CN107190077A - Urine miRNAs biomarkers and its screening technique and application - Google Patents
Urine miRNAs biomarkers and its screening technique and application Download PDFInfo
- Publication number
- CN107190077A CN107190077A CN201710521228.9A CN201710521228A CN107190077A CN 107190077 A CN107190077 A CN 107190077A CN 201710521228 A CN201710521228 A CN 201710521228A CN 107190077 A CN107190077 A CN 107190077A
- Authority
- CN
- China
- Prior art keywords
- mirnas
- urine
- liver cancer
- mir
- screening
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The present invention relates to biomedicine field, urine miRNAs biomarkers and its application in the discovery of diagnosing cancer of liver mark are disclosed.Its screening technique methods described comprises the following steps：1) total serum IgE including miRNAs is extracted from urine；2) the miRNAs express spectras of healthier person and liver cancer patient, find out the miRNAs of unconventionality expression in Urine of Patients With Primary Hepatocellular；3) real-time quantitative RT PCR methods are used, verify that screening can be used as the miRNAs of liver cancer marker through small sample primary dcreening operation and enlarged sample；4) ROC curve carries out correlation analysis.Compared with healthy person, the 5p of miR 6798 are in Urine of Patients With Primary Hepatocellular in high expression.The present invention establishes the screening technique of urine miRNAs biomarkers, and find urine miRNAs can as liver cancer patient auxiliary diagnosis, sample is easy to get, collects easy, noninvasive, with important academic significance and wide application prospect.
Description
Technical field
The invention belongs to biomedical sector, it is related to the screening technique of urine miRNAs biomarkers and its in liver cancer
Application in diagnosis marker discovery.
Background technology
Primary hepatocyte hepatocarcinoma (hepatocellular carcinoma, HCC) is clinically most common pernicious swollen
One of knurl, is respectively the 7th and the 5th in global Cancer Mortality and the death rate, the Ministry of Public Health of China statistics draws liver
Mortality of carcinoma accounts for the second of tumor mortality rate.In the treatment of liver cancer, early operation excision is presently preferred, most effective
Treatment method, and early diagnose and early treatment, be improve curative effect key.But in view of the concealment of liver cancer onset, pernicious journey
Degree is high, and progress is rapid, and only 10-20% is adapted to operative treatment.Therefore, early diagnosis to improve liver cancer patient survival rate and
Improve liver cancer patient prognosis most important.
MiRNAs is an important regulation molecule in modern biomedical, and it passes through the tune to gene transcript expression
Control, regulates and controls the various functions of all cells of human body, tissue and organ, has very in the generation and preventing and treating of human diseases
Important effect.Existing numerous studies find that miRNAs can extensively and stably be present in extracellular fluid, including serum, blood
Among slurry, urine and interstitial fluid.They are not only the regulation molecule of genes within cells transcript and expression, or between cell
The signaling molecule of information transmission.In pathologic process, changing for characteristic can occur for serum/plasma/urine miRNAs express spectras
Become, these changes help to diagnose disease and Index for diagnosis, in addition it is closely related with clinical stages classification.And circulation
With marks of the miRNAs in urine as disease diagnosis and prognosis, small, stability is good, sensitivity is high etc. is damaged with detection
Plurality of advantages.
Under normal functional state, miRNAs species and its gene expression abundance is likely to be in body interior circulation and urine
One state that is relatively stable, balancing.When body is in lysis, show as under abnormal metabolism or particular disease states
Some circulations/urine miRNAs expression conspicuousness is raised and lowered.This research is using liver cancer patient as research object, inspection
MiRNAs express spectra and the miRNAs of characteristic in Urine of Patients With Primary Hepatocellular are measured, auxiliary diagnosis and disease for enriching liver cancer
Reason mechanism etc., with important academic significance and application prospect.
The content of the invention
The present invention is intended to provide a kind of screening technique of urine miRNAs biomarkers.
Urine miRNAs is also applied to the auxiliary diagnosis mark of liver cancer by the present invention.
Technical scheme is that the screening technique of urine miRNAs biomarkers comprises the following steps：
1) urine of collection healthy person and liver cancer patient, extracts total serum IgE；
2) primary dcreening operation：Detect that miRNAs is expressed in healthy person and the clinical urine specimen of liver cancer patient, healthier person and liver cancer
The miRNAs express spectras of patient, find out the miRNAs of unconventionality expression in Urine of Patients With Primary Hepatocellular as candidate；
3) secondary screening：Using real-time quantitative RT-PCR technology, the content of candidate miRNAs in urine sample is determined, is carried out respectively small
Sample and/or enlarged sample screening, screening and determination can be used as the miRNAs of liver cancer marker；
4) determine step 3 with ROC curve method) screening liver cancer marker miRNAs.
Step 2) in, miRNAs expression is detected with miRNAs chip of expression spectrum；Changed using the T P values examined and multiple
Value carries out difference miRNA screenings, and the standard of screening is fold differences changing value >=2 and P value≤0.05.
Step 3) in, the standard of selection is fold differences changing value >=2, and P value≤0.05.
Step 3) in, described quantitative RT-PCR technology is used in combination using stem ring primer reverse transcription method special miRNA
SYBR Green qPCR detection methods are detected.
By the above method, step 2) discovery of primary dcreening operation result, there are 13 miRNAs expression in up-regulation： miR-125b-2-
3p、miR-139-3p、miR-1587、miR-205-5p、miR-422a、miR-3154、 miR-3615、miR-3659、miR-
422a、miR-4535、miR-4651、miR-6798-5p、miR-6799-5p、 miR-6880-5p。
Step 3) in, choose miR-205-5p, miR-422a, miR-6798-5p and miR-6799-5p real-time quantitative
RT-PCR method carries out small sample secondary screening, and screening obtains miR-6798 and is enlarged screening sample.
With ROC curve method (receiver operator characteristics' curve, Receiver Operator Characteristic
Curve, abbreviation ROC curve) miR-6798-5p is assessed as the clinical value of liver cancer marker, as a result show, urine miR-
The TG-AUC (area under the curve, AUC) that 6798-5p carries out diagnosing cancer of liver is 0.83, is worked well.
As can be seen here, miR-6798-5p high expression in Urine of Patients With Primary Hepatocellular, can be examined as auxiliary in urine specimen
The biomarker of disconnected liver cancer, may also be used for the medicine of screening treatment liver cancer.
MiR-6798-5p detection primers and reverse transcriptase primer, can be used to detect the table of miR-6798-5p in urine specimen
Up to amount, so that reagent, kit or biochip for preparing diagnosis or auxiliary diagnosis liver cancer, or for screening treatment
Reagent, kit or the biochip of liver-cancer medicine.
Another of the invention technical scheme is：A kind of kit or biochip, are included in Urine of Patients With Primary Hepatocellular and express
Abnormal miRNA qPCR reverse transcriptase primers and forward detection primer, for detecting the abnormal expression in Urine of Patients With Primary Hepatocellular
MiRNA and its expression quantity, can be used to diagnosing liver cancer or auxiliary diagnosing cancer of liver, may also be used for screening or assisting sifting treatment
The medicine of liver cancer.
It is preferred that, the kit or biochip of the detection liver cancer include miR-6798-5p qPCR transcription primers
And forward detection primer.
It is preferred that, the kit or biochip of the detection liver cancer, the reverse transcriptase primer of the miR-6798-5p
Sequence includes the sequence described in SEQ ID No.1：
CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCCCAAGCT；
Described forward detection primer sequence includes the sequence described in SEQ ID No.2：
ACACTCCAGCTGGGCCAGGGGGATGGGCGA。
It is furthermore preferred that the sequence of the reverse transcriptase primer of the miR-6798-5p is as shown in SEQ ID No.1：
CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCCCAAGCT；
Described positive sequencing primer sequence is as shown in SEQ ID No.2：
ACACTCCAGCTGGGCCAGGGGGATGGGCGA。
Also include general inverse detection primer in kit or biochip, its sequence is： TGGTGTCGTGGAGTCG.
As can be seen here, miR-6798-5p high expression in Urine of Patients With Primary Hepatocellular, can as assisting sifting liver cancer life
Thing mark.It may also be used for the medicine of screening treatment liver cancer.
Kit or biochip containing miR-6798-5p detection primers and reverse transcriptase primer, can be used to detect urine
MiR-6798-5p expression quantity in sample, thus for prepare diagnosing liver cancer or screening treatment liver-cancer medicine kit or
Biochip.
The beneficial effects of the present invention are：
1. establishing the screening technique of urine miRNAs biomarkers, and find to be compared with healthy person, liver cancer patient urine
In liquid there is unconventionality expression in miRNAs；Urine miRNAs can be as diagnosing cancer of liver mark, and the auxiliary available for liver cancer patient is examined
It is disconnected, pathomechanism of auxiliary diagnosis and abundant liver cancer for liver cancer etc., with important academic significance and application prospect；
2.miR-6798-5p is in Urine of Patients With Primary Hepatocellular in high expression, it may be possible to the miRNAs of liver cancer patient characteristic points
Son；It using miR-6798-5p as the liver cancer biomarkers in urine, can quickly and easily detect, patient will not be made
Into wound, miR-6798-5p can be used for the mark of diagnosis and the medicine of screening treatment liver cancer；
3. the present invention is using urine as sample, biological specimen is easy to get, and easy, noninvasive, quantity is collected greatly, by detecting disease
Mark miRNAs can be carried out diagnosis or auxiliary diagnosis, and miRNAs has wide application as disease biomarker
Prospect.
Brief description of the drawings
Fig. 1 is the flow chart of screening technique of the present invention；
Fig. 2 is healthy person (Ctrls) and liver cancer (HCC) Urine in Patients miR-205-5p, miR-422a, miR-6798-5p
With miR-6799-5p expressions (small sample checking)；
Fig. 3 is healthy person (Ctrls) and liver cancer (HCC) Urine in Patients miR-6798-5p expressions；
Fig. 4 is liver cancer (HCC) Urine in Patients miR-6798-5p ROC curve.
Embodiment
Screening process is as shown in figure 1, step includes：
(a) urine of collection healthy person (Ctrls) and liver cancer patient (HCC), extracts total serum IgE (including miRNAs)；
(b) primary dcreening operation：MiRNAs express spectras in healthy person and the clinical urine specimen of liver cancer patient are detected with miRNAs chips,
Healthier person and the miRNAs express spectras of liver cancer patient, the miRNAs that primary dcreening operation finds out unconventionality expression in Urine of Patients With Primary Hepatocellular make
For candidate；
(c) small sample secondary screening：With real-time quantitative RT-PCR (qRT-PCR) technology, candidate miRNAs in every part of urine sample is determined
Content, screening may be used as the miRNAs of HCC marks；
(d) enlarged sample secondary screening：With real-time quantitative RT-PCR (qRT-PCR) technology, candidate in every part of urine sample is determined
MiRNAs content, further determines that the miRNAs that can be used as HCC marks；
(e) miRNAs of the liver cancer marker of ROC curve method Analysis and Screening is used, clinical value assessment is carried out.
Embodiment 1
Collecting sample and use mirVanaTM PARISTMKit (Ambion-1556) extracts urine Total RNA：
1. taking the μ L of urine specimen 800,2 × Denaturing Solution of equivalent are added, is vortexed and mixes, place on ice
5 minutes.
2. adding isometric phenol/chloroform, it is vortexed and mixes 30-60 seconds.
3. add 10 μ L cel-miR-39 (1.5x109Copies/ μ L), fully mix.Room temperature, 12000 revs/min from
The heart 5 minutes.
4. carefully drawing supernatant into new 1.5mL centrifuge tubes, the absolute ethyl alcohol of 1.25 times of volumes is added, is vortexed and mixes.
5. it is transferred in pillar (the μ L of maximum volume 700), 10000g centrifugations 30s.
6. mix 10 μ L DNase I and 70 μ L Buffer RDD QIAGEN (#79254) cumulative volumes：80 μ L, be added to from
On film in stem, room temperature places 15min.
7. adding 350 μ L miRNA Wash Solution 1 into centrifugal column, 10000g, room temperature is centrifuged 15 seconds, abandoned stream
Liquid is crossed, centrifugal column is reapposed in collecting pipe
8. adding 500 μ L Wash Solution 2/3 crosses post twice, 10000g, room temperature is centrifuged 15 seconds, and abandoned stream crosses liquid,
Void column is centrifuged 1 minute afterwards.Centrifugal column is placed into new collecting pipe, post center adds the Elution of 50 μ L, 95 DEG C of preheatings
Solution, 12000 revs/min of room temperature is centrifuged 20-30 seconds, and the liquid in collecting pipe is the Total RNA of extraction, can be put
Put and preserve or carry out follow-up experiment at -80 DEG C.
Embodiment 2
Chip detects primary dcreening operation, and the operating process of chip hybridization is as follows：
100ng total RNA are taken to originate, constant volume to 2 μ L.
(1) dephosphorylation：
A. the order shown according to the form below prepares dephosphorylation mixed liquor：
Table A
| CIP Master Mix | 1× | 9× |
| 10×Calf Interinal Phosphatase Buffer | 0.4μL | 3.6μL |
| Labeling Spike-In | 1.1μL | 9.9μL |
| Calf Intestinal Phosphatase | 0.5μL | 4.5μL |
| Cumulative volume | 2μL | 18μL |
B.PCR instrument reacts：30min is expanded at 37 DEG C.
(after this step terminates, if do not carried out following reaction immediately, response sample can be placed in -80 DEG C and saved backup.)
(2) denaturing samples：
A. 2.8 μ L 100%DMSO are added in every pipe sample, centrifugation is mixed；
B. above-mentioned reaction mixture is placed in 100 DEG C of PCR instruments 5-10 minutes (7 minutes)；
C. it is transferred to rapidly in ice-water bath and cools down.
(3) linkage flag：
A. 10 × T4 RNA Ligase Buffer are placed in 37 DEG C of incubations and are spaced vortex, until precipitation all dissolvings,
It is then cooled to room temperature standby.
B. according to the form below is prepared coupled reaction mixed liquor and (noted, reaction mixture should be placed on using preceding preparation after preparing
On ice, and in 15 minutes use)：
Table B
| Ligation Master Mix | 1× | 9× |
| 10×T4 RNA Ligase Buffer | 1μL | 9μL |
| Cy3-pCp | 3μL | 27μL |
| T4 RNA Ligase | 0.5μL | 4.5μL |
| total | 4.5μL | 40.5μL |
C.PCR reacts：16 DEG C incubate 2 hours.
(4) RNA is purified after marking：
RNA moves to 2mL pipes, 1000 × g centrifugations 2min after mark；Take supernatant to move to 1.5mL pipes, added into sample
38.7 μ L ultra-pure waters (RF water) are settled to 50 μ L, 1000 × g centrifugation 4min, abandon supernatant, are settled to 50 μ L.
(5) sample is drained after purification：
1) 45 DEG C concentrate 1 hour (45 DEG C of the sample as not purified is concentrated 3 hours)
2) sample drained is re-dissolved in 17 μ L nuclease-free water
(6) 10 × Blocking Agent are prepared:
1) 125 μ L nuclease-free water, slight whirlpool are added in lyophilized 10 × GE Blocking Agent pipes
Rotation, so that it is completely dissolved, can be placed on 37 DEG C and incubate 4-5 minutes if necessary.
2) slightly centrifuge, place standby.10 × GE Blocking the Agent prepared can be placed in -20 DEG C and preserve 2
Month, melt every time and mix and centrifuge in use, noting being vortexed.
(7) hybridization reaction is prepared：
1) reaction system is configured
Table C
| Hybridization reaction system mixture | |
| Sample | 17μL |
| Hyb Spike-In | 1μL |
| 10×GE Blocking Agent | 4.5μL |
| 2×Hi-RPM Hybridization Buffer | 22.5μL |
| Cumulative volume | 45μL |
2) reaction condition：
100℃5min
Mixture of ice and water 5min
3) chip on, 55 DEG C 20 hours, 20rpm roll hybridization.
After hybridization, take out chip and washed 5 minutes in washing lotion 1；Chip is put into washing lotion 2 again and washed 5 minutes (37
℃)。
Then corresponding parameter scanning is selected in Agilent scanners.
As a result as shown in table 1, miR-125b-2-3p, miR-139-3p, miR-1587, miR-205-5p, miR-422a,
miR-3154、miR-3615、miR-3659、miR-422a、miR-4535、miR-4651、 miR-6798-5p、miR-6799-
5p, miR-6880-5p expression have more than 2 times raisings, and P value≤0.05.
MiRNAs expression (HCC/Ctrls) in the liver cancer patient of table 1. (HCC) urine
Embodiment 3
Secondary screening：RT-qPCR is detected
Small sample secondary screening chooses miR-205-5p, miR-422a, miR-6798-5p and miR-6799-5p, detects Ctrls
With these miRNAs developed by molecule situations (Ctrls 14, HCC 19) in HCC Urine in Patients.As a result show, miR-
6798-5p is in Urine of Patients With Primary Hepatocellular in high expression (P<0.0001), as shown in Figure 2.Remaining miRNAs expression quantity does not show
Difference is write, and P values are more than 0.1.
Large sample secondary screening detects expression (Ctrlss 24, HCC 47 of the miR-6798-5p in Urine of Patients With Primary Hepatocellular
It is individual).As a result show, miR-6798-5p is in Urine of Patients With Primary Hepatocellular in high expression (P<0.0001), as shown in Fig. 3.
With the quantitative gene expression of " two-step method " RT-qPCR method.In two-step method, first, RNA is generated with reverse transcriptase
cDNA.Second step is to take a part of cDNA to carry out multiple qPCR reactions again as template.Small sample secondary screening and enlarged sample secondary screening
Operate according to the following steps.
1. the first step：The preparation (reverse transcription) of cDNA templates
20 μ l reverse transcription systems are as follows：
Table D
| Reagent | Concentration | Volume |
| MiRNA reverse transcriptase primers | 0.5μM | 2μl |
| Total serum IgE | —— | 13μl |
Wherein, reverse transcriptase primer RTP sequence is as shown in table 2.
Soft to mix, 65 DEG C of incubation 5min afterwards, are put into cooled on ice, of short duration to be collected by centrifugation, and add following reagent：
Table E
| Reagent | Concentration | Volume | Final concentration |
| 5×RT Buffer | 5× | 4μl | 1× |
| RT Enzyme Mix | 1μl |
It is soft to mix, 37 DEG C of incubation 60min, afterwards, 70 DEG C of incubation 15min, inactivation M-MLV activity.It is placed in cold on ice
But, it is of short duration to be collected by centrifugation, PCR amplifications are used directly for, or in -20 DEG C of preservations.
2. second step：PCR reacts
(A) preparation of PCR reaction solutions
Table F
(B) PCR reaction condition
95 DEG C of 60s, (95 DEG C of 15s, 60 DEG C of 20s, 72 DEG C of 10s) × 40 are circulated, solubility curve analysis
Primer sequence used in above PCR reactions is as shown in table 2, wherein, RTP represents RT primer, i.e. reverse transcription
Primer；FP represents forward primer, i.e. upstream detection primer.Downstream detector primer is URP (unified reverse primer).
The miRNAs of table 2 qRT-PCR detection of expression primers
Data processing and statistical analysis
Using cel-miR-39 markizations, each △ Ct value for being detected miRNAs is calculated, typing Excel tables of data is built
Storehouse.Using 2 △CtAnalyze the difference of the miRNAs expressions between different groups, △ Ct=Ct reference gene-Ct target genes.
Data test of normality use compare between the method for moments, the group of nonnormal data using Mann-whitney examine or
Kruskal-Wallis is examined.MiRNAs and tcm syndrome and clinical indices of miRNAs, differential expression to differential expression etc.
Correlation analysis and statistical procedures are carried out, are completed using SPSS 15.0 and SAS softwares, with P<0.05 is significance test water
It is accurate.ROC (receiver operating characteristic, ROC) analyze and AUC (area under the curve,
AUC) calculate and completed by GraphPad Prism softwares.
The result of small sample secondary screening is as shown in Fig. 2 wherein Ctrls quantity is 14, HCC sample sizes 19.As a result show
Show, miR-6798-5p expression quantity is significantly increased, and<0.0001；Remaining 3 kinds of miRNAs Ctrls and HCC expression quantity
There is no notable difference, P values are more than 0.1, wherein, miR-205-5p is that 0.8128, miR-422a is 0.1131, miR-6799-5p
For 0.8986..
Enlarged sample secondary screening further verifies (Ctrls quantity is 24, HCC sample sizes 71), miR-6798-5p
Secondary screening result as shown in figure 3, the miR-6798-5p expression quantity in HCC Infection in Patients ' Urine Samples is significantly increased, and P<0.0001.
With ROC curve method (receiver operator characteristics' curve, Receiver Operator Characteristic
Curve, abbreviation ROC curve) diagnostic values of the analysis miR-6798-5p in terms of HCC.As a result as shown in figure 4, the wherein longitudinal axis
For sensitivity, transverse axis is 100%-Specificity% (i.e. 100%- specificities %, false positive rate).TG-AUC AUC
=0.83, illustrate that the correctness of diagnosis is high.
As can be seen here, miR-6798-5p high expression in Urine of Patients With Primary Hepatocellular, can be marked as the biological of screening liver cancer
Will thing, may also be used for the medicine of screening treatment liver cancer.
MiR-6798-5p detection primers and reverse transcriptase primer, can be used to detect the table of miR-6798-5p in urine specimen
Up to amount, so that reagent, kit or biochip for preparing diagnosis or auxiliary diagnosis liver cancer, or for preparing screening
Treat reagent, kit or the biochip of liver-cancer medicine.Examination containing miR-6798-5p detection primers and reverse transcriptase primer
Agent box or biochip, can be used to detect the expression quantity of miR-6798-5p in urine specimen, so that for diagnosing or aiding in examine
Disconnected liver cancer, or screening treatment liver-cancer medicine.
SEQUENCE LISTING
<110>Shanghai Univ. of Traditional Chinese Medicine
<120>Urine miRNAs biomarkers and its screening technique and application
<130> 0
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 44
<212> DNA
<213>Artificial sequence
<400> 1
ctcaactggt gtcgtggagt cggcaattca gttgagccca agct 44
<210> 2
<211> 30
<212> DNA
<213>Artificial sequence
<400> 2
acactccagc tgggccaggg ggatgggcga 30
Claims (9)
1. the screening technique of urine miRNAs biomarkers, it is characterised in that comprise the following steps：
1) urine of collection healthy person and liver cancer patient, extracts total serum IgE；
2) primary dcreening operation：Detect that miRNAs is expressed in healthy person and the clinical urine specimen of liver cancer patient, healthier person and liver cancer patient
MiRNAs express spectras, find out the miRNAs of unconventionality expression in Urine of Patients With Primary Hepatocellular as candidate；
3) secondary screening：Using real-time quantitative RT-PCR technology, the content of candidate miRNAs in urine sample is determined, small sample is carried out respectively
And/or enlarged sample screening, screen and determine to can be used as the miRNAs of liver cancer marker；
4) determine step 3 with ROC curve method) screening liver cancer marker miRNAs.
2. the screening technique of urine miRNAs biomarkers described in claim 1, it is characterised in that step 2) in, use
MiRNAs chip of expression spectrum detects miRNAs expression；Difference miRNA screenings are carried out using the T P values examined and fold change value,
The standard of screening is fold differences changing value >=2 and P value≤0.05.
3. the screening technique of urine miRNAs biomarkers described in claim 1, it is characterised in that step 3) in, it is described
Quantitative RT-PCR technology is examined using stem ring primer reverse transcription method special miRNA with SYBR Green qPCR detection methods
Survey.
4. a kind of kit or biochip detected for liver cancer, it is characterised in that be included in Urine of Patients With Primary Hepatocellular and express
Abnormal miRNA qPCR reverse transcriptase primers and forward detection primer.
5. the kit or biochip of liver cancer are detected described in claim 4, it is characterised in that including miR-6798-5p's
QPCR reverse transcriptase primer and forward detection primer.
6. the kit or biochip of liver cancer are detected described in claim 5, it is characterised in that the miR-6798-5p's is inverse
The sequence of transcription primers includes the sequence described in SEQ ID No.1：
CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCCCAAGCT；
Described forward detection primer sequence includes the sequence described in SEQ ID No.2：
ACACTCCAGCTGGGCCAGGGGGATGGGCGA。
7. the kit or biochip of liver cancer are detected described in claim 5, it is characterised in that the miR-6798-5p's is inverse
The sequence of transcription primers is as shown in SEQ ID No.1：
CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCCCAAGCT；
Described forward detection primer sequence is as shown in SEQ ID No.2：
ACACTCCAGCTGGGCCAGGGGGATGGGCGA。
8.miR-6798-5p it is used as the application of liver cancer biomarkers in urine specimen.
9.miR-6798-5p, miR-6798-5p detection primer or miR-6798-5p reverse transcriptase primers are in screening treatment liver cancer
Application in terms of medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710521228.9A CN107190077A (en) | 2017-06-30 | 2017-06-30 | Urine miRNAs biomarkers and its screening technique and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710521228.9A CN107190077A (en) | 2017-06-30 | 2017-06-30 | Urine miRNAs biomarkers and its screening technique and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107190077A true CN107190077A (en) | 2017-09-22 |
Family
ID=59880708
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710521228.9A Pending CN107190077A (en) | 2017-06-30 | 2017-06-30 | Urine miRNAs biomarkers and its screening technique and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107190077A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107663541A (en) * | 2017-10-31 | 2018-02-06 | 温州医科大学 | A kind of specific biomarkers and its screening technique and application for diagnosing primary liver cancer |
| CN109971851A (en) * | 2019-01-22 | 2019-07-05 | 宁波大学 | Purposes of the MiR-125b-2-3p as the molecular marker of antidiastole different subtypes renal cell carcinomas and its in metastases |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104152567A (en) * | 2014-08-19 | 2014-11-19 | 中国人民解放军总医院第一附属医院 | Application of miRNA-199a in preparation of diagnostic kit |
| CN104152452A (en) * | 2014-08-19 | 2014-11-19 | 中国人民解放军总医院第一附属医院 | Blood miRNA marker related to liver cancer and application thereof |
| CA2951390A1 (en) * | 2014-06-18 | 2015-12-23 | Toray Industries, Inc. | Esophageal cancer detection kit or device, and detection method |
| CN106459867A (en) * | 2014-06-18 | 2017-02-22 | 东丽株式会社 | Liver cancer detection kit or device, and detection method |
-
2017
- 2017-06-30 CN CN201710521228.9A patent/CN107190077A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2951390A1 (en) * | 2014-06-18 | 2015-12-23 | Toray Industries, Inc. | Esophageal cancer detection kit or device, and detection method |
| CN106459867A (en) * | 2014-06-18 | 2017-02-22 | 东丽株式会社 | Liver cancer detection kit or device, and detection method |
| CN104152567A (en) * | 2014-08-19 | 2014-11-19 | 中国人民解放军总医院第一附属医院 | Application of miRNA-199a in preparation of diagnostic kit |
| CN104152452A (en) * | 2014-08-19 | 2014-11-19 | 中国人民解放军总医院第一附属医院 | Blood miRNA marker related to liver cancer and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 张楚红等: ""循环microRNA-122a和microRNA-6086在肝癌诊断及预后中的作用"", 《湖南师范大学学报（医学版）》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107663541A (en) * | 2017-10-31 | 2018-02-06 | 温州医科大学 | A kind of specific biomarkers and its screening technique and application for diagnosing primary liver cancer |
| CN109971851A (en) * | 2019-01-22 | 2019-07-05 | 宁波大学 | Purposes of the MiR-125b-2-3p as the molecular marker of antidiastole different subtypes renal cell carcinomas and its in metastases |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105671181B (en) | Gene marker, primer, probe and kit for detecting lung cancer | |
| CN107400710A (en) | A kind of kit for the exon skipping deletion mutation of MET genes 14 | |
| CN107955836A (en) | For the primer pair of lung cancer related gene SHOX2 DNA methylation assays, kit and method | |
| CN106350600A (en) | Application of LOC80054 in diagnosis or prognosis of pancreatic cancer | |
| CN111621566B (en) | Serum miRNA marker for diagnosing liver cancer and predicting liver cancer metastasis and detection kit thereof | |
| CN106399569A (en) | Application of C2lorf82 in preparation of pancreatic cancer prognosis evaluation products | |
| CN107475363B (en) | Biomarker combination for non-small cell lung cancer, screening method of biomarker combination and application of biomarker combination | |
| CN105177173A (en) | miRNA (microribonucleic acid) biomarkers and detection kit for ovarian cancer diagnosis | |
| CN104745719A (en) | Primer, probe and detection reagent kit for detecting RET fusion gene | |
| CN107190077A (en) | Urine miRNAs biomarkers and its screening technique and application | |
| CN106884052A (en) | A kind of curative effect of pulmonary tuberculosis kits for evaluation based on serum miRNA composition and application thereof | |
| CN108060231A (en) | For the primer pair, kit and method of cervical cancer gene FAM19A4, miR-124-2 DNA methylation assay | |
| CN109593852B (en) | Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN106755309A (en) | Application of the molecular marked compound in cancer of pancreas prognosis evaluation product is prepared | |
| CN110656171B (en) | Use of small nucleolus ribonucleic acid SNORD33 as biomarker for preparing detection kit | |
| CN110373457A (en) | A kind of mRNA marker and its application for ulcerative colitis diagnosis | |
| CN112522391B (en) | Application of hsa_circ_0008961 as gout diagnosis marker | |
| CN107904310A (en) | Urine microRNA biomarkers, kit and its application for diagnosis of colorectal carcinoma | |
| WO2021159562A1 (en) | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof | |
| CN109536612B (en) | Plasma miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN107523641A (en) | Serum miRNAs biomarkers and its screening technique and application | |
| CN114686586B (en) | Molecular marker composition for diagnosing tuberculous pleurisy and application thereof | |
| CN112176060B (en) | Plasma non-coding RNA and primer set for detecting expression level thereof and colorectal cancer detection kit | |
| CN114686587B (en) | Molecular marker for diagnosing tuberculous pleurisy and application thereof | |
| CN116121245B (en) | Small molecule RNA and application thereof in early diagnosis of endometriosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |