CN107227323B - Construction and application of high-yield selenomethionine saccharomyces cerevisiae - Google Patents
Construction and application of high-yield selenomethionine saccharomyces cerevisiae Download PDFInfo
- Publication number
- CN107227323B CN107227323B CN201710582722.6A CN201710582722A CN107227323B CN 107227323 B CN107227323 B CN 107227323B CN 201710582722 A CN201710582722 A CN 201710582722A CN 107227323 B CN107227323 B CN 107227323B
- Authority
- CN
- China
- Prior art keywords
- saccharomyces cerevisiae
- met6
- selenium
- selenomethionine
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/12—Methionine; Cysteine; Cystine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
- C12N9/1007—Methyltransferases (general) (2.1.1.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y201/00—Transferases transferring one-carbon groups (2.1)
- C12Y201/01—Methyltransferases (2.1.1)
- C12Y201/01013—Methionine synthase (2.1.1.13)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses construction and application of high-yield selenomethionine selenium-rich saccharomyces cerevisiae. The target fragment containing the strong promoter is combined with the yeast genome by homologous recombinationMET6Exchanging promoter region of gene to obtainMET6An overexpression strain. The invention obtains the saccharomyces cerevisiae by screeningMET6The mutant strain SZ1 was overexpressed. Then the mutant strain is used for selenium enrichment operation, the mutant strain is cultured to a stable stage under the induction condition of galactose, and Na with the final concentration of 2.5mM is added2SeO3And incubating for 24h to obtain the selenium-enriched yeast with high yield of selenomethionine. The invention firstly uses the saccharomyces cerevisiaeMET6The gene modification is related to the selenium enrichment of saccharomyces cerevisiae. The content of the selenomethionine in the selenium-enriched cells of the strain is increased by at least two times compared with that of wild yeast cells.
Description
Technical Field
The invention belongs to the technical field of saccharomyces cerevisiae engineering, and particularly relates to saccharomyces cerevisiaeMET6Construction method of overexpression mutant strain and also relates toMET6Application of over-expression saccharomyces cerevisiae mutant strain.
Background
Selenium is one of essential elements of human body, and has the functions of resisting oxidation, enhancing immunity, detoxifying, promoting basal metabolism and the like. Insufficient selenium intake can lead to a series of diseases such as keshan disease, cancer, cardiovascular disease and the like. Therefore, adequate intake of selenium has an important role in maintaining health in humans. The Chinese Nutrition society establishes the reference intake of dietary selenium of Chinese residents, and proposes that the average dietary selenium requirement of adults is 41 mug/d, and the recommended intake is 50 mug/d. Selenomethionine is a low-toxicity organic selenide, can be metabolized and retained in human bodies and animals, is superior to other selenium compounds in terms of nutrition, and is an ideal selenium supplement.
As a main strain in the fermentation industry, the saccharomyces cerevisiae also has strong selenium tolerance and enrichment capacity. The selenium-rich capacity is up to 3000 mug/g, inorganic selenium can be converted into organic selenium, wherein more than 90% of selenium exists in the form of selenomethionine. The selenium-enriched yeast becomes a preferred selenium supplement additive due to the advantages of strong edible safety, high bioavailability and the like, and is widely applied to the feeding of animals and poultry and the selenium supplement of human bodies.
The improvement of the selenium enrichment capacity of the yeast is an important subject, and the traditional solution generally starts from the aspects of the optimization of the components of a culture medium and the optimization of culture conditions (temperature, rotating speed, ventilation capacity, pH and the like). The technology utilizes a strong yeast genetics operating system to further regulate and control the synthesis of the intracellular selenomethionine and transform the selenium metabolism of cells, thereby improving the synthesis capability of the intracellular selenomethionine.
MET6The gene-coded methionine synthase can catalyze homocysteine to generate methionine, and is one of the main paths for synthesizing methionine in saccharomyces cerevisiae cells. At present, no saccharomyces cerevisiae is seenMET6The report of improving the synthesis capacity of intracellular selenomethionine by gene modification.
Disclosure of Invention
The invention aims at constructing saccharomyces cerevisiaeMET6Overexpressed mutant strainsMET6The gene over-expression improves the capability of synthesizing selenomethionine when the selenium is enriched.
Another object of the present invention is to provide a method for producing Saccharomyces cerevisiaeMET6Construction method of over-expression mutant strain, and construction of saccharomyces cerevisiae cell by using microbial genetics methodMET6After the mutant strain is over-expressed, the mutant strain is used for high yield of selenomethionine when the selenium is enriched.
In order to achieve the purpose, the invention adopts the following technical scheme:
a method for preparing Saccharomyces cerevisiaeMET6Application of gene overexpression mutant strain in improving synthesis of selenomethionine.
Saccharomyces cerevisiaeMET6The construction method of the gene overexpression mutant strain comprises the following steps: exchanging a target fragment containing a strong promoter with a promoter region of MET6 gene on yeast genome by homologous recombinationMET6An overexpression strain.
Saccharomyces cerevisiaeMET6The method for constructing the gene over-expression mutant strain SZ1 comprises the following steps:
saccharomyces cerevisiaeMET6Construction of the overexpression mutant SZ 1: the homologous recombination knockout principle, primer design and knockout fragment transformation method of the saccharomyces cerevisiae gene are carried out according to the methods described in the literature (Yeast1998, 14: 953-962), which is currently a general method for gene knockout in Saccharomyces cerevisiae;
1) designing a primer: according to the Saccharomyces cerevisiaeMET6Gene sequence (GenBank: BK 006943.1) design primers:
the upstream primer MET 6-P1:
TTTTTGTTAAACTCTTCCTTTATCATAAAAAAGCAAGCATCTAAGAGCATAAAGGGAATAAGGGCGACAC；
downstream primer MET 6-P2:
TGATATGTACTTTGAAATTATATTGGTATTTTGTTTCTTAGAGTGTTGTCGGTTTTTTCTCCTTGACGTT；
2) PCR amplification, namely performing PCR amplification on plasmid pSP72-ura3-pGA L1 (available from Addgene) by using upstream primer MET6-P1 and downstream primer MET6-P2 to obtain the saccharomyces cerevisiae-containing strainMET6A GA L1 strong promoter fragment of the upstream and downstream sequences of the gene promoter;
3）MET6overexpression of genes, namely introducing a knockout fragment obtained BY PCR amplification into a saccharomyces cerevisiae BY4742 strain cell (the BY4742 strain is from China center for type culture Collection and can be obtained BY purchasing) BY a L iAc/PEG (PEG) conversion method, and screening BY Ura markers to obtain M of saccharomyces cerevisiae with Ura synthetic genesET6Overexpression mutant strain SZ1 (Saccharomyces cerevisiaeSZ 1), this strain was deposited, and the depository: china center for type culture Collection, Address: wuhan university, preservation date: 12 months 6 and 2017, the preservation number is CCTCC No: m2017326, class name: saccharomyces cerevisiae SZ1 (Saccharomyces cerevisiaeSZ1)。
A method for preparing wine yeastMET6The application of the gene overexpression mutant strain SZ1 in improving the synthesis of selenomethionine comprises the following steps:
1) the selenium-rich process:will be provided withMET6The over-expressed mutants SZ1 and BY4742 were inoculated from a plate into 2 m L YPGal medium (yeast extract: 1%, peptone: 2%, galactose: 2%), respectively, cultured with shaking at 30 ℃ at 200 rpm/min for 24 hours, and Na was added to the medium to a final concentration of 2.5mM2SeO3Continuously carrying out shaking culture at 30 ℃ for 24h at 200 rpm/min to complete selenium enrichment;
2) collecting intracellular selenomethionine, collecting selenized yeast cells (0.5 g, wet weight), washing with PBS solution, subpackaging to cryopreservation tubes filled with acid-washed glass beads (Sigma), crushing cells with Mini-Beadbed-16 type glass bead cell crusher, shaking for 1 min, incubating on ice for 1 min, centrifuging, collecting supernatant, adding 200 mg of Trypsin and 10 × TCS Buffer (1M Tris-Cl pH 7.5,100 mM CaCl)25% SDS) at 37 ℃ for 18 h; after centrifugation, the supernatant was filtered through a 0.22 μm filter, and 40 mg of protease 14 was added thereto and incubated at 37 ℃ for 24 hours; after centrifugation, the supernatant was filtered through a 0.22 μ M filter, and the incompletely digested protein was removed by size exclusion chromatography (Superdex 200 HR 10/30 Column; Shimadzu chromatography system as instrument) with a mobile phase composition of 0.05M NaH2PO4-Na2HPO4(pH 7.2), the flow rate of the mobile phase is 0.5 m L/min, the column temperature is 30 ℃, the ultraviolet detection wavelength is set to be 220 nm and 280 nm, and samples with the retention time of 80-89 min and 101-104.5 min are collected;
3) the collected samples were further confirmed BY injecting into a high performance liquid chromatography-inductively coupled plasma-mass spectrometer (HP L C-ICP-MS) with mobile phase consisting of formic acid/ammonium formate (25 mM), 0.1% (v/v) TFA, pH 3.1, 3% (v/v) methanol, selenomethionine standard purchased from Sigma, wild type Saccharomyces cerevisiae BY4742 and wild type Saccharomyces cerevisiae BY4742MET6After the overexpression mutant strain SZ1 is rich in selenium, the content of the intracellular selenomethionine is 7.806 mug/g SeMet and 21.15 mug/g SeMet respectively.
Compared with the prior art, the invention has the following advantages and effects:
the invention firstly uses the saccharomyces cerevisiaeMET6The gene is related to the selenium enrichment of the saccharomyces cerevisiae. Using strong yeast geneticsTo learn about the operating system, constructMET6Overexpression of the mutant SZ1MET6The gene further regulates and controls the synthesis of intracellular selenomethionine, and modifies the selenium metabolism of cells, thereby improving the synthesis capacity of the intracellular selenomethionine. The content of the selenomethionine in the selenium-enriched cells of the strain is increased by at least 2 times compared with that of wild yeast cells.
Drawings
FIG. 1 shows a PCR assayMET6Electrophoresis of the recombinant strain SZ 1.
By passingMET6PCR with the gene promoter specificity homologous recombination verification primer can find that a 2200 bp specific amplification band appears in a Lane of the SZ1 template.
Detailed Description
The invention is further explained by taking the construction and application of the selenium-enriched saccharomyces cerevisiae with high yield of selenomethionine as an example and referring to the attached drawings.
The Saccharomyces cerevisiae BY4742 strain and the plasmid pSP72-ura3-pGA L1 are from the China center for type culture Collection.
[ example 1 ] A Saccharomyces cerevisiaeMET6Construction method of over-expression mutant strain SZ1
Saccharomyces cerevisiaeMET6Construction of the overexpression mutant SZ 1: the homologous recombination knockout principle, primer design and knockout fragment transformation method of the saccharomyces cerevisiae gene are carried out according to the methods described in the literature (Yeast1998, 14: 953-962), which is currently a general method for gene knockout in Saccharomyces cerevisiae;
1) designing a primer: according to the Saccharomyces cerevisiaeMET6Gene sequence (GenBank: BK 006943.1) design primers:
the upstream primer MET 6-P1:
TTTTTGTTAAACTCTTCCTTTATCATAAAAAAGCAAGCATCTAAGAGCATAAAGGGAATAAGGGCGACAC；
downstream primer MET 6-P2:
TGATATGTACTTTGAAATTATATTGGTATTTTGTTTCTTAGAGTGTTGTCGGTTTTTTCTCCTTGACGTT；
2) and (3) PCR amplification: utilizing an upstream primer MET6-P1 and a downstream primer MET6-P2The plasmid pSP72-ura3-pGA L1 (available from Addgene) was subjected to PCR amplification to obtain a plasmid containing Saccharomyces cerevisiaeMET6A GA L1 strong promoter fragment of the upstream and downstream sequences of the gene promoter;
3）MET6overexpression of genes, namely introducing the knockout fragment obtained BY PCR amplification in the step 2) into a cell of a Saccharomyces cerevisiae BY4742 strain BY an L iAc/PEG (the BY4742 strain is from China center for type culture Collection and can be obtained BY purchase) through a transformation method of L iAc/PEG, and screening through Ura markers to obtain M of the Saccharomyces cerevisiae with Ura synthetic genesET6Overexpression mutant strain SZ1 (Saccharomyces cerevisiaeSZ 1) preserved in China center for type culture Collection with the preservation number of CCTCC No. M2017326.
Example 2M Using Saccharomyces cerevisiaeET6Application of overexpression mutant strain in improvement of synthesis of selenomethionine
Will be provided withMET6The over-expressed mutants SZ1 and BY4742 were inoculated from a plate into 2 m L YPGal medium (yeast extract: 1%, peptone: 2%, galactose: 2%), respectively, cultured with shaking at 30 ℃ at 200 rpm/min for 24 hours, and Na was added to the medium to a final concentration of 2.5mM2SeO3Continuously performing shaking culture at 30 ℃ for 24h at 200 rpm/min to complete selenium enrichment, collecting selenized yeast cells (0.5 g, wet weight), washing with PBS solution, subpackaging to cryopreservation tubes filled with acid-washed glass beads (Sigma), crushing cells with Mini-Beadbed-16 type glass bead cell crusher, shaking for 1 min, incubating on ice for 1 min, centrifuging, collecting supernatant, adding 200 mg of Trypsin and 10 × TCS Buffer (1M Tris-Cl pH 7.5,100 mM CaCl)25% SDS) at 37 ℃ for 18 h. After centrifugation, the supernatant was filtered through a 0.22 μm filter and incubated at 37 ℃ for 24h with 40 mg of protease 14. After centrifugation, the supernatant was filtered through a 0.22 μ M filter, and the incompletely digested protein was removed by size exclusion chromatography (Superdex 200 HR 10/30 Column; Shimadzu chromatography system as instrument) with a mobile phase composition of 0.05M NaH2PO4-Na2HPO4(pH 7.2), the flow rate of mobile phase is 0.5 m L/min, the column temperature is 30 ℃, the ultraviolet detection wavelength is set to 220 nm and 280 nm, and the mixture is collectedThe retention time is 80-89 min and 101-104.5 min.
The collected samples were further confirmed BY injecting into a high performance liquid chromatography-inductively coupled plasma-mass spectrometer (HP L C-ICP-MS) with mobile phases of formic acid/ammonium formate (25 mM), 0.1% (v/v) TFA, pH 3.1, 3% (v/v) methanol selenomethionine standards purchased from Sigma, wild type Saccharomyces cerevisiae BY4742 and wild type Saccharomyces cerevisiae BY4742MET6After the overexpression mutant strain SZ1 is rich in selenium, the content of the intracellular selenomethionine is 7.806 mug/g SeMet and 21.15 mug/g SeMet respectively.
The foregoing description is illustrative of the present invention and is not to be construed as limiting thereof, the scope of the invention being defined by the appended claims, which may be modified in any manner without departing from the spirit of the invention.
SEQUENCE LISTING
<110> Wuhan university
Construction and application of saccharomyces cerevisiae with high yield of selenomethionine
<160>2
<170>PatentIn version 3.3
<210>1
<211>70
<212>DNA
<213> Artificial sequence
<400>1
tttttgttaa actcttcctt tatcataaaa aagcaagcat ctaagagcat aaagggaata 60
agggcgacac 70
<210>2
<211>70
<212>DNA
<213> Artificial sequence
<400>2
tgatatgtac tttgaaatta tattggtatt ttgtttctta gagtgttgtc ggttttttct 60
ccttgacgtt 70
Claims (2)
1. Saccharomyces cerevisiaeMET6Gene transferExpression mutant strain, characterized in that it is classified and named as Saccharomyces cerevisiae SZ 1: (Saccharomyces cerevisiaeSZ 1) with a preservation number of CCTCC No. M2017326.
2. A method of producing Saccharomyces cerevisiae according to claim 1MET6Application of gene overexpression mutant strain in improving synthesis of yeast selenomethionine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710582722.6A CN107227323B (en) | 2017-07-17 | 2017-07-17 | Construction and application of high-yield selenomethionine saccharomyces cerevisiae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710582722.6A CN107227323B (en) | 2017-07-17 | 2017-07-17 | Construction and application of high-yield selenomethionine saccharomyces cerevisiae |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107227323A CN107227323A (en) | 2017-10-03 |
| CN107227323B true CN107227323B (en) | 2020-07-10 |
Family
ID=59956460
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710582722.6A Active CN107227323B (en) | 2017-07-17 | 2017-07-17 | Construction and application of high-yield selenomethionine saccharomyces cerevisiae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107227323B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102296033A (en) * | 2011-04-26 | 2011-12-28 | 武汉大学 | Construction method and application of Saccharomyces cerevisiae gsh1 deleted mutant strain |
| US8318474B1 (en) * | 2005-05-23 | 2012-11-27 | California Institute Of Technology | Engineered yeast cells and uses thereof |
-
2017
- 2017-07-17 CN CN201710582722.6A patent/CN107227323B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8318474B1 (en) * | 2005-05-23 | 2012-11-27 | California Institute Of Technology | Engineered yeast cells and uses thereof |
| CN102296033A (en) * | 2011-04-26 | 2011-12-28 | 武汉大学 | Construction method and application of Saccharomyces cerevisiae gsh1 deleted mutant strain |
Non-Patent Citations (2)
| Title |
|---|
| "Regulation of Amino Acid, Nucleotide, and Phosphate Metabolism inSaccharomyces cerevisiae";Per O. Ljungdahl 等;《Genetics》;20120331;第190卷(第3期);第899页图9及其图注 * |
| "富硒酵母的研究进展";贾洪锋 等;《四川食品与发酵》;20050930;第41卷(第126期);第10页左栏第1、2段、表1，第10-12页正文第3、4节 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107227323A (en) | 2017-10-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5826447B2 (en) | Non-recombinant Saccharomyces strain grown on xylose | |
| Cadete et al. | Spathaspora brasiliensis sp. nov., Spathaspora suhii sp. nov., Spathaspora roraimanensis sp. nov. and Spathaspora xylofermentans sp. nov., four novel D-xylose-fermenting yeast species from Brazilian Amazonian forest | |
| CN106701606B (en) | Genetic engineering candida utilis capable of degrading and utilizing kitchen waste and construction method thereof | |
| CN104640976B (en) | Being capable of fermenting xylose and yeast strain to inhibitor tolerance, its preparation method and application thereof | |
| CN104651287B (en) | A kind of engineering bacteria and application for synthetic glycerine glucoside | |
| WO2018082588A1 (en) | Recombinant yeast and use thereof | |
| Álvarez-Cao et al. | Bioconversion of beet molasses to alpha-galactosidase and ethanol | |
| CN108587926B (en) | Aspergillus niger, preparation method of alpha-L-rhamnosidase thereof, plasmid vector and recombinant bacterium | |
| WO2021104164A1 (en) | Mortierella alpina and use thereof, and microbial oil rich in ara at position sn-2, preparation method therefor and use thereof | |
| CN107257851A (en) | Positive influences are natural or combination of bacterial chaperonin of physiology of eukaryotic of engineering | |
| TW201437367A (en) | Yeast strain for lactic acid production by using pentose and hexose | |
| CN106414735B (en) | Optimized propagation pentose fermentation strain | |
| CN107227323B (en) | Construction and application of high-yield selenomethionine saccharomyces cerevisiae | |
| JP2021514679A (en) | Recombinant oxalate decarboxylase expressed by filamentous fungal host cells | |
| Hull et al. | Co-production of bioethanol and probiotic yeast biomass from agricultural feedstock: application of the rural biorefinery concept | |
| CN111826308B (en) | Marine sediment-derived chitin efficient degrading bacterium and application thereof | |
| CN109055417B (en) | Recombinant microorganism, preparation method thereof and application thereof in production of coenzyme Q10 | |
| CN105462857A (en) | Marasmiellus androsaceus strain and application thereof | |
| CN106893726B (en) | Promoter and recombinant yeast strain | |
| CN110591933B (en) | Engineering strain for producing ethanol and xylitol by fermenting xylose with high efficiency | |
| Azmi et al. | Production of β-carotene from deproteinized waste whey filtrate using Mucor azygosporus MTCC 414 in submerged fermentation | |
| CN104403956B (en) | The structure of xylitol high temperature high-yielding engineering bacterial strain and application | |
| CN113265342A (en) | Production process for breeding high-yield RNA yeast strain by utilizing multiple compound mutagenesis technology | |
| KR20160046337A (en) | Composition of medium for enhancement of growth and biomass of Chlorella vulgaris | |
| CN116286417B (en) | Saccharomyces cerevisiae capable of producing benzyl mercaptan and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |