CN107185048A - The preparation method of Nano pearl powder/C HA compound rests - Google Patents
The preparation method of Nano pearl powder/C HA compound rests Download PDFInfo
- Publication number
- CN107185048A CN107185048A CN201710510842.5A CN201710510842A CN107185048A CN 107185048 A CN107185048 A CN 107185048A CN 201710510842 A CN201710510842 A CN 201710510842A CN 107185048 A CN107185048 A CN 107185048A
- Authority
- CN
- China
- Prior art keywords
- pearl powder
- compound
- nano
- nano pearl
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/40—Composite materials, i.e. containing one material dispersed in a matrix of the same or different material
- A61L27/44—Composite materials, i.e. containing one material dispersed in a matrix of the same or different material having a macromolecular matrix
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
- A61L27/54—Biologically active materials, e.g. therapeutic substances
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
- A61L27/56—Porous materials, e.g. foams or sponges
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
- A61L27/58—Materials at least partially resorbable by the body
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2300/00—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices
- A61L2300/20—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices containing or releasing organic materials
- A61L2300/30—Compounds of undetermined constitution extracted from natural sources, e.g. Aloe Vera
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2300/00—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices
- A61L2300/40—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices characterised by a specific therapeutic activity or mode of action
- A61L2300/412—Tissue-regenerating or healing or proliferative agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2430/00—Materials or treatment for tissue regeneration
- A61L2430/02—Materials or treatment for tissue regeneration for reconstruction of bones; weight-bearing implants
Abstract
The invention discloses the preparation method of Nano pearl powder C HA compound rests, its operating method is:First, chitosan and hyaluronic acid are dissolved into the acetum that concentration is 1% respectively, are stirred with 2000rpm speed and place 24h under 5min, room temperature condition, obtain chitosan-acetic acid solution and hyaluronic acid acetum;2nd, chitosan-acetic acid solution and hyaluronic acid acetum are mixed after 24h, 5min is stirred with 2000rpm speed;3rd, the Nano pearl powder that percentage by weight is 1 ~ 25% is added, 5min is stirred with 2000 rpm speed;4th, 20 DEG C of refrigerator 24h are put into, then are freeze-dried 24h, compound rest is obtained.There is suitable pore structure the technical problem to be solved in the present invention is to provide one kind, be conducive to the propagation of cell, the growth of blood vessel and the transport of nutriment, with good bioactivity, biocompatibility and biological degradability, Nano pearl powder/C HA compound rest preparation methods of the given shape of Cranial defect are adapted to.
Description
Technical field
The present invention relates to bioengineering field, and in particular to a kind of preparation method of Nano pearl powder/C-HA compound rests.
Background technology
Cranial defect turns into global health problem.With aging population and the development of society, the reparation of Cranial defect into
For an important clinical problem and social demand.At present, the treatment clinically for Cranial defect depends on allogeneic
Bone collection or autologous bone transplanting, but all there are many limitations in both therapeutic modalities.For a long time, autologous bone transplanting is all public
Think the goldstandard of bone collection, but there is the shortcomings of desirable bone amount is limited, bone piece for area's complication, transplanting easily absorbs;Allosome
Then there is immunological rejection and propagate the risk of communicable disease in bone collection.
With the development of medical science, biology and material science, metal material, inorganic non-metallic material and organic material also by
Reparation applied to Cranial defect.However, research more stainless steel, titanium alloy, aluminium oxide ceramics etc. belong to biologically inert material
Material, it is impossible to combined well with tissue, limit its clinical practice.Therefore, it is clinical to promoting bone tissue regeneration, and have
The demand sustainable growth of the synthetic material of excellent mechanical performances and biocompatibility.
At present, bone tissue engineer has turned into a kind of effective ways that osteanagenesis is treated.It is different from conventional method, bone tissue work
Journey is intended to evade the limitation of existing clinical treatment, and the biological substitution product of individuation are prepared to impaired tissue or organ.
Bone tissue engineer typically refers to utilize porous bioabsorbable support, guides histiocytic adhesion, propagation and breaks up, so as to promote
Enter regeneration.Support can simulate the function of nature bone, be most important part in bone tissue engineer.Preferable support should possess
Following characteristics:1. there is good bioactivity, biocompatibility and biological degradability;2. there is suitable pore structure, have
The growth and the transport of nutriment of propagation, blood vessel beneficial to cell;3. there is good configuration of surface and physicochemical property, can
The release of induced intracellular signal;4. the given shape of Cranial defect is adapted to.
Tissue scaffold design should have appropriate mechanical performance, the complicated ambient stress of human skeletal system be adapted to, with new life
Bone tissue is combined.If the modulus of elasticity of support is excessive, it can cause stress shielding after implantation a period of time, eventually result in bone and repair
Multiple failure.The processing conditions and application environment of support depend greatly on the physical property and mechanicalness of timbering material
Energy.Bioactive ceramics can promote the growth and differentiation of Gegenbaur's cell, however, because its fragility is big, it is difficult to be molded, and degrade non-
Often slow the shortcomings of, its clinical practice is restricted.In addition, the accuracy of bioactive ceramics is poor, and porous ceramics scaffold
The new bone of upper formation can not maintain the mechanical load needed for heavy burden bone.Therefore, its clinical practice is also by more limitation.
Support is except needing appropriate mechanical performance, in addition it is also necessary to obtain loose structure, and the adhesion and propagation for cell are provided
Space, this is also the key point of support.Nature bone has multi-level three dimensional pore structures, and pore diameter is from several nanometers to hundreds of
Micron, can meet the different requirements of tissue growth.Under normal circumstances, the aperture of 150-800 μm of diameter can allow bone tissue
With growing into for big blood vessel;The hole of 10-100 μm of diameter is conducive to the growth of capillary, and the exchange and metabolism of nutriment are useless
The discharge of thing;Nano level hole can provide bigger specific surface area, be conducive to formation and the Gegenbaur's cell albumen of apatite
The adhesion of matter, the adhesion and propagation to Gegenbaur's cell is significant.
In recent years, researchers have found the method that some prepare the support with control pore structure and shape, such as molten
Thaw collapse product modeling, stereolithography and 3D printing technique.Guo etc. is prepared for good mechanical properties by Templated FDM methods
With the support of topological property, they have found, with the increase of matrix modulus, and the aperture of support reduces, and marrow stem can be promoted thin
The Osteoblast Differentiation of born of the same parents.Be prepared for calcium phosphate cement bracket material using indirect SL technologies, the inside of support have high opening,
The channel design of interconnection.Hydroxyapatite and poly- (ethene) ethanol are prepared into tissue scaffold design using 3D printing technique,
The structure of support can be pre-designed, and ensure most interconnectivity.However, due to the limitation of hot spot or nozzle diameter,
These technologies are difficult the support for preparing pore diameter range from several nanometers to several microns.Therefore, it can not meet different tissues growth
Demand.
Freeze-drying is also known as lyophilization method, and its principle is first to be chilled to aqueous material below freezing, makes liquid
The water of state is frozen into solid-state, then under the conditions of high vacuum, and ice is directly distilled and removed for steam.Left after water sublimed
Hole just constitute the pore structure of support, therefore, freeze-drying can be by controlling the size of solution concentration to control hole
Rate.Drying process is carried out at a lower temperature, it is to avoid harmful effect to albumen in timbering material.Due to these advantages,
Scholar selects freeze-drying to carry out the preparation of tissue scaffold design more and more.
Someone is prepared for porous hydroxyapatite/chitosan sugar-sodium alginate compound rest using freeze-drying, with height
Spend interrelated between porous, hole.Tested and found by MTT, prepared hydroxyapatite/chitosan-sodium alginate
Compound rest does not produce toxicity to MG-63 cells, shows that compound rest has good cell compatibility.Further by hydroxyl phosphorus
Lime stone/chitin-sodium alginate compound rest is implanted into the skull of mouse, it is found that compound rest can promote repairing for internal Cranial defect
It is multiple.Also pearl powder is combined by someone using freeze-drying with PLA, is successfully prepared with good biocompatibility
PLLA/ aragonitic pearl powder supports and PLLA/ shell pearl layer powder supports, and find that both supports can promote mouse bone marrow cells
The propagation of mescenchymal stem cell and differentiation.Oyster shell whiting is added in alginates by somebody using freeze-drying, is prepared into three
Porous support is tieed up, discovery can promote adhesion and the propagation of cell, there is good application prospect in bone tissue engineer.
The phosphate biological ceramics such as hydroxyapatite, bata-tricalcium phosphate are applied to bone tissue engineer, and existing more than 30 years goes through
History.But, hydroxyapatite is not degradable in vivo, and the degradation speed of tricalcium phosphate can not regulate and control again, and natural biologic material
With good biocompatibility and biodegradability, and by inducing the release of the bio signal factor skeletonization can be promoted thin
Adhesion, propagation and the differentiation of born of the same parents.Also, with the development of tissue engineering technique, natural biologic material is modified, one can be entered
The ability of its promotion osteanagenesis of step enhancing, is that the reparation of Cranial defect brings Gospel.
For a long time, pearl powder is widely used in the multiple fields such as Chinese medicine, cosmetics and health products in China.Pearl powder
There is very high medical value, be made up of aragonite calcium carbonate crystal and the organic substrate being embedded, and can promote containing a variety of
Enter the signaling molecule of bon e formation, be a kind of very promising bone renovating material with good biocompatibility.Pearl powder contains
There is abundant mineral matter, especially containing high-quality calcium and " signal protein ", cell can be controlled by the secretion signal factor
Growth and reparation.Signal protein contained by pearl powder, can promote skin regeneration and tissue repair.Research shows, pearl powder
The insoluble matter that water-soluble base and molecular weight are more than 14kDa can be obviously promoted fibroblastic propagation, collagen deposition
With TIMP-1 generation, so as to promote wound healing, and its main active is probably the insoluble matter that quality is more than 14kDa.
In addition, these signal proteins also play an important role in terms of bone health is promoted;They can promote the differentiation of osteocyte, accelerate
Its mineralising, so as to increase the density of existing bone.Therefore, if can apply pearl powder on tissue scaffold design, then Jiang Hui
Three-dimensional cell culture, tissue engineering bracket and regenerative medicine field are with a wide range of applications.
The content of the invention
The technical problem to be solved in the present invention is to provide one kind have suitable pore structure, be conducive to cell propagation,
The growth of blood vessel and the transport of nutriment, with good bioactivity, biocompatibility and biological degradability, adapt to bone
The Nano pearl powder of the given shape of defect/C-HA compound rest preparation methods.
In order to solve the above-mentioned technical problem, the present invention provides following technical scheme:Nano pearl powder C-HA compound rests
Preparation method, its operating method is:
First, chitosan and hyaluronic acid are dissolved into the acetum that concentration is 1% respectively, stirred with 2000rpm speed
Mix and place 24h under 5min, room temperature condition, obtain chitosan-acetic acid solution and hyaluronic acid acetum;
2nd, chitosan-acetic acid solution and hyaluronic acid acetum are mixed after 24h, stirred with 2000rpm speed
5min;
3rd, the Nano pearl powder of addition 1~25%, 5min is stirred with 2000rpm speed;
4th, -20 DEG C of refrigerator 24h, then 24h is freeze-dried, obtain compound rest.
The Nano pearl powder prepared using technical solution of the present invention /C-HA compound rests, according to experimental study, of the invention answers
The good wetability of support, compression strength are closed, and is conducive to the propagation of cell, and with good bioactivity, bio-compatible
Property and biological degradability, adapt to Nano pearl powder/C-HA compound rests and its application of the given shape of Cranial defect.
Further, described hyaluronic acid, the ratio of chitosan are:Hyaluronic acid 1%, chitosan 4%.
Further, the ratio of contained pearl powder is 1~20% in described raw material.
Further, the ratio of contained pearl powder is 5~20% in described raw material.
Further, the compound rest being prepared from, it is shaped as a diameter of 10~20mm, the highly cylinder for 2~10mm
Body, with multiple equally distributed pore structures.
Further, the compound rest being prepared from, the porosity of its pore structure is between 89~93%.
Further, the compound rest being prepared from, its crystal formation includes aragonite calcium carbonate crystal formation and calcite crystal formation.
Further, a diameter of 15mm of the described compound rest being made, is highly 5mm.
The compound rest being prepared from by the preparation method of Nano pearl powder C-HA compound rests of the present invention, passes through experiment
The properties and its Osteogenic Mechanism of its compound rest are discussed, conclusion is:(1) it is multiple with the increase of Nano pearl powder ratio
Wetability and the compression strength increase of support are closed, but the pore structure of support is interfered, porosity slightly declines.It was combined
Cheng Zhong, the crystal formation of Nano pearl powder does not change.(2) mouse MC3T3-E1 cells well-grown on compound rest, in shuttle
Shape, distribution uniform.The increase of Nano pearl powder promotes propagation and the differentiation of MC3T3-E1 cells, to the apoptosis of cell without bright
Development rings, and the cell compatibility of compound rest is good.(3) RT-qPCR experiments find that nano-pearl powder content is 10% and 25%
Support group Col α tetra- genes of I, OCN, OPN and Runx2 expression be higher than control group.In Western blotting experiments,
Nano-pearl powder content is higher than control for the synthesis of 10% and 25% support group Col α tetra- albumen of I, OCN, OPN and Runx2
Group;But nano-pearl powder content is less than control group for the synthesis of 0% support group Partial Protein.A high proportion of Nano pearl powder/
C-HA compound rests may be by raising I-type collagen, BGP, bone bridge element and the expression and the conjunction of albumen of Runx2 genes
Into promotion skeletonization.As can be seen here, Nano pearl powder/C-HA compound rests have good application prospect in terms of bone tissue engineer.
Brief description of the drawings
Fig. 1 is the substantially aspect graph of each group compound rest of present invention experiment one;
Fig. 2 is that the present invention tests hole shape of the one Nano pearl powder concentration under ESEM for 0% compound rest
State figure;
Fig. 3 is that the present invention tests hole shape of the one Nano pearl powder concentration under ESEM for 1% compound rest
State figure;
Fig. 4 is that the present invention tests hole of the one Nano pearl powder concentration under ESEM for 2.5% compound rest
Aspect graph;
Fig. 5 is that the present invention tests hole shape of the one Nano pearl powder concentration under ESEM for 5% compound rest
State figure;
Fig. 6 is that the present invention tests hole shape of the one Nano pearl powder concentration under ESEM for 10% compound rest
State figure;
Fig. 7 is that the present invention tests hole shape of the one Nano pearl powder concentration under ESEM for 25% compound rest
State figure;
Fig. 8 is the XRD spectra of each group compound rest of present invention experiment five;
Fig. 9 is the Fourier transform infrared spectroscopy figure of Nano pearl powder in present invention experiment six;
Figure 10 is the Fourier transform infrared spectroscopy figure of chitosan in present invention experiment six;
Figure 11 is the Fourier transform infrared spectroscopy figure of hyaluronic acid in present invention experiment six;
Figure 12 is the Fourier transform infrared spectroscopy that the present invention tests the compound rest that Nano pearl powder concentration in six is 0%
Figure;
Figure 13 is the Fourier transform infrared spectroscopy that the present invention tests the compound rest that Nano pearl powder concentration in six is 1%
Figure;
Figure 14 is the Fourier transform infrared light that the present invention tests the compound rest that Nano pearl powder concentration in six is 2.5%
Spectrogram;
Figure 15 is the Fourier transform infrared spectroscopy that the present invention tests the compound rest that Nano pearl powder concentration in six is 5%
Figure;
Figure 16 is the Fourier transform infrared light that the present invention tests the compound rest that Nano pearl powder concentration in six is 10%
Spectrogram;
Figure 17 is the Fourier transform infrared light that the present invention tests the compound rest that Nano pearl powder concentration in six is 25%
Spectrogram;
Figure 18 is that Nano pearl powder in six, chitosan, hyaluronic acid, the ratio of Nano pearl powder of the invention of testing is 0%
The Fourier transform infrared spectroscopy of~25% compound rest compares figure;
Figure 19 is the aspect graph of MC3T3-E1 cells under the ESEM in present invention experiment seven;
Figure 20 is distribution map of the MC3T3-E1 cells on compound rest in present invention experiment seven.
Embodiment
First, embodiment:
Nano pearl powder of the present invention/C-HA compound rests, the ratio containing pearl powder is as shown in table 1, single wherein in raw material
Position wt%:
Table 1
Embodiment | The ratio wt% of contained Nano pearl powder in raw material |
Embodiment one | 1 |
Embodiment two | 2.5 |
Embodiment three | 5 |
Example IV | 10 |
Embodiment five | 25 |
Now by taking embodiment three as an example, the preparation method of Nano pearl powder of the present invention/C-HA compound rests is illustrated;
Embodiment three:
1st, reagent, as shown in table 2
Table 2
Reagent | Company and model |
Micron pearl powder | Hainan Prov Beijing Run pearl Biotechnology Co., Ltd |
Sodium Hyaluronate | H107141, Aladdin |
Chitosan | C105803, Aladdin |
Acetic acid | Analyze pure, Aladdin |
2nd, instrument is as shown in table 3
Table 3
3rd, operating procedure
1) dispersion machine is sanded by nano ceramics uses mechanical attrition method that micron pearl powder is ground to form into Nano pearl powder, does
Dry sterilization;
2) 4wt% chitosans and 1wt% hyaluronic acids are dissolved into 1% acetum respectively, in Thinky stirrings
Stirred in machine with 2000rpm speed and place 24h under 5min, room temperature condition, obtain chitosan-acetic acid solution and hyaluronic acid acetic acid
Solution;
3) chitosan-acetic acid solution and hyaluronic acid acetum are mixed after 24h, in Thinky mixers with
2000rpm speed stirring 5min;
4) and then 2.5wt% Nano pearl powder is added, 5min is stirred with 2000rpm speed;
5) with syringe by solution-cast in 24 orifice plates, per hole 0.5ml, in -20 DEG C of refrigerator 24h, be freeze-dried 24h,
Obtain Nano pearl powder/C-HA compound rests.
Two:The confirming performance of Nano pearl powder/C-HA compound rests
1st, experimental group:
Experimental group one:Compared with embodiment three, the ratio for differing only in contained Nano pearl powder in raw material is 0wt%;
One~embodiment of embodiment five
2nd, experiment reagent and instrument
It is identical with instrument with the reagent of embodiment
One) one, is tested:Determination to compound rest surface topography
1st, the surface topography of compound rest is observed by SEM
Sample is cut into the wide thin slices of 3mm, makes sample surfaces as far as possible smooth.By sample after being dried with vacuum freeze drier
It is bonded at successively on conducting resinl, mark is carried out in the upper left corner of conducting resinl, by sample surface metal spraying 60s.Then scanning electron is opened
The sample room of microscope (MIRA3, Czech), the sample to be observed is fixed, vacuumized, section is directly observed with ESEM
Pattern.
2nd, conclusion
As shown in figure 1, support has highly porous, hole is uniformly distributed, and connection is good.Discovery is further looked at, when
When nano-pearl powder content is relatively low, pore structure and the experimental group one of compound rest:Simple Chitosan-Hyaluronic Acid support phase
Seemingly.However, as shown in Figure 2 to 7, as nano-pearl powder content is gradually stepped up from 0%, when reaching 25%, the surface of support
Gradually coarse, pore structure tends to be disorderly, is locally broken.
The ratio for illustrating contained Nano pearl powder in raw material is 1~25wt%, and its pattern can meet the outer of compound rest
Shape requirement.
Two) two, are tested:Determination to compound rest porosity
1st, method
The porosity (%) of compound rest, always enter amount (mL/g) and total hole area (m2/ g) mercury is automatically pressed by high-performance
Instrument is measured.The compound rest sample prepared by one~embodiment of embodiment five, experimental group one is placed in sample box, adjusted
Pressure, makes mercury enter holes all in material, the weight before and after determination sample infiltration.
2nd, conclusion
As shown in table 4:With the increase of Nano pearl powder ratio, the porosity of support is reduced with amount is always entered, and total hole face
Product increase, but experimental group one and one~embodiment of embodiment five all have higher porosity, are between 89% to 93%, to implement
Support of the porosity of example one less than experimental group one and embodiment two.
Table 4
The porosity of one~embodiment of embodiment five is higher as can be seen here.
Three) three, are tested:The determination of compound rest wetability
1st, method
Wetability is mainly by water droplet in the contact angle that its surface is formed come what is characterized, and the present invention passes through JC2000C types
Static Contact angle measuring instrument (Powereach, Shanghai Zhongchen digital technology equipment Co., Ltd, China) carries out composite membrane contact angle
Measure.
2nd, conclusion
The occurrence of each group compound rest contact angle is as shown in table 5, it is seen then that with the increase of Nano pearl powder ratio,
The contact angle of compound rest diminishes, i.e. the wetability increase of compound rest, and the support wetability of embodiment one is worst, embodiment
4th, five support wetability is optimal.
Table 5, unit:Degree
Four) four, are tested:The determination of compound rest compression strength
1st, method
Present invention use CTM8050 microcomputer controlled electronic universal testers (strong instrument Science and Technology Ltd. of upper Taiwan Strait Exchange Association, in
State) carry out compound rest compression strength measurement.
2nd, conclusion
As shown in table 6, the compression strength of compound rest is dramatically increased with the increase of Nano pearl powder ratio.
Table 6
Group | Ratio | Sample 1 | Sample 2 | Sample 3 |
Experimental group one | 0% | 0.172 | 0.164 | 0.155 |
Embodiment one | 1% | 0.211 | 0.219 | 0.225 |
Embodiment two | 2.5% | 0.292 | 0.309 | 0.295 |
Embodiment three | 5% | 0.312 | 0.348 | 0.348 |
Example IV | 10% | 0.339 | 0.399 | 0.4 |
Embodiment five | 25% | 0.575 | 0.575 | 0.585 |
Five) five, are tested:The determination of compound rest crystal formation
1st, method
Research shows that aragonitic pearl powder can advantageously promote propagation and the differentiation of cell than the pearl powder of ball aragonitic.
In the present invention, the compound raw material of support is aragonitic pearl powder, and compound process includes mixing, stirring, dries and sterilize.For
Whether the crystal formation of pearl powder changes in detection recombination process, to compound rest carries out X-ray diffraction with X-ray diffractometer
Detection.
2nd, conclusion
As shown in Figure 8:When Nano pearl powder ratio than it is relatively low when, its characteristic peak is not obvious.When Nano pearl powder
When content is more than 5%, its characteristic peak occurs.In the other compound rest of each group, aragonite calcium carbonate is main crystal formation, only
There is a small amount of calcite crystal formation.
Six) six, are tested:The composition of compound rest is determined
1st, method
Infrared spectrum is a kind of spectrum of molecule absorption, also known as vibration-rotation spectrum.Its principle is, when molecule is by red
The radiation of outer light, produces the transition of vibration level.When having dipole moment change when in vibration, infrared photon is just absorbed, so that shape
Into infrared absorption spectroscopy.Infra-red sepectrometry can be from the molecular structure of the characteristic absorption peak authenticating compound of molecule, so as to carry out thing
The qualitative and quantitative analysis of matter, based on qualitative analysis.
The present invention is by fourier transform infrared spectroscopy, and detection and analysis Nano pearl powder, chitosan, hyaluronic acid are different
Interaction between composition molecule.
2nd, conclusion
Detect each in one~embodiment of embodiment five, the compound rest recombination process of experimental group one by FTIR spectrum
Reaction between composition.The FTIR spectrograms of Nano pearl powder/C-HA compound rests, from spectrogram can be absorbed peak position, inhale
Receive the intensity at peak and the shape of absworption peak.
As shown in Fig. 9~Figure 18:
In spectrogram, 3600 to 3200cm-1Peak be O-H stretching vibration absworption peak.The spectrogram of Nano pearl powder (NPP)
In, 1488cm-1For C-O stretching vibration absworption peaks, 860cm-1For CO3 2-Flexural vibrations absworption peak.
In the spectrogram of chitosan (C), 2879cm-1For C-H stretching vibration absworption peaks, 1650cm-1And 1589cm-1Place's ownership
For the overlapping of acid amides I and the peaks of acid amides II two.1155cm-1For C-O-C antisymmetric stretching vibration absworption peaks, 1085cm-1For sugared skeleton
C-O stretching vibration absworption peaks.
In hyaluronic acid (H) spectrogram, 2921cm-1For C-H stretching vibration absworption peaks, 1623cm-1And 1413cm-1Point
COO- asymmetric and symmetrical stretching vibration absworption peak is not belonged to.1558cm-1For acid amides peak, 1155cm-1Oppose for C-O-C
Claim stretching vibration absworption peak, 1044cm-1Locate C-H the and C-O-C elastic vibration absorption that adjacent two peak is attributed on sugared skeleton respectively
Peak.
As can be seen here:Influence of the hyaluronic acid to compound rest spectrogram is less than chitosan.Compared with the spectrogram of chitosan, respectively
Amide I peaks and acid amides II peaks there occurs that blue shift, i.e. hypsochromic shift are moved in ratio compound rest.With the spectrogram phase of hyaluronic acid
Than 1700 to 900cm in each ratio compound rest-1Peak intensity weaken.In the spectrogram of each ratio compound rest, nanometer is precious
Pearl powder, chitosan, the peak of three kinds of compositions of hyaluronic acid are superimposed, and with the increase of Nano pearl powder ratio, its characteristic peak
(1488cm-1And 860cm-1) gradually obvious.Show that pearl powder can be effectively embedded in polymer.
3rd, the cell compatibility experiment of Nano pearl powder/C-HA compound rests
In the research of bone tissue engineer, the selection to timbering material, cell compatibility is one of primary index.Although
Pearl powder, hyaluronic acid, chitosan three have good biocompatibility, but three is combined into the bio-compatible after support
Property is unclear.In the present invention, the form of cell and distribution on the compound rest of each embodiment and experimental group are observed;Pass through
The proliferative conditions of CCK-8 testing inspection each group cells;Pass through the differentiation of ALP testing inspection each group cells;Pass through flow cytometry
Detect the apoptosis of each group cell;So as to assess the cell compatibility of Nano pearl powder/C-HA compound rests.
1st, experimental group
Experimental group one:Compared with embodiment three, the ratio for differing only in contained Nano pearl powder in raw material is 0wt%
One~embodiment of embodiment five
2nd, experiment reagent, as shown in table 7
Table 7
3rd, laboratory apparatus, as shown in table 8
Table 8
One) seven, are tested:Cellular morphology, distribution in cell culture, compound rest
1st, method
The compound rest of the one~embodiment of embodiment five prepared, experimental group one is carried out disinfection with Co 60, agent is irradiated
Measure as 15kGy.Compound rest is immersed in α-MEM basal mediums (HyClone, the U.S.) after 12h and carries out cell culture.Will
Support is placed in 24 orifice plates, and the 50 μ l complete mediums containing 50,000 cell are injected per hole, 37 DEG C are placed on, containing 5%CO2Training
Support in case and cultivate 1h, cell culture is carried out after adding 1ml complete mediums after cell attachment per hole, the next day change liquid.
Cell is cultivated after 7d on support, support is transferred in 24 new orifice plates, with 2.5% glutaraldehyde solution 4
DEG C fixation is stayed overnight, and is dehydrated with graded ethanol solutions (0%, 30%, 50%, 75%, 95%, 100%), each concentration dehydration two
It is secondary, finally with gradient t-butanol solution (25%, 50%, 100%)) wash away ethanol.Support is freeze-dried 4h, in ESEM
The form of cell on support is observed under (MIRA3, Czech).
Sample is cut into the wide thin slices of 3mm, makes sample surfaces as far as possible smooth.Sample is bonded at conducting resinl successively after drying
On, surface metal spraying 60s.Then the sample room of ESEM is opened, the sample to be observed is fixed, vacuumized, with scanning electricity
The form of sem observation cell.
2nd, conclusion
By mouse MC3T3-E1 cell culture on compound rest, the next day change liquid, cell under observation three-dimensional cultivation condition
Form.Figure 19 is the form of MC3T3-E1 cells under ESEM, and arrow show MC3T3-E1 cells, and in fusiformis, cell is stretched
Go out pseudopodium to be attached on support.Figure 20 shows that blue-fluorescence (white point) is in distribution of the MC3T3-E1 cells on support, figure
The nucleus of MC3T3-E1 cells, light blue floccule (canescence floccule) is timbering material, distribution of the cell on support
It is more uniform.
MC3T3-E1 cells on compound rest are in fusiformis, situation are sprawled preferably, with the cell under two-dimentional cultivation conditions
Form is similar, shows that compound rest has good mechanical performance, is conducive to the adhesion and growth of cell.MC3T3-E1 cells exist
Distribution uniform on support, illustrate MC3T3-E1 cells can on compound rest well-grown, show that support has good thin
Born of the same parents' compatibility.
Two) eight, are tested:The detection of cell proliferative conditions on compound rest
1st, method
Using CCK-8 kits respectively at the proliferative conditions of cell on culture 1d, 3d, 5d, 7d detection support, each sample
3 multiple holes of this setting, with spectrophotometer (Bio-Rad xMarkTM, the U.S.) detection 450nm at absorbance.
2nd, conclusion
The proliferative conditions for assessing each group cell are tested by CCK-8 in cell culture 1d, 3d, 5d and 7d, such as the institute of table 9
Show.Increase over time, the MC3T3-E1 cells of each support group are bred substantially.Cell concentration between 1d each groups is without substantially poor
It is different.After 3d, the cell of each group rapidly increases, and with the increase of Nano pearl powder ratio, cell breeds more obvious, cell
The most support group for being 25% for Nano pearl powder ratio of propagation.
Increase over time, each support group MC3T3-E1 cells are bred substantially, show that compound support frame material has good
Good cell compatibility.With the increase of Nano pearl powder ratio, cell propagation is more obvious, and this shows that Nano pearl powder can have
Effect ground promotes the propagation of MC3T3-E1 cells.Cell concentration no significant difference between 1d each groups, this is probably due to MC3T3-E1
Cell be substantially carried out in initial 24h it is adherent, not yet carry out cell propagation.
Table 9
Three) nine, are tested:The detection of cell differentiation on compound rest
1st, method
Alkaline phosphatase can effectively assess the differentiation situation of MC3T3-E1 cells.By MC3T3-E1 cells with 5 × 105Individual/
The density kind of support, with osteogenic culture 28d, is tested in 0d, 7d, 14d, 28d with alkaline phosphatase respectively on support
Box (Bioengineering Research Institute is built up in A059-1, Nanjing) is detected.
2nd, conclusion
It is thin by the Activity Assessment each group for detecting the alkaline phosphatase of MC3T3-E1 cells in cell culture 1d, 7d, 14d
The differentiation situation of born of the same parents.Cell suspension in each group timbering material sample, is computed the alkaline phosphatase activity of gained each group cell
(mg/gprot) result is as shown in table 10.Increase over time, the activity increase of alkaline phosphatase;With Nano pearl powder
Increase, the activity of alkaline phosphatase gradually increases, and the difference between each group is most obvious in 7d.
Illustrate that compound rest improves the activity of Cellular alkaline phosphatase in early stage, promote the differentiation of cell.
Table 10
Four) ten, are tested:The detection of Apoptosis on compound rest
1st, method
Annexin V are to detect one of sensitive indexes of Apoptosis.It is a kind of cardiolipin binding protein, can be with early stage
The after birth of apoptotic cell is combined, and one of the change of the change of cytoplasma membrane when being apoptosis earliest.By MC3T3-E1
Cell is with 5 × 105The density kind of individual/support is collected after being digested after culture 3d, 7d, 10d with pancreatin, passed through on support
The apoptosis situation of Annexin V Flow cytometry cells.
2nd, conclusion
The apoptosis situation of Flow cytometry each group cell is used in cell culture 3d, 7d, 10d.By each group cell
Apoptosis rate statistics is as shown in table 11, and the apoptosis rate of each group shows compound rest not in normal range (NR), and without notable difference
Promote the apoptosis of cell, and do not influenceed by Nano pearl powder ratio.
As a result show, Nano pearl powder/C-HA compound rests do not promote the apoptosis of cell, support has nontoxicity, and not
Influenceed by Nano pearl powder ratio.
Table 11
In summary:Mouse MC3T3-E1 cell successful growths are on support, and within the specific limits, a high proportion of compound
Support promotes propagation and the differentiation of cell, and cell compatibility is good.
4th, the influence that Nano pearl powder/C-HA compound rests are expressed Bone formation-related gene, albumen is synthesized
Bone is considered as a kind of structure organ always.Classical theory thinks that bone plays structure stand in animal body, bag
Cell containing three types:Gegenbaur's cell, osteocyte and osteoclast.Gegenbaur's cell derives from mesenchymal stem cells MSCs, energy
It is divided into osteocyte.Gegenbaur's cell is the chief functional cells of bon e formation, and its activity can pass through a variety of ways such as Wnt signal paths
Footpath is adjusted.Osteoclast can absorb bone tissue, from the monocyte of Monocytes/Macrophages system.Osteocyte and Gegenbaur's cell
Some signal factors, such as type i collagen, BGP, bone bridge element and Runt associated transcription factors 2, to adjust Gegenbaur's cell can be secreted
With the interaction of osteoclast, so as to carry out the regeneration and reconstruction of bone.
Type i collagen be bone extracellular matrix in one of main albumen.Collagen can provide cell surface
The binding site of integrin receptor, such as RGD motif, therefore to cell adherence, cell survival, migration and maintain tissue and organ
Physical stability is all essential.
BGP is a kind of Osteoblast Specific albumen, is a kind of main non-collagen in extracellular matrix
Matter.BGP is synthesized and secreted by Gegenbaur's cell system, such as Gegenbaur's cell, osteocyte.Most BGP is present in bone matrix
In, only it is present on a small quantity in blood, because its affinity to bone matrix is stronger.It has the work(for facilitating bone and bon e formation
Energy.Gegenbaur's cell, which can secrete BGP, stimulates osteoblast differentiation and the maturation of osteocyte.
Since bone bridge element was described for the first time from before more than 20 years, played an important role in many physiology and pathologic process,
Including biomineralization, tissue remodeling and inflammation.As extracellular matrix protein and pro-inflammatory cytokine, OPN is considered as to promote
Enter the recruitment of monocyte and macrophage, and mediated leucocytes secrete cytokines.
A large amount of in vivo and in vitro are overexpressed using Runt associated transcription factors 2 to be carried out into come inducing bone mesenchymal stem cell
Bone breaks up, and induces the activity of some Bone formation-related genes, including BGP, type i collagen, bone bridge element and sialoprotein.Grind
Study carefully proof, C2C12 cells are in osteogenic induction early stage high expression Runx2 genes;In ripe Gegenbaur's cell, Runx2 expression
Significantly reduce;During osteoblast differentiation is osteocyte, Runx2 can not then be detected.Therefore, Runx2 may be participated in
Active cell is divided into Gegenbaur's cell, and it is expressed in later stage reduction, so maintenance of the Runx2 low expression to function of osteoblast
It is vital.
In the present invention, by the way that unsupported blank control group and one~embodiment of embodiment five, experimental group one are answered
Support group cell culture 0d, 3d, 7d and 14d are closed, real time fluorescent quantitative polynucleotide chain reaction experiment is carried out, detects each group
Compound rest is expressed Bone formation-related gene;Western blotting experiments are carried out in culture 0d, 3d, 7d, 14d, are discussed
The influence that Nano pearl powder/C-HA compound rests are synthesized to skeletonization GAP-associated protein GAP.
1st, reagent, as shown in table 12:
Table 12
2nd, instrument is as shown in table 13
Table 13
3rd, experimental program
Each group cell culture is cultivated in Osteogenic Induction Medium, cell RNA is extracted in culture 0d, 3d, 7d, 14d
Real time fluorescent quantitative polynucleotide chain reaction (RT-qPCR) experiment is carried out using SYBR methods, Nano pearl powder/C-HA is detected
The influence that compound rest is expressed Bone formation-related gene;Western blotting examinations are carried out in culture 0d, 3d, 7d, 14d
Test, the influence that detection Nano pearl powder/C-HA compound rests are synthesized to skeletonization GAP-associated protein GAP.
One) 11, are tested:Real time fluorescent quantitative polynucleotide chain reaction
1st, the extraction of cell RNA
2nd, RNA reverse transcriptions
3rd, RT-qPCR operation
1) target gene Col α I, OCN, OPN and Runx2 sequence are searched on NCBI, design of primers is as shown in table 14:
Table 14
2) system composition is as shown in Table 15
Table 15
3) quantitative pcr amplification program:
System is mixed, is placed in quantitative real time PCR Instrument.After 95 DEG C × 10min pre-degenerations, then (become with 95 DEG C × 15s
Property), 60 DEG C × 1min (annealing and extensions) are a circulation, carry out 40 circulations.
4th, conclusion
Shown in target gene Col α I, OCN, OPN and Runx2 relative expression's scale 16,17,18,19:
On the day of cell culture as shown in table 16, the differential expression of each pack support target gene is not statistically significant.
Table 16
As shown in table 17, nano-pearl powder content is high for 25% support group OPN and Runx2 expression by cell culture 3d
In blank control group (p<0.05), remaining each group is not statistically significant.
Table 17
As shown in table 18, nano-pearl powder content is 10% and 25% support group Col α I and Runx2 to cell culture 7d
Expression be higher than control group (p<0.05);Nano-pearl powder content is 25% support group OCN and OPN expression also above control
Group (p<0.05).
Table 18
As shown in table 19, nano-pearl powder content is 10% and 25% support group OCN and Runx2 to cell culture 14d
Expression be higher than control group (p<0.05).
Table 19
The RT-qPCR experiments of the present invention use SYBR Green methods, using β-Actin as reference gene, find nano-pearl
Powder content is generally higher than control group for the expression of 10% and 25% support group Col α tetra- genes of I, OCN, OPN and Runx2;
But expression and control group no difference of science of statistics of the nano-pearl powder content for 0% support group gene, illustrate a high proportion of nanometer
Pearl powder/C-HA compound rests may be by raising I-type collagen, BGP, bone bridge element and the expression promotion of Runx2 genes
Skeletonization.
Two) 12, are tested:Western blotting immunoblottings are tested
The relative synthetic quantity of destination protein Col α I, OCN, OPN and Runx2 albumen is as shown in table 20,21,22,23.
On the day of cell culture as shown in table 20, nano-pearl powder content is 25% support group Col α I, OCN and Runx2 eggs
White synthesis is higher than blank control group (p<0.05), nano-pearl powder content is high for the synthesis of 10% support group Runx2 albumen
In blank control group (p<0.05), nano-pearl powder content is higher than blank for the synthesis of 0% support group OCN and Runx2 albumen
Control group (p<0.05).
Table 20
As shown in table 21, nano-pearl powder content is 25% support group Col α I and Runx2 albumen to cell culture 3d
Synthesis is higher than blank control group (p<0.05), nano-pearl powder content is the synthesis of 10% support group Runx2 albumen higher than sky
White control group (p<0.05).And on OCN albumen, the synthesis of Nano pearl powder/C-HA compound rest groups of three ratios is low
In blank control group (p<0.05), and nano-pearl powder content for 0% support group Col α I synthesis be less than blank control group
(p<0.05)。
Table 21
Cell culture 7d as shown in table 22, nano-pearl powder content for 25% support group Col α I, OCN, OPN and
The synthesis of tetra- albumen of Runx2 is above blank control group (p<0.05), nano-pearl powder content is 10% support group Col α I
Synthesis with Runx2 albumen is higher than blank control group (p<0.05), nano-pearl powder content is the OCN of 0% support group conjunction
Into higher than blank control group, but OPN synthesis is less than blank control group (p<0.05).
Table 22
As shown in table 23, nano-pearl powder content is higher than cell culture 14d for the synthesis of 25% support group OCN albumen
Blank control group (p<0.05), nano-pearl powder content is higher than for the synthesis of 10% support group Col α I, OCN and Runx2 albumen
Blank control group (p<0.05), nano-pearl powder content is higher than blank control group (p for the OCN of 0% support group synthesis<
0.05)。
Table 23
Cell culture 3d of the present invention, the synthesis of Nano pearl powder/C-HA compound rest group OCN albumen of three ratios is equal
Less than blank control group (P<0.05), but cell culture 7d, nano-pearl powder content be 0% and 25% support group OCN
The synthesis of albumen is above blank control group (p<0.05), cell culture 14d, Nano pearl powder/C-HA of three ratios is multiple
The synthesis for closing support group OCN albumen is above blank control group (p<0.05).OCN albumen becomes in 3d resulting anomalies, but totally
Gesture is that the synthesis of compound rest group is higher than blank control group.
A high proportion of Nano pearl powder/C-HA supports may promote cell by raising type i collagen (Col α I) expression
The formation of epimatrix.The binding site of the integrin receptor provided by collagen, promotes the adhesion, migration and maintenance of cell
The physical stability of tissue and organ.
A high proportion of Nano pearl powder/C-HA supports may promote the shape of bone matrix by raising BGP OCN expression
Into providing suitable extracellular environment for mouse MC3T3-E1 growth.
A high proportion of Nano pearl powder/C-HA supports may by raising bone bridge element OPN expression, regulation Gegenbaur's cell and
The interaction of osteoclast, and the various factors expression, suppress Apoptosis.
Runx2/Cbf α 1 are also referred to as the core-binding factor of polyoma enhancer associated proteins 2/ or acute myeloid is white
Blood cause of disease.A high proportion of Nano pearl powder/C-HA supports may be by raising Runx2 expression, inducing mouse MC3T3-E1
Cell carries out Osteoblast Differentiation, induces the activity of the Bone formation-related genes such as Col α I, OCN, OPN.
In summary:Compound rest promote the expression of Osteoblast Differentiation related gene such as Col α I, OCN, OPN and Runx2 and
Albumen is synthesized.Consider that compound rest of the content of Nano pearl powder between 1~20 its morphological stability is good and performance compared with
It is excellent, in terms of bone tissue engineer can be widely used in.
The readable carrier content of the nucleotides sequence list is:
<110>Haikou City the People's Hospital
<120>The preparation method of Nano pearl powder C-HA compound rests
<160>10
<210>1
<211>21
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>1
CCAAAGCCAGAGTGGACCCTT
<210>2
<211>21
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>2
GCTTCCGTCAGCGTCAACACC
<210>3
<211>20
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>3
CAGAATCTCCTTGCGCCACA
<210>4
<211>21
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>4
ATTCGTCAGATTCATCCGAGT
<210>5
<211>19
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>5
CTGACCTCACAGATGCCAA<210>6
<211>21
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>6
CATACTGGTCTGATAGCTCGT
<210>7
<211>21
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>7
GCGACCTCAAGATGTGCCACT
<210>8
<211>21
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>8
CTCTCCAAACCAGACGTGCTT
<210>9
<211>20
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>9
CATCCTGCGTCTGGACCTGG
<210>10
<211>20
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>10
TAATGTCACGCACGATTTCC。
For those skilled in the art, on the premise of technical solution of the present invention is not departed from, if can also make
Dry modification and improvement, these should also be considered as protection scope of the present invention, these effects implemented all without the influence present invention and
Practical applicability.
<110>Haikou City the People's Hospital
<120>The preparation method of Nano pearl powder C-HA compound rests
<160>10
<210>1
<211>21
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>1
CCAAAGCCAGAGTGGACCCTT
<210>2
<211>21
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>2
GCTTCCGTCAGCGTCAACACC
<210>3
<211>20
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>3
CAGAATCTCCTTGCGCCACA
<210>4
<211>21
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>4
ATTCGTCAGATTCATCCGAGT
<210>5
<211>19
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>5
CTGACCTCACAGATGCCAA
<210>6
<211>21
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>6
CATACTGGTCTGATAGCTCGT
<210>7
<211>21
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>7
GCGACCTCAAGATGTGCCACT
<210>8
<211>21
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>8
CTCTCCAAACCAGACGTGCTT
<210>9
<211>20
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>9
CATCCTGCGTCTGGACCTGG
<210>10
<211>20
<212>RNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>10
TAATGTCACGCACGATTTCC
Claims (8)
1. the preparation method of Nano pearl powder C-HA compound rests, it is characterised in that its operating method is:
First, chitosan and hyaluronic acid are dissolved into the acetum that concentration is 1% respectively, stirred with 2000rpm speed
24h is placed under 5min, room temperature condition, chitosan-acetic acid solution and hyaluronic acid acetum is obtained;
2nd, chitosan-acetic acid solution and hyaluronic acid acetum are mixed after 24h, 5min is stirred with 2000rpm speed;
3rd, the Nano pearl powder that percentage by weight is 1 ~ 25% is added, 5min is stirred with 2000 rpm speed;
4th, -20 DEG C of refrigerator 24h are put into, then are freeze-dried 24h, compound rest is obtained.
2. the preparation method of Nano pearl powder C-HA compound rests according to claim 1, it is characterised in that:Described is saturating
Bright matter acid, the ratio of chitosan are:Hyaluronic acid 1%, the % of chitosan 4.
3. the preparation method of Nano pearl powder C-HA compound rests according to claim 1, it is characterised in that:Described receives
The percentage by weight of rice pearl powder is 1 ~ 20%.
4. the preparation method of Nano pearl powder C-HA compound rests according to claim 3, it is characterised in that:Described receives
The percentage by weight of rice pearl powder is 5 ~ 20 %.
5. the preparation method of the Nano pearl powder C-HA compound rests according to claim 1 ~ 4 any one, its feature exists
In:The compound rest being prepared from, it is shaped as a diameter of 10 ~ 20mm, the highly cylinder for 2 ~ 10mm, with multiple uniform
The pore structure of distribution.
6. the preparation method of Nano pearl powder C-HA compound rests according to claim 5, it is characterised in that:It is prepared from
Compound rest, the porosity of its pore structure is between 89 ~ 93%.
7. the preparation method of Nano pearl powder C-HA compound rests according to claim 5, it is characterised in that:It is prepared from
Compound rest, its crystal formation include aragonite calcium carbonate crystal formation and calcite crystal formation.
8. the preparation method of Nano pearl powder C-HA compound rests according to claim 5, it is characterised in that:Described system
Into compound rest a diameter of 15mm, be highly 5mm.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710510842.5A CN107185048B (en) | 2017-06-28 | 2017-06-28 | Preparation method of nano pearl powder/C-HA composite stent |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710510842.5A CN107185048B (en) | 2017-06-28 | 2017-06-28 | Preparation method of nano pearl powder/C-HA composite stent |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107185048A true CN107185048A (en) | 2017-09-22 |
CN107185048B CN107185048B (en) | 2020-08-04 |
Family
ID=59880154
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710510842.5A Active CN107185048B (en) | 2017-06-28 | 2017-06-28 | Preparation method of nano pearl powder/C-HA composite stent |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107185048B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108066817A (en) * | 2017-12-06 | 2018-05-25 | 常州琨瑶纺织品有限公司 | A kind of nano bone repair material and preparation method thereof |
CN108939151A (en) * | 2018-08-01 | 2018-12-07 | 北京大学 | Application of the nanoporous micro rack in regeneration and restoration |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101172164A (en) * | 2006-11-03 | 2008-05-07 | 中国科学院化学研究所 | Biopolymer nano tunica fibrosa material capable of being biological degraded and absorbed, preparing method and uses of the same |
CN101401964A (en) * | 2008-11-17 | 2009-04-08 | 昆明理工大学 | Organic-inorganic compound bone restoration bioactive material |
CN101496908A (en) * | 2009-02-20 | 2009-08-05 | 杭州电子科技大学 | Pearl powder artificial bone supporting material with multi-stage micro-nano structure and technique for producing the same |
CN102357262A (en) * | 2011-10-09 | 2012-02-22 | 清华大学 | Porous composite scaffold of PLLA (polylactic acid)/pearl powder and its preparation method |
CN102875824A (en) * | 2012-10-25 | 2013-01-16 | 福州大学 | Bioactive nano composite polyelectrolyte three-dimensional porous bone tissue engineering scaffold |
CN106540329A (en) * | 2016-12-10 | 2017-03-29 | 深圳清华大学研究院 | Nanofiber complex calcium phosphate bone support and preparation method thereof |
-
2017
- 2017-06-28 CN CN201710510842.5A patent/CN107185048B/en active Active
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101172164A (en) * | 2006-11-03 | 2008-05-07 | 中国科学院化学研究所 | Biopolymer nano tunica fibrosa material capable of being biological degraded and absorbed, preparing method and uses of the same |
CN101401964A (en) * | 2008-11-17 | 2009-04-08 | 昆明理工大学 | Organic-inorganic compound bone restoration bioactive material |
CN101496908A (en) * | 2009-02-20 | 2009-08-05 | 杭州电子科技大学 | Pearl powder artificial bone supporting material with multi-stage micro-nano structure and technique for producing the same |
CN102357262A (en) * | 2011-10-09 | 2012-02-22 | 清华大学 | Porous composite scaffold of PLLA (polylactic acid)/pearl powder and its preparation method |
CN102875824A (en) * | 2012-10-25 | 2013-01-16 | 福州大学 | Bioactive nano composite polyelectrolyte three-dimensional porous bone tissue engineering scaffold |
CN106540329A (en) * | 2016-12-10 | 2017-03-29 | 深圳清华大学研究院 | Nanofiber complex calcium phosphate bone support and preparation method thereof |
Non-Patent Citations (3)
Title |
---|
CLARA R. CORREIA等: "Chitosan Scaffolds Containing Hyaluronic Acid for Cartilage Tissue Engineering", 《TISSUE ENGINEERING》 * |
李婷等: "珍珠层粉/壳聚糖多孔支架的制备及分析测试", 《材料导报B:研究篇》 * |
李贺军,齐乐华,张守阳: "《先进复合材料》", 31 December 2016, 西北工业大学出版社 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108066817A (en) * | 2017-12-06 | 2018-05-25 | 常州琨瑶纺织品有限公司 | A kind of nano bone repair material and preparation method thereof |
CN108939151A (en) * | 2018-08-01 | 2018-12-07 | 北京大学 | Application of the nanoporous micro rack in regeneration and restoration |
CN108939151B (en) * | 2018-08-01 | 2019-11-05 | 北京大学 | Application of the nanoporous micro rack in regeneration and restoration |
Also Published As
Publication number | Publication date |
---|---|
CN107185048B (en) | 2020-08-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Volkov et al. | Poly (3-hydroxybutyrate)/hydroxyapatite/alginate scaffolds seeded with mesenchymal stem cells enhance the regeneration of critical-sized bone defect | |
Yang et al. | Bioinspired membrane provides periosteum-mimetic microenvironment for accelerating vascularized bone regeneration | |
Jia et al. | Human-like collagen/nano-hydroxyapatite scaffolds for the culture of chondrocytes | |
Liu et al. | Heparan sulfate loaded polycaprolactone-hydroxyapatite scaffolds with 3D printing for bone defect repair | |
Li et al. | 3D-printed scaffolds with calcified layer for osteochondral tissue engineering | |
Venugopal et al. | Electrospun PCL nanofibers blended with Wattakaka volubilis active phytochemicals for bone and cartilage tissue engineering | |
Cheng et al. | Extracellular matrix imitation utilizing nanofibers-embedded biomimetic scaffolds for facilitating cartilage regeneration | |
Xu et al. | Development of biodegradable bioactive glass ceramics by DLP printed containing EPCs/BMSCs for bone tissue engineering of rabbit mandible defects | |
Li et al. | Nano-pearl powder/chitosan-hyaluronic acid porous composite scaffold and preliminary study of its osteogenesis mechanism | |
Salehi et al. | Efficient mineralization and osteogenic gene overexpression of mesenchymal stem cells on decellularized spinach leaf scaffold | |
Mahdavi et al. | Bioactive glass ceramic nanoparticles-coated poly (l-lactic acid) scaffold improved osteogenic differentiation of adipose stem cells in equine | |
Wan et al. | Layer-by-layer paper-stacking nanofibrous membranes to deliver adipose-derived stem cells for bone regeneration | |
Sattary et al. | Polycaprolactone/Gelatin/Hydroxyapatite nanocomposite scaffold seeded with Stem cells from human exfoliated deciduous teeth to enhance bone repair: in vitro and in vivo studies | |
Chen et al. | Effect of internal structure of collagen/hydroxyapatite scaffold on the osteogenic differentiation of mesenchymal stem cells | |
Ghorbani et al. | A bioinspired 3D shape olibanum‐collagen‐gelatin scaffolds with tunable porous microstructure for efficient neural tissue regeneration | |
Herrero-Herrero et al. | Influence of chemistry and fiber diameter of electrospun PLA, PCL and their blend membranes, intended as cell supports, on their biological behavior | |
Yang et al. | Synthesis of aligned porous polyethylene glycol/silk fibroin/hydroxyapatite scaffolds for osteoinduction in bone tissue engineering | |
Yang et al. | Osteogenic activity of nanonized pearl powder/poly (lactide-co-glycolide) composite scaffolds for bone tissue engineering | |
Liu et al. | Vascularized bone tissue formation induced by fiber-reinforced scaffolds cultured with osteoblasts and endothelial cells | |
Wu et al. | Tissue engineering in female pelvic floor reconstruction | |
Wang et al. | Stretchable collagen-coated polyurethane-urea hydrogel seeded with bladder smooth muscle cells for urethral defect repair in a rabbit model | |
CN107446885A (en) | A kind of timbering material of derived mesenchymal stem cells in vitro Osteoinductive differentiation and its application | |
Liu et al. | Bioinspired mineral-polymeric hybrid hyaluronic acid/poly (γ-glutamic acid) hydrogels as tunable scaffolds for stem cells differentiation | |
CN102861360A (en) | Neural restoration promoting material as well as preparation method and application thereof | |
Wu et al. | Electrospun fibers immobilized with BMP-2 mediated by polydopamine combined with autogenous tendon to repair developmental dysplasia of the hip in a porcine model |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |