCGAGTATTTTGTGACACTATGAACAGTTTGACATTACCAAGTGAAGTCAGCCTTTGTAACACTGACATATTCAATTCCAAGTATGACTGCAAAATTATGACATCAAAAACAGACATAAGCAGCTCAGTAATTACTTCTCTTGGAGCTATAGTGTCATGCTATGGTAAAACTAAATGCACTGCATCCAACAAAAATCGTGGGATTATAAAGACATTTTCTAATGGTTGTGACTATGTGTCAAACAAAGGAGTAGATACTGTGTCAGTGGGCAACACTTTATACTATGTAAACAAGCTGGAAGGCAAGAACCTTTATGTAAAAGGGGAACCTATAATAAATTACTATGACCCTCTAGTGTTTCCTTCTGATGAGTTTGATGCATCAATATCTCAAGTCAATGAAAAAATCAATCAAAGTTTAGCTTTTATTCGTAGATCTGATGAATTACTACATAATGTAAATACTGGCAAATCTACTACAAATATTATGATAACTACAATTATTATAGTAATCATTGTAGTATTGTTATCATTAATAGCTATTGGTTTGCTGTTGTATTGCAAAGCCAAAAACACACCAGTTACACTAAGCAAAGACCAACTAAGTGGAATCAATAATATTGCATTCAGCAAATAGACAAAAAACCACCTGATCATGTTTCAACAACAGTCTGCTGATCACCAATCCCAAATCAACCCATAACAAACACTTCAACATCACAGTACAGGCTGAATCATTTCTTCACATCATGCTACCCACACAACTAAGCTAGATCCTTAACTCATAGTTACATAAAAACCTCAAGTATCACAATCAAACACTAAATCAACACATCATTCACAAAATTAACAGCTGGGGCAAATATGTCGCGAAGAAATCCTTGTAAATTTGAGATTAGAGGTCATTGCTTGAATGGTAGAAGATGTCACTACAGTCATAATTACTTTGAATGGCCTCCTCATGCCTTACTAGTGAGGCAAAACTTCATGTTAAACAAGATACTCAAGTCAATGGACAAAAGCATAGACACTTTGTCTGAAATAAGTGGAGCTGCTGAACTGGACAGAACAGAAGAATATGCTCTTGGTATAGTTGGAGTGCTAGAGAGTTACATAGGATCTATAAACAACATAACA

the underlined positions in the fragment are the promoter and terminator for the F protein.

According to the above-mentioned primer, adopting expression vector pcDNA3.1 to construct pcDNA3.1-F, and cloning F protein gene fragment into CMV promotor downstream of pcDNA3.1 to construct eukaryotic expression plasmid LapcDNA3.1-F. The partially ligated fragments that were successfully constructed are shown in FIG. 2.

Respectively amplifying the F protein gene sequence and pcdna3.1 plasmid, restriction enzyme digestion PCR product and pcdna3.1, connecting the double digestion products to complete plasmid construction.

The PCR product F fragment of the PCR plasmid was about 2150bp long, consistent with the expected PCR product. The positive plasmid sequence determination result is completely consistent with the original F gene sequence. The positions of the double-cleaved vector and the target fragment are also consistent with the expectation. The positive plasmid is successfully constructed.

Secondly, introducing the recombinant eukaryotic expression plasmid into attenuated salmonella

2.1 preparation of attenuated Salmonella competent cells

Carrying out streak culture on Salmonella typhimurium SL7207 on an LB plate; selecting a single colony, inoculating 3mL of LB liquid culture medium, and carrying out shaking culture at 37 ℃ overnight; each 5mL of LB liquid medium was inoculated with 100. mu.L of overnight culture, and cultured at 37 ℃ with shaking 225prm to OD_600nm0.6; the culture is iced for 30min, and centrifuged for 10min at 4000 rpm; decanting all nutrient solutions, resuspending bacteria in an equal volume of ice-cooled WB solution, 4000prm, centrifuging for 10min (WB 10% glycerol, 90% double distilled water, filtering); repeat the last step 2 times: most of the WB was decanted to a residual volume of 50. mu.l (50. mu.l of competent cells per 10mL of original culture preparation, i.e., 0.5%), and mixed to obtain a mixtureA competent cell.

2.2 electrotransformation

Adding 5 mul of plasmid pcDNA3.1-F, pcDNA3.1 and fluorescent plasmid pEGFP into every 40ul of competent cells, and mixing uniformly; pipette 40. mu.l into an ice-chilled electrode cup for electrotransformation. The parameters are set to 2.5Kv, 200 Ω, 25 μ F, t ≈ 4.5-5.0 ms. Another competent cell without plasmid was used as control: immediately adding 1mL of LB into the electrode cup after electric shock, uniformly mixing, and carrying out shaking culture at 37 ℃ for 1 h; 200. mu.l of the suspension was applied with Amp^RResistant LB plates, cultured overnight at 37 ℃.

Picking transformed colonies with Amp^RCultured in LB liquid Medium to OD_600nm1.0; after extracting the plasmid, the size of the plasmid is identified by electrophoresis, and the plasmid is proved to be the same as the known plasmid.

Third, immunological evaluation of recombinant salmonella carrier respiratory syncytial virus

3.1 preliminary experiments on Primary macrophages in the infected peritoneal

Taking primary macrophages in the abdominal cavity of a mouse, removing eyeballs, bleeding, cutting the neck, killing the mouse, and soaking the mouse in 75% ethanol; fixing the mouse, aseptically opening the skin of the abdomen of the mouse, and exposing the peritoneum; injecting 10mL of serum-free medium RPMI1640 in 37 ℃ water bath into the abdominal cavity of a mouse along the front edge of the pubis and one side of the abdominal midline without pulling out a needle head, and gently massaging the abdomen with fingers; ascites fluid was aseptically collected and macrophages were isolated.

The isolated macrophages were counted and seeded in 24-well cell plates, 5 × 10⁵～1×10⁶Each cell/well, adsorbing at 37 ℃ for 2h in a cell flask containing RPMI medium; washing the cells 2 times with incomplete antibiotic-free medium RPMI1640 to remove non-adsorbed cells; the cells were collected by centrifugation at 5000rpm and resuspended in 0.01mol/L PBS (pH7.4); counting the attenuated salmonella, adding the counted attenuated salmonella and the cell number into a 24-well cell plate according to different ratios of 1:1, 5:1, 10:1, 20:1, 50:1, 100:1, 500:1 and 1000:1, repeating the steps for 3 wells in each ratio, and incubating for 30min at 37 ℃; washing the cells with 0.01mol/L PBS (pH7.4) for 3 times, and culturing the cells in RPMI1640 culture medium containing 100mg/L gentamicin sulfate for 2h to kill extracellular bacteria; reintroducing the cell cultureAdding 10mg/L tetracycline, and incubating at 37 deg.C for 2 hr to block intracellular bacteria propagation; the cells were further cultured in RPMI1640 containing 10mg/L gentamicin sulfate (containing 10% FCS) for 48 to 96 hours, and the presence or absence of contamination was observed every 12 hours to determine the amount of infection.

And (3) the recombinant attenuated salmonella and macrophage act according to MOI (molar equivalent of average of identity) of 20, and the presence or absence of green fluorescence expression in the cells is observed by a fluorescence microscope 48-72 hours after infection. Approximately 34/th of the cells were seen to express green fluorescence at both 48h and 72h post-infection, whereas no fluorescence was observed in the control,

3.2 in vivo infection assay with recombinant attenuated Salmonella

In this example, mice were used for in vivo infection tests and administered orally.

Female mice of 6-8 weeks old are divided into 4 groups, a SL7207/pcDNA3.1-F group, a control SL7207/pcDNA3.l group, a FI-RSV vaccine as a vaccine positive control group, and a PBS group as a negative control. The vaccine is administered 30min before immunization with 7.5% NHaCO₃Gastric acid was neutralized by gavage at 100. mu.l/tube, and then the recombinant immunogenes (10) was orally administered⁸cfu/only, 200. mu.l).

Total RNA of intestinal mucosa was extracted at 0h, 24h, 48h and 72h after oral immunization, 2 each time. Shearing about 100mg of small intestine mucosa, adding 1.0mol of TRIzol reagent after shearing, homogenizing by using a tissue triturator, and incubating for 5min at 15-30 ℃; adding 200 mul of chloroform, covering a tube cover tightly, and shaking vigorously for 15 s; incubating at 15-30 ℃ for 2-3 mni; centrifuging at 12000g at 2-8 deg.C for 15 min; transferring the water phase to a new centrifuge tube, adding 0.5mL isopropanol, acting at 15i-30 deg.C for 10min, centrifuging at 2-8 deg.C 12000g for 10 min; discarding supernatant, adding 75% ethanol l.0mL, shaking, centrifuging at 2-8 deg.C 7500g for 5 min; the supernatant was discarded and the precipitate was dried (about 5min at room temperature); dissolved in 20. mu.l of DEPC water and stored at-20 ℃.

After extracting total RNA, carrying out reverse transcription cDNA synthesis and PCR amplification to amplify whether the target gene F is transcribed and expressed. Beta-actin is used as an internal reference during amplification.

Beta-actin specific primers: the sequence of P beta l is 5'-GTGGGCCGCTcTAGGCACCAA-3'; the sequence of P beta 2 is 5'-CTCTTTGATGTCACGCACGATTTC-3'; f protein gene: pre-denaturation at 94 ℃ for 3min, 35 cycles, extension at 72 ℃ for 10min, and placing the product in a refrigerator for testing.

Beta-actin: taking 2.0 μ l of the reverse transcription product, adding 48.0 μ l of PCR mixed solution, including 40pmol each of P β 1 and P β 2, pre-denaturing at 94 ℃ for 5min, 35 cycles, extending at 72 ℃ for 5min, and placing the product in a refrigerator for detection.

The PCR products were checked by 2% agarose gel electrophoresis, and the results are shown in FIG. 3. In the figure, a band 1 is an F protein gene, and a band 2 is a beta-actin gene. The test result shows that the position of the band is correct and clear, which indicates that the target gene F is correctly transcribed and expressed.

Expression and purification of recombinant LTB and CTB proteins

According to the nucleic acid sequences and amino acid sequences of LTB and CTB registered by GeneBank, the specific sequences are as follows:

the nucleic acid LTB nucleic acid sequence (375bp) is shown as a sequence table SEQ ID NO: 5, the amino acid sequence (124a.a, MW 14133.74) encoded by the nucleic acid sequence is as shown in SEQ ID NO: and 6.

The CTB nucleic acid sequence (375bp) is shown as a sequence table SEQ ID NO: 7, the CTB amino acid sequence (124 a.a.mw. 13896.46) encoded by this nucleic acid sequence is as set forth in SEQ ID NO: shown in fig. 8.

pET28a was selected as a vector, and primers were designed based on the full-length CDS sequences of LTB and CTB registered in GeneBank as follows:

LTB-Fwd is sequentially from 5 'end to 3': protecting base- -BamH I enzyme cutting site- -LTB protein N-terminal sequence. The primers (shown as SEQ ID NO: 11 in the sequence table) are as follows:

5’-CG--GGATCC--atgaataaagtaaaatgttatgttttatttacggcgtta-3’

LTB-Rev is sequentially from 5 'end to 3': protecting basic group-Eco 311 restriction enzyme cutting site-CTB protein N terminal sequence-LTB protein C terminal sequence. The primers (shown as SEQ ID NO: 12 in the sequence table) are as follows:

5’-CTAG--GGTCTC--cat--gtttttcatactgattgccgcaa-3

the CTB-Fwd comprises the following components from the 5 'end to the 3' end in sequence: protecting basic group-Eco 311 restriction enzyme cutting site-LTB protein C terminal sequence-CTB protein N terminal sequence. The primers (shown as SEQ ID NO: 13 in the sequence table) are as follows:

5’-CTAG--GGTCTC--AAC--atgattaaattaaaatttggtgttttttttacagtttta-3’

the CTB-Rev comprises the following components from 5 'end to 3' end: protecting base- -Xho I cleavage site- -CTB protein C terminal sequence. The primers (shown as SEQ ID NO: 14 in the sequence table) are as follows:

5’-CC--CTCGAG--ttaatttgccatactaattgcggcaa-3’

as shown in FIG. 4, pET28a-LTB-CTB plasmid was constructed. Because LTB and CTB have higher homology, the LTB fragment is inserted into the CTB fragment, connected by primers and bridged for PCR, and the full-length fragment of the recombinant LTB-CTB carrier protein can be obtained by amplification. The complete sequence of the constructed pET28a plasmid is shown in a sequence table SEQ ID NO: 9, the coded amino acid sequence is shown in a sequence table SEQ ID NO: shown at 10.

After the vector and the PCR product are subjected to double enzyme digestion by BamHI and XhoI, LTB and CTB fragments are recovered by gel. After the glue is recovered, DNA ligase is used for connecting overnight at 16 ℃, Escherichia coli DH5 alpha is connected and transformed, monoclonal amplification is carried out, after plasmids are extracted, a band of about 800bp identified by BamH I and Xho I double enzyme digestion is carried out, positive clone is screened under ampicillin resistance, sequencing is carried out after positive screening, and sequencing results are compared on NCBI websites, so that the results are completely correct.

The recombinant LTB-CTB carrier protein is induced for 30h at 20 ℃, the IPTG concentration is 0.3mmol/L, and the induction condition is optimal. After induction, the supernatant and the precipitate of the ultrasonic cleavage product were removed in a suitable amount to carry out SDS-PAGE, and the protein before induction was used as a control. After disruption, the expressed protein was found to exist in the form of inclusion bodies. After the inclusion body is washed, the inclusion body is dissolved by 8mol/L urea, renatured by renaturation liquid, and purified by a glutathione S-transferase (GST) affinity chromatographic column to obtain the recombinant fusion protein with the purity of about 93 percent. SDS-PAGE results showed that an additional band of about 30kD appeared in the lysed pellet of recombinant bacteria, similar to the expected results. Because the protein is mainly expressed in the form of inclusion bodies, long-time induction at a lower temperature is selected to ensure the protein expression quantity. The purification result of induced expression is shown in FIG. 5, and a band 1 is a protein Marker; 2 is total protein before induction; 3 is total protein after induction; 4, centrifuging the bacterial crushing liquid and then clearing the bacterial crushing liquid; 5, centrifuging the bacterial crushing liquid and precipitating; lane 6 is the lyophilized recombinant LTB-CTB carrier protein.

Fifthly, preparing the pneumococcal protein-capsular polysaccharide combination

5.1.1 preparation of pneumococcal polysaccharide (7 valent)

Selecting 7 serotypes (4, 6B, 9V, 14, 18C, 19F and 23F) of pneumococcus, fermenting and culturing, separating culture solution by using a sand culture centrifuge, a disc centrifuge or other high-capacity centrifuges, and collecting centrifugal supernatant; ultrafiltering and concentrating the centrifugal supernatant by using a 100KD membrane package, performing fractional precipitation by using 25-80% ethanol, collecting the precipitate, and washing the precipitate by using absolute ethyl alcohol and acetone respectively to obtain crude polysaccharide; dissolving polysaccharide in sterile water for injection, treating with sodium deoxycholate, refining with ion exchange filler by series chromatography or fractional chromatography, collecting flow-through peak, desalting with GE Sephadex G25Coarse, precipitating with ethanol or lyophilizing to recover polysaccharide, and storing at-20 deg.C.

5.1.2 recombinant LTB-CTB Carrier protein pneumococcal polysaccharide conjugates

Coupling the purified recombinant LTB-CTB carrier protein with pneumococcal capsular polysaccharide by an amino reduction method, specifically, coupling the recombinant LTB-CTB carrier protein obtained in the above steps with various capsular saccharides in a ratio of 1: 2, mixing according to the mass ratio. Dissolving each serotype polysaccharide in 150mmol/LPBS (pH7.2), adding sodium periodate (final concentration is 2mmol/L) and oxidizing at room temperature for 10min to prepare 10mL vaccine stock solution, adding 40 μ g each of capsular polysaccharides 4, 9V, 14, 19F and 23F, 18 μ g of oligosaccharide and 20 μ g of polysaccharide 6B, and adding ethylene glycol (final concentration is 25mmol/L) to terminate the reaction. Dialyzing with 150mmol/L PBS for 3 times, adding 160 μ g of pre-reconstituted recombinant LTB-CTB carrier protein, stirring gently at room temperature for 5 days to obtain granular conjugate, and centrifuging at 4 deg.C for 10min for collection. And purifying by gel chromatography column chromatography to obtain the purified conjugate of pneumococcus and recombinant LTB-CTB.

The recombinant LTB-CTB carrier protein pneumococcal polysaccharide conjugate can be selected from lyophilized dosage forms, and is convenient for storage and transportation. The freeze-dried preparation is sucrose as a freeze-dried framework, wherein the initial mass percentage of the sucrose in the freeze-dried stock solution is not more than 20%, and the freeze-dried preparation of the pneumococcal capsular saccharide-protein vaccine is obtained after freeze-drying.

5.1.3 recombinant LTB-CTB Carrier protein pneumococcal polysaccharide conjugate assay

Purifying the combined product by a gel filtration chromatography column, wherein the eluent is 0.2M NaCl, detecting the light absorption value at the ultraviolet 280nm position, and collecting substances in each elution peak. And (3) confirming that the combined product contains a recombinant LTB-CTB component by an SDS-PAGE method, and detecting the protein content. The content of polysaccharide was determined by phenol-sulfuric acid method and confirmed to be about 95. mu.g/mL.

And (3) detecting whether the binding product is combined with GM1 on the surface of the small intestine by GM1-ELISA, and stimulating a mucous membrane system to produce mucous membrane IgA. The specific determination method is as follows:

1) coating: GM1 was diluted to 10. mu.g/mL with carbonate coating buffer. To each reaction well of the 96-well plate, 100. mu.l of the above-described coating antigen was added and left overnight at 4 ℃. The next day, remove the well solution and wash 3 times with wash buffer PBST;

2) and (3) sealing: 200. mu.l of 4% BSA solution was added to the coated wells and left at 37 ℃ for 2 hours. Discarding the confining liquid, and washing for 3 times;

3) sample adding: adding a series of dilution gradients of CTB solution and conjugate sample solution, 100. mu.l per well, incubating at 37 ℃ for 1.5 hours, and washing 3 times;

4) adding a primary antibody: add 1: mu.l of rabbit anti-CTB IgG antibody at 4000 dilutions were incubated for 2 hours at 37 ℃;

5) adding an enzyme-labeled antibody: adding 100 mu l of a freshly diluted enzyme-labeled donkey anti-rabbit IgG antibody into each reaction hole, incubating for 1 hour at 37 ℃, and washing for 3 times;

6) adding a substrate solution for color development: adding 100 mu l of TMB substrate solution into each reaction hole, and standing at room temperature for 10-15 minutes;

7) and (3) terminating the reaction: adding 50 mu l of 2M sulfuric acid into each reaction hole;

8) reading: and detecting the light absorption value of each hole at the ultraviolet 450nm position on a microplate reader, and printing and recording.

The detection result shows that the OD value of the CTB pure protein is about 0.30, and the binding capacity of the CTB pure protein and GM1 is stable. The OD value of the recombinant LTB-CTB protein fluctuates between 0.25 and 0.48, which indicates that the recombinant LTB-CTB in the binding product still maintains the binding capacity with GM1, and the capacity is stable and can cause good mucosal immune response. The peaks are exactly the same at the expected result. The peak products were collected and subjected to GM1-ELISA assay to confirm that recombinant LTB-CTB in the binding product still maintained the ability to bind to GM1 and that the ability was stable and could elicit a good mucosal immune response.

Sixth, immunological evaluation of RSV-PCV vaccine

6.1 IgG antibody titer detection in mice

40 female Balb/C mice of 5 weeks old are taken and randomly divided into 4 groups, namely a FI-RSV group, a Pepper group, a RSV-PCV vaccine group and a PBS negative control group, and each group comprises 10 mice. Intraperitoneal injection, each injection is 5 mu g, the injection is performed once a week for 3 times, and orbital bleeding is taken after 21 days. The IgG antibody titer of each serotype of pneumococcus and the RSV IgG antibody titer in the plasma of the mice are detected by an ELISA method. The results are shown in Table 1.

TABLE 1

As can be seen from table 1 above, the RSV-PCV combined vaccine of the present invention can effectively induce two immune responses, namely PCV and RSV, in a mouse body, to generate an immune effect, but the antibody titer is slightly lower than that of the existing vaccine, probably because two antigens induce immune competition in vivo, the antibody titer is slightly lower than that of the existing single vaccine, which can be further studied as a subsequent development direction.

6.2 in vivo IgA antibody titer detection in mice

40 female Balb/C mice of 5 weeks old were randomly divided into 4 groups, namely FI-RSV group, Peyer group, RSV-PCV vaccine group and negative control (SL7207 blank bacteria) group.

The mice were anesthetized by intraperitoneal injection with 1.5% sodium pentobarbital until the mice were no longer alive, and the RSV-PCV mixture was dropped into the nasal cavities of the mice in the experimental group by a sterile tip, 30. mu.l each (containing 15. mu.g of vaccine mixture), while the nasal cavities of the mice in the control group were dropped by SL7207 white bacteria, 30. mu.l each; immunizations were performed once a week for four weeks.

One week after the last immunization, carbachol was intraperitoneally injected into mice to produce saliva, 30ul per mouse, and saliva was collected using a sterile pipette tip (mucosal immunization group collection); the saliva of each group of mice was extracted from 1: 200 start dilution to 1: 25600, indirect ELISA to detect antibody titers. Mucosal immunoassay saliva IgA titers (geometric mean). The results are shown in Table 2.

TABLE 2

	FI-RSV	PCV 7 (Peier)	RSV-PCV	Negative control
					Type
4	--	5861	7811	0
					6B type	--	7356	7799	0
9V type	--	8993	9631	0
					14 type	--	6013	7141	0
Type 18	--	7913	8515	0
					19F type	--	9036	9581	0
Type 23F	--	7629	8791	0
					RSV	7022	--	10640	0

As can be seen from the above table, the bacterial vector in the RSV-PCV vaccine used after mixing plays a role of a certain mucosal adjuvant, and compared with the existing products, the mucosal immune antibody titer is slightly increased, but no significant effect is found in the antibody aspect of the PCV antigen, which may be caused by insufficient promotion effect of the bacterial vector on PCV due to the carrier of the RSV antigen, or possibly caused by immune competition between different antigens, and the specific principle and deep analysis of mucosal immunity can be discussed as the research subject of the subsequent experiment.

Finally, it must be said here that: the above embodiments are only used for further detailed description of the technical solutions of the present invention, and should not be understood as limiting the scope of the present invention, and the insubstantial modifications and adaptations made by those skilled in the art according to the above descriptions of the present invention are within the scope of the present invention.

SEQUENCE LISTING

<110> Wuhan Bowo Biotechnology Ltd

<120> RSV-PCV vaccine and method for preparing the same

<130>2017

<160>14

<170>PatentIn version 3.5

<210>1

<211>1725

<212>DNA

<213>respiratory syncytial virus

<220>

<223>F CDS DNA

<400>1

atggagctgc tgatccacag gttaagtgca atcttcctaa ctcttgctat taatgcattg 60

tacctcacct caagtcagaa cataactgag gagttttacc aatcgacatg tagtgcagtt 120

agcagaggtt attttagtgc tttaagaaca ggttggtata ccagtgtcat aacaatagaa 180

ttaagtaata taaaagaaac caaatgcaat ggaactgaca ctaaagtaaa acttataaaa 240

caagaattag ataagtataa gaatgcagtg acagaattac agctacttat gcaaaacaca 300

ccagctgcca acaaccgggc cagaagagaa gcaccacagt atatgaacta tacaatcaat 360

accactaaaa acctaaatgt atcaataagc aagaagagga aacgaagatt tctgggcttc 420

ttgttaggtg taggatctgc aatagcaagt ggtatagctg tatccaaagt tctacacctt 480

gaaggagaag tgaacaagat caaaaatgct ttgttatcta caaacaaagc tgtagtcagt 540

ctatcaaatg gggtcagtgt tttaaccagc aaagtgttag atctcaagaa ttacataaat 600

aaccaattat tacccatagt aaatcaacag agctgtcgca tctccaacat tgaaacagtt 660

atagaattcc agcagaagaa cagcagattg ttggaaatca acagagaatt cagtgtcaat 720

gcaggtgtaa caacaccttt aagcacttac atgttaacaa acagtgagtt actatcattg 780

atcaatgata tgcctataac aaatgatcag aaaaaattaa tgtcaagcaa tgttcagata 840

gtaaggcaac aaagttattc tatcatgtct ataataaagg aagaagtcct tgcatatgtt 900

gtacagctac ctatctatgg tgtaatagat acaccttgct ggaaattaca cacatcacct 960

ctatgcacca ccaacatcaa agaaggatca aatatttgtt taacaaggac tgatagagga 1020

tggtattgtg ataatgcagg atcagtatcc ttctttccac aggctgacac ttgtaaagta 1080

cagtccaatc gagtattttg tgacactatg aacagtttga cattaccaag tgaagtcagc 1140

ctttgtaaca ctgacatatt caattccaag tatgactgca aaattatgac atcaaaaaca 1200

gacataagca gctcagtaat tacttctctt ggagctatag tgtcatgcta tggtaaaact 1260

aaatgcactg catccaacaa aaatcgtggg attataaaga cattttctaa tggttgtgac 1320

tatgtgtcaa acaaaggagt agatactgtg tcagtgggca acactttata ctatgtaaac 1380

aagctggaag gcaagaacct ttatgtaaaa ggggaaccta taataaatta ctatgaccct 1440

ctagtgtttc cttctgatga gtttgatgca tcaatatctc aagtcaatga aaaaatcaat 1500

caaagtttag cttttattcg tagatctgat gaattactac ataatgtaaa tactggcaaa 1560

tctactacaa atattatgat aactacaatt attatagtaa tcattgtagt attgttatca 1620

ttaatagcta ttggtttgct gttgtattgc aaagccaaaa acacaccagt tacactaagc 1680

aaagaccaac taagtggaat caataatatt gcattcagca aatag 1725

<210>2

<211>31

<212>DNA

<213>Artificial Sequence

<220>

<223> F-F primer

<400>2

cccaagcttc agaaaaccgt gacctatcaag 31

<210>3

<211>32

<212>DNA

<213>Artificial Sequence

<220>

<223> F-R primer

<400>3

ccctcgagac atgaagtttt gcctcactag ta 32

<210>4

<211>2306

<212>DNA

<213>Artificial Sequence

<220>

<223> fragment to be amplified

<400>4

cttagttatt caaaaactac atcttagcag aaaaccgtga cctatcaagc aagaacgaaa 60

ttaaacctgg ggcaaataac catggagctg ctgatccaca ggttaagtgc aatcttccta 120

actcttgcta ttaatgcatt gtacctcacc tcaagtcaga acataactga ggagttttac 180

caatcgacat gtagtgcagt tagcagaggt tattttagtg ctttaagaac aggttggtat 240

accagtgtca taacaataga attaagtaat ataaaagaaa ccaaatgcaa tggaactgac 300

actaaagtaa aacttataaa acaagaatta gataagtata agaatgcagt gacagaatta 360

cagctactta tgcaaaacac accagctgcc aacaaccggg ccagaagaga agcaccacag 420

tatatgaact atacaatcaa taccactaaa aacctaaatg tatcaataag caagaagagg 480

aaacgaagat ttctgggctt cttgttaggt gtaggatctg caatagcaag tggtatagct 540

gtatccaaag ttctacacct tgaaggagaa gtgaacaaga tcaaaaatgc tttgttatct 600

acaaacaaag ctgtagtcag tctatcaaat ggggtcagtg ttttaaccag caaagtgtta 660

gatctcaaga attacataaa taaccaatta ttacccatag taaatcaaca gagctgtcgc 720

atctccaaca ttgaaacagt tatagaattc cagcagaaga acagcagatt gttggaaatc 780

aacagagaat tcagtgtcaa tgcaggtgta acaacacctt taagcactta catgttaaca 840

aacagtgagt tactatcatt gatcaatgat atgcctataa caaatgatca gaaaaaatta 900

atgtcaagca atgttcagat agtaaggcaa caaagttatt ctatcatgtc tataataaag 960

gaagaagtcc ttgcatatgt tgtacagcta cctatctatg gtgtaataga tacaccttgc 1020

tggaaattac acacatcacc tctatgcacc accaacatca aagaaggatc aaatatttgt 1080

ttaacaagga ctgatagagg atggtattgt gataatgcag gatcagtatc cttctttcca 1140

caggctgaca cttgtaaagt acagtccaat cgagtatttt gtgacactat gaacagtttg 1200

acattaccaa gtgaagtcag cctttgtaac actgacatat tcaattccaa gtatgactgc 1260

aaaattatga catcaaaaac agacataagc agctcagtaa ttacttctct tggagctata 1320

gtgtcatgct atggtaaaac taaatgcact gcatccaaca aaaatcgtgg gattataaag 1380

acattttcta atggttgtga ctatgtgtca aacaaaggag tagatactgt gtcagtgggc 1440

aacactttat actatgtaaa caagctggaa ggcaagaacc tttatgtaaa aggggaacct 1500

ataataaatt actatgaccc tctagtgttt ccttctgatg agtttgatgc atcaatatct 1560

caagtcaatg aaaaaatcaa tcaaagttta gcttttattc gtagatctga tgaattacta 1620

cataatgtaa atactggcaa atctactaca aatattatga taactacaat tattatagta 1680

atcattgtag tattgttatc attaatagct attggtttgc tgttgtattg caaagccaaa 1740

aacacaccag ttacactaag caaagaccaa ctaagtggaa tcaataatat tgcattcagc 1800

aaatagacaa aaaaccacct gatcatgttt caacaacagt ctgctgatca ccaatcccaa 1860

atcaacccat aacaaacact tcaacatcac agtacaggct gaatcatttc ttcacatcat 1920

gctacccaca caactaagct agatccttaa ctcatagtta cataaaaacc tcaagtatca 1980

caatcaaaca ctaaatcaac acatcattca caaaattaac agctggggca aatatgtcgc 2040

gaagaaatcc ttgtaaattt gagattagag gtcattgctt gaatggtaga agatgtcact 2100

acagtcataa ttactttgaa tggcctcctc atgccttact agtgaggcaa aacttcatgt 2160

taaacaagat actcaagtca atggacaaaa gcatagacac tttgtctgaa ataagtggag 2220

ctgctgaact ggacagaaca gaagaatatg ctcttggtat agttggagtg ctagagagtt 2280

acataggatc tataaacaac ataaca 2306

<210>5

<211>375

<212>DNA

<213>Unknown

<220>

<223> LTB DNA sequence

<400>5

atgaataaag taaaatgtta tgttttattt acggcgttac tatcctctct atatgcacac 60

ggagctcccc agactattac agaactatgt tcggaatatc gcaacacaca aatatatacg 120

ataaatgaca agatactatc atatacggaa tcgatggcag gcaaaagaga aatggttatc 180

attacattta agagcggcga aacatttcaggtcgaagtcc cgggcagtca acatatagac 240

tcccagaaaa aagccattga aaggatgaag gacacattaa gaatcacata tctgaccgag 300

accaaaattg ataaattatg tgtatggaat aataaaaccc ccaattcaat tgcggcaatc 360

agtatgaaaa actag 375

<210>6

<211>124

<212>Protein

<213>Unknown

<220>

<223> LTB amino acid sequence

<400>6

MNKVKCYVLF TALLSSLYAH GAPQTITELC SEYRNTQIYT INDKILSYTE SMAGKREMVI 60

ITFKSGETFQ VEVPGSQHID SQKKAIERMK DTLRITYLTE TKIDKLCVWN NKTPNSIAAI 120

SMKN 124

<210>7

<211>375

<212>DNA

<213>Unknown

<220>

<223> CTB DNA sequence

<400>7

atgattaaat taaaatttgg tgtttttttt acagttttac tatcttcagc atatgcaaat 60

ggaacacctc aaaatattac tgatttgtgt gcagaatacc acaacacaca aatacatacg 120

ctaaatgata agatattttc gtatacagaa tctctagctg gaaaaagaga gatggctatc 180

attactttta agaatggtgc aacttttcaa gtagaagtac caggtagtca acatatagat 240

tcacaaaaaa aagcgattga aaggatgaag gataccctga ggattgcata tcttactgaa 300

gctaaagtcg aaaagttatg tgtatggaat aataaaacgc ctcatgcgat tgccgcaatt 360

agtatggcaa attaa 375

<210>8

<211>124

<212>Protein

<213>Unknown

<220>

<223> CTB amino acid sequence

<400>8

MIKLKFGVFF TVLLSSAYAN GTPQNITDLC AEYHNTQIHT LNDKIFSYTE SLAGKREMAI 60

ITFKNGATFQ VEVPGSQHID SQKKAIERMK DTLRIAYLTE AKVEKLCVWN NKTPHAIAAI 120

SMAN 124

<210>9

<211>747

<212>DNA

<213>Unknown

<220>

<223>LTB-CTB DNA

<400>9

atgaataaag taaaatgtta tgttttattt acggcgttac tatcctctct atatgcacac 60

ggagctcccc agactattac agaactatgt tcggaatatc gcaacacaca aatatatacg 120

ataaatgaca agatactatc atatacggaa tcgatggcag gcaaaagaga aatggttatc 180

attacattta agagcggcga aacatttcag gtcgaagtcc cgggcagtca acatatagac 240

tcccagaaaa aagccattga aaggatgaag gacacattaa gaatcacata tctgaccgag 300

accaaaattg ataaattatg tgtatggaat aataaaaccc ccaattcaat tgcggcaatc 360

agtatgaaaa acatgattaa attaaaattt ggtgtttttt ttacagtttt actatcttca 420

gcatatgcaa atggaacacc tcaaaatatt actgatttgt gtgcagaata ccacaacaca 480

caaatacata cgctaaatga taagatattt tcgtatacag aatctctagc tggaaaaaga 540

gagatggcta tcattacttt taagaatggt gcaacttttc aagtagaagt accaggtagt 600

caacatatag attcacaaaa aaaagcgatt gaaaggatga aggataccct gaggattgca 660

tatcttactg aagctaaagt cgaaaagtta tgtgtatgga ataataaaac gcctcatgcg 720

attgccgcaa ttagtatggc aaattaa 747

<210>10

<211>248

<212>Protein

<213>Unknown

<220>

<223> LTB-CTB amino acid sequence

<400>10

MNKVKCYVLF TALLSSLYAH GAPQTITELC SEYRNTQIYT INDKILSYTE SMAGKREMVI 60

ITFKSGETFQ VEVPGSQHID SQKKAIERMK DTLRITYLTE TKIDKLCVWN NKTPNSIAAI 120

SMKNMIKLKF GVFFTVLLSS AYANGTPQNI TDLCAEYHNT QIHTLNDKIF SYTESLAGKR 180

EMAIITFKNG ATFQVEVPGS QHIDSQKKAI ERMKDTLRIA YLTEAKVEKL CVWNNKTPHA 240

IAAISMAN 248

<210>11

<211>47

<212>DNA

<213>Unknown

<220>

<223> LTB-Fwd primer sequence

<400>11

cgggatccat gaataaagta aaatgttatg ttttatttac ggcgtta 47

<210>12

<211>36

<212>DNA

<213>Unknown

<220>

<223> LTB-Rev primer sequences

<400>12

ctagggtctc catgtttttc atactgattg ccgcaa 36

<210>13

<211>52

<212>DNA

<213>Unknown

<220>

<223> CTB-Fwd primer sequence

<400>13

ctagggtctc aacatgatta aattaaaatt tggtgttttt tttacagttt ta 52

<210>14

<211>34

<212>DNA

<213>Unknown

<220>

<223> CTB-Rev primer sequences

<400>14

ccctcgagtt aatttgccat actaattgcg gcaa 34

Claims

1. An RSV-PCV vaccine, wherein the combination vaccine comprises:

an RSV (respiratory syncytial virus) immune intermediate, wherein the antigen of the RSV immune intermediate is an RSV membrane surface fusion protein F which can cause an immune response of an organism, wherein a nucleic acid sequence of an expression protein antigen is recombined on a nucleic acid vector, and the nucleic acid sequence of a recombinant protein takes an attenuated intracellular bacterium as a bacterial vector; the gene sequence for expressing the F protein sequence is shown in a sequence table SEQ ID NO: 1, designing a specific primer according to a nucleic acid sequence of an expression protein, wherein the primer sequence is shown as a sequence table SEQ ID NO: 2 and SEQ ID NO: 3, the sequence to be amplified after the primer is combined is shown as a sequence table SEQ ID NO: 4, the bacterial vector for transfecting the RSV antigen is SL 7207/pcDNA3.1-F;

PCV (pneumococcus) immune intermediate which is pneumococcus polysaccharide antigen and protein carrier, wherein the protein carrier is recombinant protein carrier, and is obtained by recombining escherichia coli heat-labile enterotoxin B subunit (LTB) protein and vibrio cholerae enterotoxin B subunit protein (CTB), the LTB nucleic acid sequence and the CTB nucleic acid sequence are bridged through primer sequence, and the coded carrier protein sequence is shown as sequence table SEQ ID NO: 10 is shown in the figure; the gene sequence of the coded recombinant carrier protein is shown in a sequence table SEQID NO: 9, shown as SEQ ID NO: the carrier protein shown in 9 is C end of LTB protein connected with N end of CTB protein, LTB gene is connected with CTB gene through primer, R end primer sequence of LTB gene is shown in sequence table SEQ ID NO: 12, the sequence of the F-end primer of the CTB gene is shown as the sequence table SEQ ID NO: 13 is shown in the figure; the sequence of the primer at the F end of the LTB gene is shown as the sequence table SEQID NO: 11, the R-end primer sequence of the CTB gene is shown as a sequence table SEQ ID NO: 14 is shown in the figure; the pneumococcal polysaccharide antigen is polysaccharide on the capsule of the pneumococcus of separated and purified serotypes, wherein the serotypes of the pneumococcus are 4, 6B, 9V, 14, 18, 19F and 23F;

2. The RSV-PCV vaccine according to claim 1, characterized in that: the mass ratio of each serotype of pneumococcal capsular saccharide to the protein carrier is 1.5-4.5: 1.

3. The RSV-PCV vaccine according to claim 1, characterized in that: the RSV immune intermediate and the PCV immune intermediate are both freeze-dried powder and are suspended for clinical use.

4. The method of producing an RSV-PCV vaccine according to claim 1, wherein the method of producing an RSV immune intermediate comprises the steps of:

a. culturing RSV, adopting a virus RNA/DNA rapid purification kit to extract RSV bacterial RNA, carrying out Reverse Transcription (RT) on the extracted bacterial RNA, and carrying out F protein gene sequence amplification by taking a cDNA product after the reverse transcription as a template;

b. designing a specific primer according to an RSV virus protein expression sequence, wherein the specific primer sequence is shown in a sequence table SEQ ID NO: 2 and SEQ ID NO: 3, the expression vector of the recombinant antigen protein is pcDNA3.1-F;

c. the expression vector is transfected into attenuated salmonella SL7207 to construct antigen SL 7207/pcDNA3.1-F.

5. The method of producing an RSV-PCV vaccine according to claim 1, characterized in that the method of producing an immune intermediate of PCV comprises the steps of:

a. according to CDS region nucleic acid sequences of LTB and CTB, after PCR amplification, carrying out double enzyme digestion through BamH I and Xho I, and recovering LTB-CTB fragments and an expression vector pET28a through gel to construct pET28a-LTB-CTB plasmid;

b. transforming the plasmid into an escherichia coli DH5 alpha strain, screening positive clones, performing monoclonal amplification, and identifying after IPTG induction;