CN107217058A

CN107217058A - Sesame SiCOL1 and SiCOL2 gene and its application

Info

Publication number: CN107217058A
Application number: CN201710573988.4A
Authority: CN
Inventors: 魏鑫; 周瑢; 张秀荣; 刘盼; 黎冬华
Original assignee: Oil Crops Research Institute of Chinese Academy of Agriculture Sciences
Current assignee: Oil Crops Research Institute of Chinese Academy of Agriculture Sciences
Priority date: 2017-07-14
Filing date: 2017-07-14
Publication date: 2017-09-29
Anticipated expiration: 2037-07-14
Also published as: CN107217058B

Abstract

The invention belongs to genetic engineering field, it is related to sesame SiCOL1 and SiCOL2 gene and its application.Sesame SiCOL1 genes, with the nucleotide sequence or the sequence as shown in SEQ ID No.1 through replacing, lacking or adding the nucleotide sequence with equal function that one or several nucleotides are formed.Sesame SiCOL2 genes, with the nucleotide sequence or the sequence as shown in SEQ ID No.2 through replacing, lacking or adding the nucleotide sequence with equal function that one or several nucleotides are formed.Plant growth period can be changed, promote flowering of plant by being overexpressed SiCOL1 and SiCOL2 genes, available for the flowering asynchronism solved the problems, such as in crossbreeding, various crops, veterinary antibiotics, the breeding time control problem of flowers, photoperiod-sensitive problem and introduce a fine variety problem.

Description

Sesame SiCOL1 and SiCOL2 gene and its application

Technical field

The present invention relates to genetic engineering field, and in particular to two be like sesame flowers genes and its in the plant photoperiod and blooms Application in time adjustment.

Background technology

Sesame (Sesamum indicumL.) is under the jurisdiction of Pedaliaceae flax category, is a kind of ancient oil crops, cultivation is gone through History is more than 5000.At present, be widely distributed in 40 degree of south latitude between 45 degree of north latitude, concentrate on Asia and Africa the torrid zone, Subtropical zone.It is as a kind of nutritious, feature is strong, good health care effect valuable oil plant is loved by people.Sesame Oily unsaturated fatty acid content is up to 85%, the sesamin rich in anti-oxidant, anticancer, reducing blood lipid, is described as " oil plant queen ".Sesame Fiber crops are short-day plant, are bloomed main by Photoperiod, and be like sesame flowers for different regions, and time difference is very big, it may be possible to by Photoperiod effect gene.

Research to plants such as arabidopsis, paddy rice shows that the Photoperiod pathway of flowering of plant is by phytochrome, the rhythm and pace of moving things The gene regulations such as clock, florigen, the variation of one of key gene CONSTANS (abbreviation CO) is to flowering of plant time adjustment It is most important.CO genes are located at the output pathway of biological clock, are the monitoring durations of day between biological clock and flowering time gene Critical elements, it can integrate optical signal and biological clock signal, activate to rhythmicity FLOWERING LOCUS T expression, from And induced flowering.The albumen of CO gene codes is comprising two conservative domains：B-box domains close to aminoterminal are zinc Finger domain and the CCT domains close to c-terminus.The expression of CO genes is regulated and controled by circadian clock.The gene of this in different plant species Copy number is different, and the function between CO genes difference copy has differences.Incomplete statistics, CO genes person from arabidopsis, Clone and obtain in nearly 20 species such as paddy rice, corn and soybean, tomato, grape, but the clone of sesame Photoperiod gene There is not been reported with functional verification.

The content of the invention

It is an object of the invention to provide sesame SiCOL1 and SiCOL2 gene and its application.Two sesames are cloned including (1) Floral genes SiCOL1 and SiCOL2；(2) sequence of gene and its encoding proteins is provided；(3) the two genes are provided in breeding In application, especially regulation the plant photoperiod and flowering time in application.

To achieve the above object of the invention, the technical solution adopted by the present invention is as follows：

The present invention provides a kind of sesame SiCOL1 genes, its have nucleotide sequence as shown in SEQ ID No.1 or The sequence is through replacing, lacking or adding the nucleotide sequence with equal function that one or several nucleotides are formed, Yi Jizhi Numb SiCOL2 genes, it is with the nucleotide sequence or the sequence as shown in SEQ ID No.2 through replacing, lacking or adding one Or the nucleotide sequence with equal function of several nucleotides formation.

The present invention also provides the albumen of above-mentioned sesame SiCOL1 genes and SiCOL2 genes.The albumen of sesame SiCOL1 genes With the amino acid sequence or the sequence as shown in SEQ ID No.3 through replacing, lacking or adding one or several amino acid shapes Into the amino acid sequence with equal function.The albumen of sesame SiCOL2 genes has the amino as shown in SEQ ID No.4 Acid sequence or the sequence are through replacing, lacking or adding one or several amino acids formed amino acid sequences with equal function Row.

SiCOL1 genes and SiCOL2 gene (full name of the present inventionSesamum iNdicum CONSTANS like 1 and 2) It is from the sesame variety " amino acid of two genes being cloned into middle sesame 13 ", SiCOL1 genes and SiCOL2 gene coded proteins Homology between sequence is 70%, and the homology with arabidopsis CO albumen is respectively 57% and 61%.And SiCOL1 and SiCOL2 albumen has identical conserved domain with arabidopsis CO：CCT domains and Zinc finger domain.Wherein, CCT domains It is the distinctive class formation domain of floral genes.It therefore, it can speculate that SiCOL1 and SiCOL2 is similar with arabidopsis CO genes, all have There is the function of Accelerate bloom.In CCT domains, sesame SiCOL1 and SiCOL2 albumen are respectively present five with arabidopsis CO albumen Individual and four amino acid difference；In Zinc finger domain, SiCOL1 albumen has two B-box, and the first of SiCOL2 albumen There is missing in individual B-box.These structures and sequence difference may result in sesame SiCOL1 and SiCOL2, and in regulation and control, be like sesame flowers During function difference.Sesame SiCOL1 and SiCOL2 gene expression quantity highest in the blade in phase and florescence before flowering. Sesame SiCOL1 and SiCOL2 gene, by Photoperiod, are in rhythmic expression under long and short illumination.

The present invention includes nucleotide sequence or the sequence as shown in SEQ ID No.1-2 for being obtained by various methods through replacing Change, lack or add the gene with equal function of one or several nucleotides formation.

Cloning vector containing SiCOL1 or SiCOL2 nucleotide sequences or all kinds of expression vectors, the place containing the carrier Chief cell, transgenic cell line or recombinant bacterium containing the nucleotide sequence.

Applications of the above-mentioned encoding gene SiCOL1 and SiCOL2 in regulation plant photoperiod and flowering time.

SiCOL1 and SiCOL2 gene constructed expression carrier pBI121 are expanded numerous by the present invention in bacillus coli DH 5 alpha. Colored method is dipped in by agriculture bacillus mediated, SiCOL1 the and SiCOL2 genes that pBI121 is carried are transferred to arabidopsis, arabidopsis is obtained Transformed plant.Test result indicates that, plant is to photoperiodic sensitivity and promotes arabidopsis with enhancing by SiCOL1 and SiCOL2 The effect bloomed.

Above-mentioned technical proposal has the following advantages that：

1st, there is provided sesame SiCOL1 and SiCOL2 gene and its coding albumen in itself.

2nd, plant growth period can be changed, promote flowering of plant by being overexpressed SiCOL1 and SiCOL2 genes.Sesame is overexpressed to open Flower gene SiCOL1 and SiCOL2 are obviously promoted plant (arabidopsis) and bloomed, and shorten the time at florescence, reduction in the life period.Thus, SiCOL1 and SiCOL2 have florescence alternation, available for the flowering asynchronism solved the problems, such as in crossbreeding, various crops, vegetables, Fruit, the breeding time control problem of flowers, photoperiod-sensitive problem and introduce a fine variety problem.

Brief description of the drawings

Fig. 1 is the structural analysis of the present invention be like sesame flowers gene SiCOL1 and SiCOL2 encoding proteins；Fig. 1 explanations：" * " generation The amino acid sequence in the table site is completely the same, ":" represent the site amino acid sequence similarity it is higher, " " represents the position The amino acid sequence similarity of point is relatively low；

Fig. 2 is the plant expression vector pBI121 of the embodiment of the present invention 3；

Fig. 3 is clone's intermediate carrier pEASY-T1 of the embodiment of the present invention 4；

Fig. 4 is that be like sesame flowers the gene SiCOL1 of the embodiment of the present invention 5 promotes arabidopsis to bloom figure；

Fig. 5 is that be like sesame flowers the gene SiCOL1 of the embodiment of the present invention 6 promotes arabidopsis to bloom figure；

Fig. 6 is that be like sesame flowers the gene SiCOL1 of the embodiment of the present invention 7 promotes arabidopsis to bloom figure；

Fig. 7 is that be like sesame flowers the gene SiCOL2 of the embodiment of the present invention 8 promotes arabidopsis to bloom figure；

Fig. 8 is that be like sesame flowers the gene SiCOL2 of the embodiment of the present invention 9 promotes arabidopsis to bloom figure；

Fig. 9 is that be like sesame flowers the gene SiCOL2 of the embodiment of the present invention 10 promotes arabidopsis to bloom figure；

Figure 10 is expression of be like sesame flowers the gene SiCOL1 and SiCOL2 of the embodiment of the present invention 11 in sesame different tissues Level；

Figure 11 is sesame blades of be like sesame flowers the gene SiCOL1 and SiCOL2 of the embodiment of the present invention 12 in different times In expression；

Figure 12 is be like sesame flowers expression water of the gene SiCOL1 and SiCOL2 under long and short sunshine of the embodiment of the present invention 13 It is flat.

Embodiment

With reference to the accompanying drawings and examples, the embodiment to the present invention is described in further detail.Implement below Example is used to illustrate the present invention, but is not limited to the scope of the present invention.

Embodiment 1：Be like sesame flowers gene SiCOL1 and SiCOL2 clone

Utilize forward primer CCCGGGATGCTGAAGCTCCA (shown in SEQ ID No.5) and reverse primer GAGCTCTCAGAAGGACGGGA (shown in SEQ ID No.6) and forward primer CCCGGGATGCTGAAAGTCGA (SEQ ID Shown in No.7) and reverse primer GAGCTCTCAGAATGATGGAA (shown in SEQ ID No.8) respectively from sesame variety " middle sesame Cloned in 13 ".

Embodiment 2：The intermediate carrier that be like sesame flowers clones used in gene SiCOL1 and SiCOL2 is pEASY-T1 (see figure 3)。

The PCR primer obtained is expanded from embodiment 1 to be directly cloned on pEASY-T1 according to TA cloning process.Will connection Product converts bacillus coli DH 5 alpha, and expands numerous wherein, and positive colony obtains SiCOL1 and SiCOL2, its base by sequencing screening Because sequence is as shown in SEQ ID No.1 and SEQ ID No.2；By the amino acid sequence such as SEQ ID of the protein of its coding Shown in No.3 and SEQ ID No.4.

Embodiment 3：The structural analysis of be like sesame flowers gene SiCOL1 and SiCOL2 encoding proteins

Homology between the amino acid sequence of be like sesame flowers gene SiCOL1 and SiCOL2 gene coded protein is 70%, with The homology of arabidopsis CO albumen is respectively 57% and 61%.And SiCOL1 and SiCOL2 albumen has identical with arabidopsis CO Conserved domain：CCT domains and Zinc finger domain.Wherein, CCT domains are the distinctive class formation domains of floral genes. It therefore, it can speculate the function that SiCOL1 and SiCOL2 has similar Accelerate bloom with arabidopsis CO genes.In CCT domains In, sesame SiCOL1 and SiCOL2 albumen are respectively present the difference of five and four amino acid with arabidopsis CO albumen；In zinc finger In domain, there is missing in SiCOL2 first B-box, these structures and sequence difference may result in sesame SiCOL1 and Function differences of the SiCOL2 during regulation and control are bloomed.

Embodiment 4：Be like sesame flowers gene SiCOL1 and SiCOL2 plant expression vector

The PBI121 plasmids that be like sesame flowers shown in gene SiCOL1 and SiCOL2 and Fig. 2 are connected using the method for homologous recombination Connect, build the over-express vector of sesame SiCOL1 and SiCOL2 gene.The carrier built is transferred in Agrobacterium, then use is dipped in Flower method imports Agrobacterium in arabidopsis.The mature seed (T0 is for seed) of arabidopsis is collected, by T0 for arabidopsis seed disinfection It is seeded in afterwards on the MS screening and culturing mediums containing kanamycins and screens positive plant.The leaf DNA of positive plant is extracted, is utilized respectively Forward primer CGACACTTGCCGCTCAG (shown in SEQ ID No.9) and reverse primer ACGACGCCCTCCCATT (SEQ ID Shown in No.10) and forward primer ATACAACTGGCTTTCGT (shown in SEQ ID No.11) and reverse primer CCATTGGTGATAGGGA (shown in SEQ ID No.12) carry out transfer-gen plant PCR Molecular Identifications, confirm SiCOL1 and The T1 that SiCOL2 genes have been transferred to is for positive plant.T1 is proceeded into kanamycins screening for seed, positive plant is extracted Leaves genomic DNA enters performing PCR Molecular Identification, determines T2 for positive plant.

Application Example：

Embodiment 5：Be like sesame flowers, and gene SiCOL1 promotes arabidopsis to bloom --- transformation system I

The T2 generations positive transformation of Arabidopsis thaliana plant obtained from embodiment 3 grows with parent (wild type Col-0) in arabidopsis Between in cultivate that (16 hours illumination/8 hour dark photoperiod, light intensity is 120- μm of ol/m together²S), until transgenosis is planted Strain is bloomed.As shown in figure 4, wherein left figure is transfer-gen plant, right figure is control.Fig. 4 shows that be like sesame flowers, and gene SiCOL1 turns Change arabidopsis, cause arabidopsis to strengthen photoperiod-sensitive degree, bloom 1 week in advance.Illustrate that sesame SiCOL1 genes have to bloom Activity, can promote flowering of plant.

Embodiment 6：Be like sesame flowers, and gene SiCOL1 promotes arabidopsis to bloom --- transformation system II

The T2 generations positive transformation of Arabidopsis thaliana plant obtained from embodiment 3 grows with parent (wild type Col-0) in arabidopsis Between in cultivate that (16 hours illumination/8 hour dark photoperiod, light intensity is 120- μm of ol/m together²S), until transgenosis is planted Strain is bloomed.As shown in figure 5, wherein left figure is transfer-gen plant, right figure is control.Fig. 5 shows that be like sesame flowers, and gene SiCOL1 turns Change arabidopsis, cause arabidopsis to strengthen photoperiod-sensitive degree, bloom 1 week in advance.Illustrate that sesame SiCOL1 genes have to bloom Activity, can promote flowering of plant.

Embodiment 7：Be like sesame flowers, and gene SiCOL1 promotes arabidopsis to bloom --- transformation system III

The T2 generations positive transformation of Arabidopsis thaliana plant obtained from embodiment 3 grows with parent (wild type Col-0) in arabidopsis Between in cultivate that (16 hours illumination/8 hour dark photoperiod, light intensity is 120- μm of ol/m together²S), until transgenosis is planted Strain is bloomed.As shown in fig. 6, wherein left figure is transfer-gen plant, right figure is control.Fig. 6 shows that be like sesame flowers, and gene SiCOL1 turns Change arabidopsis, cause arabidopsis to strengthen photoperiod-sensitive degree, bloom 1 week in advance.Illustrate that sesame SiCOL1 genes have to bloom Activity, can promote flowering of plant.

Embodiment 8：Be like sesame flowers, and gene SiCOL2 promotes arabidopsis to bloom --- transformation system I

The T2 generations positive transformation of Arabidopsis thaliana plant obtained from embodiment 3 grows with parent (wild type Col-0) in arabidopsis Between in cultivate that (16 hours illumination/8 hour dark photoperiod, light intensity is 120- μm of ol/m together²S), until transgenosis is planted Strain is bloomed.As shown in fig. 7, wherein left figure is transfer-gen plant, right figure is control.Fig. 7 shows that be like sesame flowers, and gene SiCOL2 turns Change arabidopsis, cause arabidopsis to strengthen photoperiod-sensitive degree, bloom 1 week in advance.Illustrate that sesame SiCOL2 genes have to bloom Activity, can promote flowering of plant.

Embodiment 9：Be like sesame flowers, and gene SiCOL2 promotes arabidopsis to bloom --- transformation system II

The T2 generations positive transformation of Arabidopsis thaliana plant obtained from embodiment 3 grows with parent (wild type Col-0) in arabidopsis Between in cultivate that (16 hours illumination/8 hour dark photoperiod, light intensity is 120- μm of ol/m together²S), until transgenosis is planted Strain is bloomed.As shown in figure 8, wherein left figure is transfer-gen plant, right figure is control.Fig. 8 shows that be like sesame flowers, and gene SiCOL2 turns Change arabidopsis, cause arabidopsis to strengthen photoperiod-sensitive degree, bloom 1 week in advance.Illustrate that sesame SiCOL2 genes have to bloom Activity, can promote flowering of plant.

Embodiment 10：Be like sesame flowers, and gene SiCOL2 promotes arabidopsis to bloom --- transformation system III

The T2 generations positive transformation of Arabidopsis thaliana plant obtained from embodiment 3 grows with parent (wild type Col-0) in arabidopsis Between in cultivate that (16 hours illumination/8 hour dark photoperiod, light intensity is 120- μm of ol/m together²S), until transgenosis is planted Strain is bloomed.As shown in figure 9, wherein left figure is transfer-gen plant, right figure is control.Fig. 9 shows that be like sesame flowers, and gene SiCOL2 turns Change arabidopsis, cause arabidopsis to strengthen photoperiod-sensitive degree, bloom 1 week in advance.Illustrate that sesame SiCOL2 genes have to bloom Activity, can promote flowering of plant.

Embodiment 11：Be like sesame flowers, and gene SiCOL1 and SiCOL2 expression quantity in sesame blade is higher

Using actin7 genes as reference gene, by real-time fluorescence quantitative PCR detection be like sesame flowers gene SiCOL1 and SiCOL2 is in the sesame variety " expression in root, stem, leaf, capsule and the seed of middle sesame 13 ".As shown in Figure 10, SiCOL1 and SiCOL2 high expression in sesame blade.Expand actin7 forward primer and reverse primer sequences be respectively： GGAACCACCACTGAGGACAAT (shown in SEQ ID No.13) and ACAGGAGCTAGAAACAGCAAAGA (SEQ ID No.14 It is shown)；Expand SiCOL1 forward primer and reverse primer sequences be respectively：AAGCAACGACGATAATGGGA(SEQ ID Shown in No.15) and CTGACACGAATTGTAGTAATCAAGG (shown in SEQ ID No.16)；Expand SiCOL2 forward primer It is respectively with reverse primer sequences：CTCCAATCCAGGTGCCGACT (shown in SEQ ID No.17) and AACATCTGCTCCACTTCGACT (shown in SEQ ID No.18).

Embodiment 12：Gene SiCOL1 and SiCOL2 expression quantity highests in the sesame blade before buddingging that be like sesame flowers

Using the primer in embodiment 11, using actin7 genes as reference gene, detected by real-time fluorescence quantitative PCR Be like sesame flowers gene SiCOL1 and SiCOL2 is in sesame variety " expression in the middle different times of sesame 13 " blade, including sowing The sesame plant of 14 days afterwards, 21 days, 28 days, 30 days, 33 days, 36 days, 38 days, 40 days and 50 days.Wherein, 30 days and 40 days difference There is bud and the period bloomed for sesame plant.As shown in figure 11, sesame SiCOL1 and SiCOL2 genes were at after planting 28 days Expression quantity highest, that is, expression quantity highest before buddingging；Show that SiCOL1 and SiCOL2 genes there may be the work(for determining that be like sesame flowers Energy.

Embodiment 13：Be like sesame flowers gene SiCOL1 and SiCOL2 rhythmic expressions under long and short illumination condition

Using the primer in embodiment 11, using actin7 genes as reference gene, detected by real-time fluorescence quantitative PCR Be like sesame flowers gene SiCOL1 and SiCOL2 is in the sesame variety " expression in the middle blade of sesame 13 " under the conditions of long and short photo-irradiation treatment Level.Short photoperiod treatment conditions are to start within after planting 14 days photo-irradiation treatment 9 hours from 8 points to 17 daily, until blooming.Long light It it is after planting 14 days daily 14 hours of photo-irradiation treatment from 5 points to 19 according to treatment conditions.As shown in figure 12, sesame SiCOL1 and SiCOL2 genes are under long and short illumination condition, in 4 expression quantity highests；Sesame SiCOL1 and SiCOL2 gene are in long and short light It is minimum in 0 point and 16 expression quantity respectively according under the conditions of；Show that SiCOL1 and SiCOL2 genes, by Photoperiod, are presented Circadian rhythm is expressed.

Described above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, without departing from the technical principles of the invention, some improvements and modifications can also be made, these improvements and modifications Also protection scope of the present invention should be considered as.

Sequence table

<110>Inst. of Oil Crops, Chinese Academy of Agriculture

<120>SesameSiCOL1WithSiCOL2Gene and its application

<160>8

<170>PatentIn Version 3.5

<210>1

<211>1065

<212>DNA

<213>Sesame (Sesamum indicum L.)

<400>1

atgctgaagc tccaaaacag ccccatgaaa cacggcggcg ccgccaggag cacctggccc 60

cgtggctgcg acacttgccg ctcagctgca tccgccgtct actgccgcac gcacttggcc 120

tacctctgca ccagctgcga tacccgcata cacgccgaca accacttatc tccccgccac 180

gagcgcgtat gggtctgcga ggcctgcgaa agctctcccg cggccctcat atgcaaagcc 240

gattcagctt ccctctgctc cgcctgcgac gccgacatcc actcggccaa ccctctcgcc 300

cgccgccacc accgcgtccc catcctgccg attccaggta ctctctacgg cccctcagcc 360

gccaacgctg acggagtcat agtccgccgg tcgatggatg aagaagctga ggatgaggat 420

gaggatgaag cagcttcatg gctattatac aaccctacaa tcaagaacgg cgatgaagac 480

caaagcaacg acgataatgg gagggcgtcg tttggcggag aggcggatga gtatttagcc 540

cttgattact acaattcgtg tcagaataat cagttcaaca atggatacag tattaatcag 600

cagcaaccat gtcagagttt tcctcaacgt agctactgca gcgacagtgt tgtcccaatc 660

ccacctgcat acagttatcc tgcttcaatt tctcaaactg ttgcgcttcc attaatggat 720

catgtcgggg gggttccgga accagcaaca agtgaagttt cagtctccca aacacgacct 780

ccaaaaggaa ccatcgaact cttctcaggc cctcctgtcc aaattccaac acagctttct 840

ccaacagaca gagaggccag agtgttgaga tatagagaga agaagaagaa ccggaagttt 900

gagaagacaa tcaggtatgc gtcgagaaag gcttatgcag aaaccaggcc gaggatcaaa 960

ggtcgatttg ccaagagatc aggagatgca gaagccgaag tggatcagct gttctctaca 1020

tctctagtaa gcgagagcgc gttcagcgtc gtcccgtcct tctga 1065

<210>2

<211>999

<212>DNA

<213>Sesame (Sesamum indicum L.)

<400>2

atgctgaaag tcgaaaacag cgccggaaac gaccccggag gcgccagata caactggctt 60

tcgtcccgcc gccagccgtt ctggctgtgc gaagcctgtg aacgcgctcc ggcagccttc 120

ctatgcaagg ctgacgccgc gtccctctgt gcggcctgtg attctgatat ccactccgcc 180

aaccctctcg cccgccgcca ccatcgcgta cccattccgc aggttcctaa tacactctac 240

ggcccttctg ctcctggatt aataactggg ccggcggcag gagatgcaga ggaagaattc 300

ttgactcagg aagctgatga gactgttgat ggagaagatg aagatgaagc agcttcatgg 360

ctgctgctga atcctgtcaa gaatggcgac aaccaaagcc atgacaacgg gccgacggca 420

gcgctctttg gtggaacgat ggatgagtat ttggaccttg atgactacaa ttcatgccag 480

aatagtcagt tcaatgagca cttcaccaac cagcagcaac attacagcga cagcgttgtg 540

ccaacacagt accagaaagt aaaggattgt tttcaattgg gcttggagta tgaggtctcc 600

aacactgcat acagctatcc taattcaatg tctcacaatg tttccctatc accaatggat 660

gttggagtag ttccagaatc aacaatgact gaaatttcca tctcccacca acggcccccg 720

aaagggacga tcgatctttt ctcaggccct ccaatccagg tgccgactca gctgactcca 780

atggacagag aagcccgagt tctgaggtac agagagaaga agaagacgag gaagttcgag 840

aagacaataa ggtacgcatc aagaaaagct tatgcagaaa ccagaccccg gatcaaaggt 900

cgattcgcca agagaaaaga tgttggagtc gaagtggagc agatgtttgc tgcacctcta 960

atgggagaaa gtgaatatgg aattgttcca tcattctga 999

<210>3

<211>354

<212>PRT

<213>Sesame (Sesamum indicum L.)

<400>3

Met Leu Lys Leu Gln Asn Ser Pro Met Lys His Gly Gly Ala Ala Arg

1 5 10 15

Ser Thr Trp Pro Arg Gly Cys Asp Thr Cys Arg Ser Ala Ala Ser Ala

20 25 30

Val Tyr Cys Arg Thr His Leu Ala Tyr Leu Cys Thr Ser Cys Asp Thr

35 40 45

Arg Ile His Ala Asp Asn His Leu Ser Pro Arg His Glu Arg Val Trp

50 55 60

Val Cys Glu Ala Cys Glu Ser Ser Pro Ala Ala Leu Ile Cys Lys Ala

65 70 75 80

Asp Ser Ala Ser Leu Cys Ser Ala Cys Asp Ala Asp Ile His Ser Ala

85 90 95

Asn Pro Leu Ala Arg Arg His His Arg Val Pro Ile Leu Pro Ile Pro

100 105 110

Gly Thr Leu Tyr Gly Pro Ser Ala Ala Asn Ala Asp Gly Val Ile Val

115 120 125

Arg Arg Ser Met Asp Glu Glu Ala Glu Asp Glu Asp Glu Asp Glu Ala

130 135 140

Ala Ser Trp Leu Leu Tyr Asn Pro Thr Ile Lys Asn Gly Asp Glu Asp

145 150 155 160

Gln Ser Asn Asp Asp Asn Gly Arg Ala Ser Phe Gly Gly Glu Ala Asp

165 170 175

Glu Tyr Leu Ala Leu Asp Tyr Tyr Asn Ser Cys Gln Asn Asn Gln Phe

180 185 190

Asn Asn Gly Tyr Ser Ile Asn Gln Gln Gln Pro Cys Gln Ser Phe Pro

195 200 205

Gln Arg Ser Tyr Cys Ser Asp Ser Val Val Pro Ile Pro Pro Ala Tyr

210 215 220

Ser Tyr Pro Ala Ser Ile Ser Gln Thr Val Ala Leu Pro Leu Met Asp

225 230 235 240

His Val Gly Gly Val Pro Glu Pro Ala Thr Ser Glu Val Ser Val Ser

245 250 255

Gln Thr Arg Pro Pro Lys Gly Thr Ile Glu Leu Phe Ser Gly Pro Pro

260 265 270

Val Gln Ile Pro Thr Gln Leu Ser Pro Thr Asp Arg Glu Ala Arg Val

275 280 285

Leu Arg Tyr Arg Glu Lys Lys Lys Asn Arg Lys Phe Glu Lys Thr Ile

290 295 300

Arg Tyr Ala Ser Arg Lys Ala Tyr Ala Glu Thr Arg Pro Arg Ile Lys

305 310 315 320

Gly Arg Phe Ala Lys Arg Ser Gly Asp Ala Glu Ala Glu Val Asp Gln

325 330 335

Leu Phe Ser Thr Ser Leu Val Ser Glu Ser Ala Phe Ser Val Val Pro

340 345 350

Ser Phe

<210>4

<211>332

<212>PRT

<213>Sesame (Sesamum indicum L.)

<400>4

Met Leu Lys Val Glu Asn Ser Ala Gly Asn Asp Pro Gly Gly Ala Arg

1 5 10 15

Tyr Asn Trp Leu Ser Ser Arg Arg Gln Pro Phe Trp Leu Cys Glu Ala

20 25 30

Cys Glu Arg Ala Pro Ala Ala Phe Leu Cys Lys Ala Asp Ala Ala Ser

35 40 45

Leu Cys Ala Ala Cys Asp Ser Asp Ile His Ser Ala Asn Pro Leu Ala

50 55 60

Arg Arg His His Arg Val Pro Ile Pro Gln Val Pro Asn Thr Leu Tyr

65 70 75 80

Gly Pro Ser Ala Pro Gly Leu Ile Thr Gly Pro Ala Ala Gly Asp Ala

85 90 95

Glu Glu Glu Phe Leu Thr Gln Glu Ala Asp Glu Thr Val Asp Gly Glu

100 105 110

Asp Glu Asp Glu Ala Ala Ser Trp Leu Leu Leu Asn Pro Val Lys Asn

115 120 125

Gly Asp Asn Gln Ser His Asp Asn Gly Pro Thr Ala Ala Leu Phe Gly

130 135 140

Gly Thr Met Asp Glu Tyr Leu Asp Leu Asp Asp Tyr Asn Ser Cys Gln

145 150 155 160

Asn Ser Gln Phe Asn Glu His Phe Thr Asn Gln Gln Gln His Tyr Ser

165 170 175

Asp Ser Val Val Pro Thr Gln Tyr Gln Lys Val Lys Asp Cys Phe Gln

180 185 190

Leu Gly Leu Glu Tyr Glu Val Ser Asn Thr Ala Tyr Ser Tyr Pro Asn

195 200 205

Ser Met Ser His Asn Val Ser Leu Ser Pro Met Asp Val Gly Val Val

210 215 220

Pro Glu Ser Thr Met Thr Glu Ile Ser Ile Ser His Gln Arg Pro Pro

225 230 235 240

Lys Gly Thr Ile Asp Leu Phe Ser Gly Pro Pro Ile Gln Val Pro Thr

245 250 255

Gln Leu Thr Pro Met Asp Arg Glu Ala Arg Val Leu Arg Tyr Arg Glu

260 265 270

Lys Lys Lys Thr Arg Lys Phe Glu Lys Thr Ile Arg Tyr Ala Ser Arg

275 280 285

Lys Ala Tyr Ala Glu Thr Arg Pro Arg Ile Lys Gly Arg Phe Ala Lys

290 295 300

Arg Lys Asp Val Gly Val Glu Val Glu Gln Met Phe Ala Ala Pro Leu

305 310 315 320

Met Gly Glu Ser Glu Tyr Gly Ile Val Pro Ser Phe

325 330

<210>5

<211>20

<212> DNA

<213>Sesame (Sesamum indicum L.)

<400>5

cccgggatgc tgaagctcca 20

<210>6

<211>20

<212> DNA

<213>Sesame (Sesamum indicum L.)

<400>6

gagctctcag aaggacggga 20

<210>7

<211>20

<212> DNA

<213>Sesame (Sesamum indicum L.)

<400>7

cccgggatgc tgaaagtcga 20

<210>8

<211>20

<212> DNA

<213>Sesame (Sesamum indicum L.)

<400>8

gagctctcag aatgatggaa 20

<210>9

<211>17

<212> DNA

<213>Sesame (Sesamum indicum L.)

<400>9

cgacacttgc cgctcag 17

<210>10

<211>16

<212> DNA

<213>Sesame (Sesamum indicum L.)

<400>10

acgacgccct cccatt 16

<210>11

<211>17

<212> DNA

<213>Sesame (Sesamum indicum L.)

<400>11

Atacaactgg ctttcgt 17

<210>12

<211>16

<212> DNA

<213>Sesame (Sesamum indicum L.)

<400>12

ccattggtga taggga 16

<210>13

<211>21

<212> DNA

<213>Sesame (Sesamum indicum L.)

<400>13

ggaaccacca ctgaggacaa t 21

<210>14

<211>23

<212> DNA

<213>Sesame (Sesamum indicum L.)

<400>14

acaggagcta gaaacagcaa aga 23

<210>15

<211>20

<212> DNA

<213>Sesame (Sesamum indicum L.)

<400>15

aagcaacgac gataatggga 20

<210>16

<211>25

<212> DNA

<213>Sesame (Sesamum indicum L.)

<400>16

ctgacacgaa ttgtagtaat caagg 25

<210>17

<211>20

<212> DNA

<213>Sesame (Sesamum indicum L.)

<400>17

ctccaatcca ggtgccgact 20

<210>18

<211>21

<212> DNA

<213>Sesame (Sesamum indicum L.)

<400>18

aacatctgct ccacttcgac t 21

Claims

1. sesame SiCOL1 genes, it is characterised in that：Passed through with the nucleotide sequence as shown in SEQ ID No.1 or the sequence Replace, lack or add the nucleotide sequence with equal function of one or several nucleotides formation.

2. sesame SiCOL2 genes, it is characterised in that：With the nucleotide sequence or the sequence as shown in SEQ ID No.2 through replacing Change, lack or add the nucleotide sequence with equal function of one or several nucleotides formation.

3. the albumen of the sesame SiCOL1 gene codes described in claim 1, it is characterised in that：With such as SEQ ID No.3 institutes The amino acid sequence shown or the sequence are through replacing, lacking or adding one or several amino acids formed ammonia with equal function Base acid sequence.

4. the albumen of the sesame SiCOL2 gene codes described in claim 2, it is characterised in that：With such as SEQ ID No.4 institutes The amino acid sequence shown or the sequence are through replacing, lacking or adding one or several amino acids formed ammonia with equal function Base acid sequence.

5. cloning vector or all kinds of expression vectors containing the sesame SiCOL1 gene orders described in claim 1, containing described The host cell of carrier, transgenic cell line or recombinant bacterium containing the nucleotide sequence.

6. cloning vector or all kinds of expression vectors containing the sesame SiCOL2 gene orders described in claim 2, containing described The host cell of carrier, transgenic cell line or recombinant bacterium containing the nucleotide sequence.

7. application of the sesame SiCOL1 genes in regulation plant photoperiod and flowering time described in claim 1.

8. application of the sesame SiCOL2 genes in regulation plant photoperiod and flowering time described in claim 2.