CN107190093A - For screening the functional molecular marker of corn evening floral formation and its application under long-day conditions - Google Patents
For screening the functional molecular marker of corn evening floral formation and its application under long-day conditions Download PDFInfo
- Publication number
- CN107190093A CN107190093A CN201710604513.7A CN201710604513A CN107190093A CN 107190093 A CN107190093 A CN 107190093A CN 201710604513 A CN201710604513 A CN 201710604513A CN 107190093 A CN107190093 A CN 107190093A
- Authority
- CN
- China
- Prior art keywords
- corn
- molecular marker
- pzmcol3
- evening
- functional molecular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
For screening the functional molecular marker of corn evening floral formation and its application under long-day conditions, it is related to biological field.Functional molecular marker InDel PZmCOL3 for screening the evening floral formation of corn under long-day conditions, its PCR primer sequence is：Forward primer：5 ' AGCCTAAGCATCTCCAAGGG 3 ', reverse primer：5′‑CGGGTTTGCTCCTTTGTTCG‑3′.The present invention is according to above-mentioned specific difference sequences Design specific function molecular labeling, tropical blood relationship corn material is conducive to introduce Temperate maize material producing region genetic breeding, both the excellent disease-resistant allele for introducing tropical blood relationship corn material is remained, tropical blood relationship corn material is improved again and is bloomed the late shortcoming that can not be applied directly in the production of Temperate maize material.
Description
Technical field
The present invention relates to biological technical field, and in particular to a kind of to be used to screen corn evening floral formation under long-day conditions
Functional molecular marker and its application.
Background technology
Functional label is developed according to the polymorphism motif for causing phenotypic character to make a variation inside functional gene.Once
Hereditary effect is positioned on specific functional motif, and the functional label based on this related sexual development then need not be further
Checking can just determine the presence or absence of target alleles under different genetic background.Upper in application, functional label can be avoided
It is more efficient in the target gene detection of colony due to the selection mistake that restructuring is exchanged and is produced；Due in gene
Portion, directly reflects the performance of objective trait, can accurately detect, track target gene, and its genetic effect value have it is pervasive
Property, and reliability is high, effective to biological engineering colony and natural population, is bloomed the characters such as period regulation using backcross transformation
During transfer, the application of functional label can preferably avoid Linkage drag, so the exploitation of functional label helps to promote breeding
In molecular marker assisted selection application and association analysis in the research based on candidate gene strategy, and be conducive in germplasm
Beneficial gene is excavated in resource.
Corn originates from the torrid areas of Middle and North America, belongs to typical short-day plant.Corn is planted extensively into Temperate Region in China
Plant is the result of domestication.Corn is bloomed by Photoperiod substantially, and tropical and subtropical maize germplasm is introduced a fine variety to temperate zone and planted
Afterwards, occur that florescence postpones mostly, male and female are uncoordinated, the problems such as late-maturing, seriously limit above-mentioned germ plasm resource beautiful in temperate zone
Research application in rice genetic breeding.Influenceed by photoperiod sensitivity, there are different lifes between different corn inbred lines and kind
State area adaptability, many corn varieties can not trans-regional popularizing planting.
The content of the invention
In order to solve spring maize main producing region breeding man prior to seeding unpredictable acquisition corn germ plasm resource in temperate zone length day
Whether can normally be bloomed according to area plantation, can not estimate that suitable intervals carry out florescence in hybridization and backcross transformation
The technical problem of wrong phase, overcome tropical blood relationship corn material bloom it is late can not be applied directly to Temperate maize material production in lack
Point, the present invention provides a kind of for screening the functional molecular marker of corn evening floral formation and its application under long-day conditions.
The present invention is as follows to solve the technical scheme that technical problem is used：
Functional molecular marker InDel-PZmCOL3 for screening corn evening floral formation under long-day conditions, its PCR draw
Thing sequence is：
Forward primer：5 '-AGCCTAAGCATCTCCAAGGG-3 ',
Reverse primer：5′-CGGGTTTGCTCCTTTGTTCG-3′.
As preferred embodiment, functional molecular marker InDel-PZmCOL3 is bloomed period regulation base positioned at corn
Because of ZmCOL3 promoter regions.
As preferred embodiment, the corn florescence controlling gene ZmCOL3 belongs to CCT class transcription factors, is located at
On the chromosome of corn the 5th.
As preferred embodiment, under long-day conditions, the ZmCOL3 of normally bloom corn and late corn of blooming is encoded
There is specific difference sequence, the specific difference sequence and corn flowering time close linkage, institute in gene promoter region
Specific difference sequence is stated positioned at ZmCOL3 encoding gene initiation codons 261~811bp of upstream.
As preferred embodiment, under long-day conditions, in corn of normally blooming, the specific difference sequence such as sequence
SEQ ID NO in list：Shown in 1, evening blooms in corn, the SEQ ID NO in the specific difference sequence such as sequence table：
Shown in 2.
The above-mentioned normal jade of blooming of functional molecular marker InDel-PZmCOL3 differentiations is utilized present invention also offers a kind of
The method of rice and late corn of blooming.
Present invention also offers above-mentioned functional molecular marker InDel-PZmCOL3 corn is bloomed normal and evening blooms
Application in terms of the molecular marker assisted selection breeding of corn variety.
The beneficial effects of the invention are as follows：Under long-day conditions, the ZmCOL3 codings of normally bloom corn and late corn of blooming
There is specific difference sequence, described specific difference sequence and corn flowering time close linkage in gene promoter region,
Described specific difference sequence is located at ZmCOL3 encoding genes initiation codon (ATG) 261~811bp of upstream.Root of the present invention
It is designed for distinguishing normal bloom and late the special of corn that bloom under long-day conditions according to above-mentioned specific difference sequence characteristic
Sexual function molecular labeling, functional molecular marker InDel-PZmCOL3 is conducive to tropical blood relationship corn material to introduce temperate zone
Corn material producing region genetic breeding.Spring maize corn producing region (long-day conditions) genetic breeding is introducing tropical blood relationship corn germplasm
During resource, removed using functional molecular marker InDel-PZmCOL3 is autotelic containing gene evening flower feature base sequence
Row, both remain the excellent disease-resistant allele for introducing tropical blood relationship corn material, tropical blood relationship corn material are improved again and is opened
Spend the late shortcoming that can not be applied directly in the production of Temperate maize material.
The application of the functional molecular marker of the present invention is conducive to temperate zone long-day area, and especially spring maize main producing region is educated
Plant the quick corn germ plasm resource to acquisition of researcher and carry out florescence prediction, for the mistake phase at florescence in hybridization and backcross transformation
With great importance.The tropical blood relationship material of the quick differentiation of breeding man and temperate zone blood relationship material (most of heat are also convenient for simultaneously
Postpone or can not normally bloom to bloom with the resistant good economical character of blood relationship material, but in temperate zone long-day regional representation
Biological characteristics)；The popularization and application of the triage techniques are for accelerating tropical blood relationship corn germ plasm resource in Temperate maize main product
The application speed of area's breeding, improves corn variety eurytopicity, significant.
Brief description of the drawings
Fig. 1 is sequence alignment analysis figure.
The representative Inbred Lines Genotyping figure that Fig. 2 can normally bloom for long-day region.In figure：M：DL2000
Marker；1：Zheng 58；2：7922；3：Hold 351；4：Ji 853；5：Lucky V203；6：B73；7：PH6WC；8：Four -144；9：Four-
287；10：PH4CV；11：Lucky A001；12：A6203；13：Prosperous 7-2；14：A188；15：8902；16：Mo17；17：H99；18：Wise man
461；19：Pellet 598；20：Method A.
Fig. 3 is the commercially available commercial hybrids kind Genotyping figure in long-day region.In figure：M：DL2000 Marker；1：It is first beautiful
335；2：First jade 696；3：DK516；4：DK517；5：Zheng Dan 958；6：Lucky single 27；7：Lucky single 519；8：Dolantin is sub- No. 1；9：Dolantin
It is sub- No. 2；10：Dolantin is sub- No. 3.
Fig. 4 is the representative self-mating system Genotyping figure in southwest and Yunnan Province.In figure：M：DL2000 Marker；1：Into certainly
273；2：06S282；3：It is empty；4：HF05-1；5：K959；6：WY8-1-2；7：Q319；8：C128；9：C08；10：Hand over 51；11：
FS08H；12：T497-2；13：It is empty；14：HWZ03；15：C319.
Embodiment
The a kind of of the present invention is used to screen the functional molecular marker InDel- of corn evening floral formation under long-day conditions
PZmCOL3, its PCR primer sequence is：
Forward primer (INDEL-F)：5 '-AGCCTAAGCATCTCCAAGGG-3 ',
Reverse primer (INDEL-R)：5′-CGGGTTTGCTCCTTTGTTCG-3′.
Corn florescence controlling gene ZmCOL3 belongs to CCT class transcription factors, on the chromosome of corn the 5th.The present invention
Functional molecular marker InDel-PZmCOL3 be located at corn florescence controlling gene ZmCOL3 promoter regions.
Under long-day conditions, there is spy in the ZmCOL3 encoding gene promoters region of normally bloom corn and late corn of blooming
Different in nature diversity sequence, described specific difference sequence and corn flowering time close linkage, described specific difference sequence
Positioned at ZmCOL3 encoding genes initiation codon (ATG) 261~811bp of upstream.
Under long-day conditions, in corn of normally blooming, the SEQ ID in described specific difference sequence such as sequence table
NO：Shown in 1, evening is bloomed in corn, and described specific difference sequence is replaced by a length for 217bp base sequence, such as
SEQ ID NO in sequence table：Shown in 2.
The present invention also provides a kind of distinguished using above-mentioned functional molecular marker InDel-PZmCOL3 and normally bloomed jade
The method of rice and late corn of blooming.
The functional molecular marker InDel-PZmCOL3 of the present invention can also be applied to normal bloom corn and evening blooms jade
In terms of the molecular marker assisted selection breeding of rice new varieties.Control corn florescence specific transcription factor ZmCOL3 functional moleculars
The exploitation of mark, it will help accelerate application of the tropical blood relationship corn germ plasm resource in Temperate maize genetic breeding.
In the present invention, corn hybrid seed material of normally blooming refers under long-day conditions, florescence be not later than or close to
The corn inbred line in Jilin Province's regional testing Reference cultivars first jade florescence of 335, Zheng Dan 958 or cenospecies.Evening corn of blooming is miscellaneous
Hand over kind of a material to refer to relative Reference cultivars flowering time to postpone more than 7 days, the corn material do not bloomed even.Selfing based material is with state
Border sequencing kind B73 florescence is reference.
The corn florescence controlling gene ZmCOL3 promoter poor specificities of embodiment 1 are heterotactic to be obtained
1st, experiment material
Normal corn inbred line of blooming under long-day conditions：B73；
Long-day conditions lower evening blooms corn inbred line：CML432.
2nd, the extraction of genomic DNA
Maize at Seedling Stage takes blade, aligns normally opened colored corn inbred line B73 and evening corn inbred line CML432 of blooming is adopted respectively
Genomic DNA is extracted with CTAB methods.
Comprise the following steps that：Under the conditions of liquid nitrogen, maize leaf about 0.5~1g is pulverized rapidly last be transferred to
In 2ml centrifuge tubes, and the μ L of CTAB buffer solutions about 800 of 65 DEG C of preheatings are added, fully mixed；Centrifuge tube is placed in 65 DEG C of water-baths
15min, then takes out to add 10 μ L RNAase (RNase, concentration is 10mg/ml), continues 1~1.5h of water-bath, during water-bath
It is gentle to mix several times；In the mixing liquid of taking-up centrifuge tube, the isometric chloroform of often pipe addition and isoamyl alcohol, the mixed solution,
The volume ratio of chloroform and isoamyl alcohol is V:V=24:1, it is gentle to mix after 30min, in 8000rpm, centrifugation 20min；Draw
Supernatant is moved into another centrifuge tube, the mixing liquid of the isometric chloroform of often pipe addition and isoamyl alcohol, in the mixed solution, chlorine
The imitative volume ratio with isoamyl alcohol is V:V=24:1, in 8000rpm, centrifugation 20min (in order to prevent from being drawn onto two layers after mixing
Albumen between liquid, it should be noted that sucting can not grasp too much clearly, draws 2/3 volume of supernatant, it is proposed that with having cut pipe
The pipette tips of mouth, if it is necessary, this step can be repeated once)；Supernatant is moved into another 1.5ml centrifuge tubes, the body such as addition
The pre-cooled isopropanol of product, is gently mixed, and 20~30min is stood under the conditions of -20 DEG C, is then drawn with the pipette tips for cutting off the mouth of pipe
DNA floccules, soaking 2h with 70% ethanol (can be changed without centrifuge tube, draw after DNA floccules, by the liquid in centrifuge tube
Outwell)；With 70% alcohol flushing 2~3 times, micro centrifuge brief centrifugation 10 seconds removes 70% ethanol and dried；Add
100~200 μ L l × TE, 56 DEG C of dissolving DNAs half a day (specific dissolution time depends on the circumstances)；With the DNA of NaNoDrop 2000
Concentration mensuration instrument detects DNA concentration and purity, and takes a small amount of sample to pass through 0.8% Agarose gel electrophoresis measure DNA matter
Amount.
3rd, PCR sequencings and sequencing analysis
Corn inbred line B73 is bloomed with normal under long-day conditions and long-day conditions lower evening blooms corn inbred line
CML432 genome nucleotide sequences (MaizeGDB accession number:GRMZM2G021777) it is template, designs primer, PCR amplifications is beautiful
Rice self-mating system B73 and corn inbred line CML432 genomic DNA fragment.
Primer is designed using software Primer5.0, synthesized by Sangon Biotech (Shanghai) Co., Ltd., with sterilizing
ddH2O is diluted to 10 μm of ol/L, and -20 DEG C save backup.
(1) primer sequence is as follows：
A-551- type promoters primer sequences：
F：AGCCGAGTGTTTGGTACGAATGGTT；
R：GTTGGTGCGTGTCCGCCGTG.
P-217- type promoters primer sequences：
F：GCTGATGTGTTTGGTACGGGTGG；
R：CCGGGCGGACTGGGTTGC.
(3) PCR amplification system (20 μ L systems) is as follows：
(4) PCR amplification programs are as follows：
Amplified production is detected with 1% agarose gel electrophoresis, with being had after DNA Purification Kits by Shanghai bioengineering
Limit company is sequenced.
Found by sequence alignment analysis, under long-day conditions it is normal bloom corn inbred line B73 and evening bloom corn from
Friendship is that corn C ML432 ZmCOL3 encoding gene promoters region has specific sequence difference, as shown in Figure 1.Described opens
Mover specific difference sequence is located at gene initiation codon (ATG) 261~811bp of upstream.Under long-day conditions, normally bloom
In corn inbred line B73, the SEQ ID NO in described specific difference sequence such as sequence table：Shown in 1, evening blooms corn certainly
During friendship is corn C ML432, described specific difference sequence is replaced by a length for 217bp base sequence, such as sequence table
In SEQ ID NO：Shown in 2.
Embodiment 2 is a kind of to be used to screen the functional molecular marker InDel- of corn evening floral formation under long-day conditions
PZmCOL3 exploitation and its genotyping to the torrid zone and temperate zone blood relationship corn
1st, primer is designed
The sequence of deleted segment both sides in normal corn inbred line B73 of blooming ZmCOL3 genes is chosen, according to its missing
Base sequence information in the range of 300~500bp of section position both sides, designs primer, primer is by giving birth to using software Primer5.0
Work bioengineering (Shanghai) limited company synthesizes, with sterilizing ddH2O is diluted to 10 μm of ol/L, and -20 DEG C save backup.
Primer sequence is as follows：
Forward primer (INDEL-F)：5′-AGCCTAAGCATCTCCAAGGG-3′(SEQ ID NO：3),
Reverse primer (INDEL-R)：5′-CGGGTTTGCTCCTTTGTTCG-3′(SEQ ID NO：4).
2nd, experiment material and its florescence investigation
317 parts of association analysis genetic groups, for carrying out Genotyping and the test of florescence phenotype.
It is sequenced and is found by PCR, wherein 210 parts of materials are A-551- types, 107 parts of materials is P-217- types.A-
551- type promoters and corn florescence close linkage under Jilin Province, the long-day conditions of Beijing two.
Table 1 is the significance analysis between the two types promoter difference and florescence difference of SNP marker.p-value<
0.05 represents significant difference (0.0161,0.0332,0.0260,0.0289), pvalue<0.01 represents pole significant difference
(0.0094、0.0016)。
Table 1
| 551/217 | DT | DA | DS |
| 2014JL | 0.0161 | 0.0094 | 0.0332 |
| 2012BJ | 0.0260 | 0.0289 | 0.0016 |
Embodiment 3 carries out genotyping for colony to F2 using functional molecular marker InDel-PZmCOL3 and bloomed
Phase trait associations are analyzed
In order to further clear and definite P-217- types and A-551- types whether in genetic group it is close with corn florescence
It is chain, utilize tropical blood relationship corn material CML189 (P-217- types) and temperate zone blood relationship corn material Mo17 (A-551- types)
After being hybridized, F2 is built for genetic group；Hubei, Hainan and three kinds of Jilin different ecological region are planted in respectively, and are carried out
Take out the florescence correlated traits investigation such as male, spinning and loose powder.
Genotype has been carried out for more than 1000 individual plant of genetic group to F2 using functional molecular marker InDel-PZmCOL3
Analysis.Research finds the A-551- types of the P-217- types, the A-551/P-217- types of heterozygosis and homozygosis of homozygosis, heredity point
From than being about 1:2:1.Association analysis result shows P-217- type promoters and evening under Jilin Province and mayor of Beijing sunshine condition
Character of blooming close linkage.(Jilin Province area) functional molecular marker InDel-PZmCOL3 can be notable under long-day conditions
Distinguish corn and take out the characters of blooming, P values such as male, spinning and loose powder<0.01, and it is not notable under the conditions of short-day.Table 2 be three not
With genotype and phenotypic analysis of the place F2 for genetic group.
Table 2
The functional molecular marker InDel-PZmCOL3 of embodiment 4 to southwest, Huang-Huai-Hai and Spring Corn Area of Northeast of China domain corn from
Hand over the genotype detection of system and cenospecies
Using marker gene type analysis of the functional molecular marker InDel-PZmCOL3 to corn, 2 kinds of banding patterns are amplified,
Late flowering corn is a kind of banding pattern (P-217- types, size 363bp), and the corn normally bloomed is another banding pattern (A-
551- types, size 697bp).
Using functional molecular marker InDel-PZmCOL3 to northeast spring maize producing region and Huang-Huai-Hai corn producing region (temperate zone,
Long-day region) representative Inbred Lines Zheng 58, prosperous 7-2, PH6WC, PH4CV, four -287, four -144, A6202, wise man 461,
B73, Mo17, the lucky corn inbred lines such as 853 carry out all A-551- type genes types (stripe size about 700bp) of detection, such as
Shown in Fig. 2.
Using functional molecular marker InDel-PZmCOL3 to northeast spring maize and the Yellow River and Huai He River sea region (temperate zone, the long-day area
Domain) representativeness cenospecies Zheng Dan 958, first jade 335, first jade 696, enlightening card 516, enlightening card 517, dolantin Asia 1, dolantin sub- No. 2, moral
U.S. sub- No. 3 are waited corn inbred line to carry out all A-551- type genes types (stripe size about 700bp) of detection, as shown in Figure 3.
The representative selfing in southwest and Yunnan Province is tied to form from 273 using functional molecular marker InDel-PZmCOL3,
698-3, HF05-1, K959, WY8-1-2, hand over the 51, corn inbred line such as C319, Q319 to be detected, wherein friendship 51, C319,
This 3 corn inbred lines of Q319 show as florescence in Jilin Province and seriously postponed, and PCR augmentation detection stripe sizes are about 350bp,
P-217- types are accredited as, are prolonged except above-mentioned 3 corn inbred lines others do not show the serious florescence in Jilin Province
Late, can be normally solid, PCR augmentation detection stripe sizes are about 700bp, are accredited as A-551- types, as shown in Figure 4.
The studies above result explanation：Under long-day conditions P-217- types of molecules labeled as evening bloom corn institute it is peculiar, and
A-551- types of molecules is peculiar labeled as normal corn institute of blooming.Can be very using functional molecular marker InDel-PZmCOL3
It is well normally to bloom under long-day conditions by electrophoretic band size discrimination corn material, or late blooming.The function
Property molecular labeling InDel-PZmCOL3 application be conducive to carrying out temperate zone introducing tropical blood relationship corn germ plasm resource genetic background
When in maize genetic breeding, the purposeful gene loci for removing late blooming introduces the excellent disease-resistant of tropical blood relationship having ensured
Allele improve simultaneously, again tropical blood relationship corn bloom it is late can not be applied directly to Temperate maize production shortcoming, accelerate
Application in Maize Production.
Described above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, under the premise without departing from the principles of the invention, some improvements and modifications can also be made, these improvements and modifications also should
It is considered as protection scope of the present invention.
SEQUENCE LISTING
<110>Jilin Academy of Agricultural Science
<120>For screening the functional molecular marker of corn evening floral formation and its application under long-day conditions
<160>4
<210>1
<211>551
<212>DNA
<213>Manually
<400>1
GGCTAGCTCCAACAAGGAGCTCTAAAGGGTCCTACACCCTAAATTTAGAGGATAAAGACA 60
TCCTCTACTCCCTCCAGCAGCGTCCTCTAAACGGTTCTCTAAATTTAGAGGACGTTGCTG 120
GATCCTCTATATATAGAGTTTCTCTAAACGGTTCTCTATCCATTTAAATACTTTAAACAA 180
CCGGTTTAGTAAAACTAAAATATGTACAATACATTCGAGAGTATGACAAATACGTATGTA 240
CAAAAAATTAAAAATAAAAAATGTCTTTAATATATGTATTTGCATATAGAGGACGTGATT 300
TAGAGGACGTTGTTGGAGAGGAAGGAGATATAGAGGATGAAATCTTTTAGAGAAGACTGT 360
AAAGGACGGATATAGAGGATGTTGCTGGAGACAGTCTACTCTATATGTAGCATCTCACTT 420
CAACAAACTTCTATCTAGTTTGGCTCTAGTGAGAGAGCTATTTTAGATACTCCAATAGCT 480
TGACAAGTTAGATAAATAGTCTGTTAAAGAATTATTTTGATGTTGAATGACTAAATAACT 540
AGTCTATGGGA 551
<210>2
<211>217
<212>DNA
<213>Manually
<400>2
ATATTATATATGTAGCATCTCACTCTAACAAACTATCTATATAGTTTGGCTAGTCAGGAT 60
AACTATGTAAGTTTCGTTAGTGAGAGAGCTAATTTAGATACTCAAATAGCTTGATGAGTT 120
AGATAACTAATCTATTAAAGAATTTATTTTTTTATTGAATAGCTAAAATTTAGCTTTACG 180
AGTCGTTTACCTCGCCTTTCGGAGATGGTACAAGTAC 217
<210>3
<211>20
<212>DNA
<213>Manually
<400>3
INDEL-F：5′-AGCCTAAGCATCTCCAAGGG-3′
<210>4
<211>20
<212>DNA
<213>Manually
<400>4
INDEL-R：5′-CGGGTTTGCTCCTTTGTTCG-3′
Claims (7)
1. the functional molecular marker InDel-PZmCOL3 for screening corn evening floral formation under long-day conditions, its feature exists
In its PCR primer sequence is：
Forward primer：5 '-AGCCTAAGCATCTCCAAGGG-3 ',
Reverse primer：5′-CGGGTTTGCTCCTTTGTTCG-3′.
2. a kind of functional molecular marker InDel-PZmCOL3 according to claim 1, it is characterised in that the feature
Molecular labeling InDel-PZmCOL3 is located at corn florescence controlling gene ZmCOL3 promoter regions.
3. a kind of functional molecular marker InDel-PZmCOL3 according to claim 1, it is characterised in that the corn
Florescence controlling gene ZmCOL3 belongs to CCT class transcription factors, on the chromosome of corn the 5th.
4. a kind of functional molecular marker InDel-PZmCOL3 according to claim 1, it is characterised in that long-day bar
Under part, there is specific difference sequence, institute in the ZmCOL3 encoding gene promoters region of normally bloom corn and late corn of blooming
Specific difference sequence and corn flowering time close linkage are stated, the specific difference sequence is located at ZmCOL3 encoding genes and risen
Beginning password 261~811bp of upstream.
5. a kind of functional molecular marker InDel-PZmCOL3 according to claim 4, it is characterised in that long-day bar
Under part, in corn of normally blooming, the SEQ ID NO in the specific difference sequence such as sequence table：Shown in 1, evening blooms corn
In, the SEQ ID NO in the specific difference sequence such as sequence table：Shown in 2.
6. the functional molecular marker InDel-PZmCOL3 in a kind of utilization claim 1 to 5 described in any one distinguishes normal
Bloom corn and evening blooms the method for corn.
7. functional molecular marker InDel-PZmCOL3 in claim 1 to 5 described in any one it is normal bloom corn and
Evening bloom corn variety molecular marker assisted selection breeding in terms of application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710604513.7A CN107190093B (en) | 2017-07-24 | 2017-07-24 | Functional molecular marker for screening late flowering characteristics of corn under long-day conditions and application of functional molecular marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710604513.7A CN107190093B (en) | 2017-07-24 | 2017-07-24 | Functional molecular marker for screening late flowering characteristics of corn under long-day conditions and application of functional molecular marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107190093A true CN107190093A (en) | 2017-09-22 |
| CN107190093B CN107190093B (en) | 2020-08-25 |
Family
ID=59883946
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710604513.7A Active CN107190093B (en) | 2017-07-24 | 2017-07-24 | Functional molecular marker for screening late flowering characteristics of corn under long-day conditions and application of functional molecular marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107190093B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109929842A (en) * | 2019-02-28 | 2019-06-25 | 吉林省农业科学院 | Corn floral genes ZmCol3 promoter ZmCOL3pro217And its application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004005555A1 (en) * | 2002-07-02 | 2004-01-15 | The Australian National University | Method of producing plants having enhanced transpiration efficiency and plants produced therefrom |
| CN103305507A (en) * | 2013-05-29 | 2013-09-18 | 四川农业大学 | Corn photoperiod gene specific molecular marker and application thereof |
| CN104004759A (en) * | 2014-06-10 | 2014-08-27 | 河南科技大学 | Molecular marker of maize photoperiod sensibility candidate gene zmCCA1 and application thereof |
-
2017
- 2017-07-24 CN CN201710604513.7A patent/CN107190093B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004005555A1 (en) * | 2002-07-02 | 2004-01-15 | The Australian National University | Method of producing plants having enhanced transpiration efficiency and plants produced therefrom |
| CN103305507A (en) * | 2013-05-29 | 2013-09-18 | 四川农业大学 | Corn photoperiod gene specific molecular marker and application thereof |
| CN104004759A (en) * | 2014-06-10 | 2014-08-27 | 河南科技大学 | Molecular marker of maize photoperiod sensibility candidate gene zmCCA1 and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| QIN YANG ET AL.: "CACTA-like transposable element in ZmCCT attenuated photoperiod sensitivity and accelerated the postdomestication spread of maize", 《PNAS》 * |
| SODERLUND C ET AL.: "Zea mays CONSTANS-like protein CO5 (LOC100281289), mRNA", 《GENBANK》 * |
| YAN L ET AL.: "Zea mays BAC clone CH201-52A17 from chromosome 5, complete sequence", 《GENBANK》 * |
| 杨爽: "玉米光周期敏感相关基因ZmCOL的克隆及功能验证", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109929842A (en) * | 2019-02-28 | 2019-06-25 | 吉林省农业科学院 | Corn floral genes ZmCol3 promoter ZmCOL3pro217And its application |
| CN109929842B (en) * | 2019-02-28 | 2021-04-20 | 吉林省农业科学院 | Maize flowering gene ZmCo 3 promoter ZmCOL3pro217And uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107190093B (en) | 2020-08-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103320437B (en) | Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof | |
| CN103305510B (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| CN105063033B (en) | A kind of molecular labeling of Brassica Napus knee ospc gene and its application in anti-clubroot breeding | |
| CN102154281B (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| CN108411027A (en) | It is a kind of detection capsicum CMS fertility restorer genes CAPS molecular labeling primers and application | |
| CN110512025A (en) | A kind of molecular labeling and its application with powdery mildew resistance gene in wheat PmJM23 close linkage | |
| CN110205329B (en) | Saccharum cutting secret specific sequence and identification method thereof | |
| CN105176978B (en) | Tomato yellow leaf curl disease-resistant gene ty 5 molecular labeling primer and its application | |
| CN112011637B (en) | Molecular marker closely linked with wheat powdery mildew resistance gene Pm68 and application thereof | |
| CN114015796A (en) | Molecular marker closely linked with control of light white peel of American pumpkin, primer and application | |
| Mammadov et al. | Molecular mapping of leaf rust resistance gene Rph5 in barley | |
| CN103740817B (en) | Method for identifying male sterile cytoplasm based on kenaf atp8 gene | |
| CN110551843B (en) | Codominant marking primer capable of distinguishing tobacco spot wilt-resistant locus RTSW homozygous heterozygous genotype, distinguishing method and application thereof | |
| CN107190093A (en) | For screening the functional molecular marker of corn evening floral formation and its application under long-day conditions | |
| CN102690812A (en) | Molecular marker SIsv0067 closely linked with Setaria italica L. Beauv. heading stage gene | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| CN108546775A (en) | The InDel labels and its detection primer of a kind of Chinese cabbage burr and application | |
| CN112575101B (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
| CN104450900B (en) | For the primer for the molecular labeling for aiding in identification soybean M type cytoplasmic male sterility restoring gene Rf m1 | |
| CN107460246A (en) | A kind of method of fast positioning peach target gene | |
| US20240090396A1 (en) | Clubroot resistance in brassica | |
| CN114410821A (en) | InDel molecular marker for identifying amaranth leaf color character and application thereof | |
| CN110106270B (en) | Molecular marker coseparated from melon yellow seed coat and application thereof | |
| CN113881801A (en) | Molecular marker composition with tightly linked dark green stem characters of American pumpkin and application thereof | |
| CN102690818A (en) | Molecular marker SIsv0832 closely linked with Setaria italica L. Beauv. heading stage gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |