CN107184967A - A kind of helicobacter pylori oral vaccine based on withered grass gemma carrier - Google Patents

A kind of helicobacter pylori oral vaccine based on withered grass gemma carrier Download PDF

Info

Publication number
CN107184967A
CN107184967A CN201710188754.8A CN201710188754A CN107184967A CN 107184967 A CN107184967 A CN 107184967A CN 201710188754 A CN201710188754 A CN 201710188754A CN 107184967 A CN107184967 A CN 107184967A
Authority
CN
China
Prior art keywords
ureb
cotc
ctb
withered grass
gemma
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710188754.8A
Other languages
Chinese (zh)
Inventor
周珍文
董慧
关锐梨
龚四堂
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Women and Childrens Medical Center
Original Assignee
Guangzhou Women and Childrens Medical Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Women and Childrens Medical Center filed Critical Guangzhou Women and Childrens Medical Center
Priority to CN201710188754.8A priority Critical patent/CN107184967A/en
Publication of CN107184967A publication Critical patent/CN107184967A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/0208—Specific bacteria not otherwise provided for
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/742—Spore-forming bacteria, e.g. Bacillus coagulans, Bacillus subtilis, clostridium or Lactobacillus sporogenes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55544—Bacterial toxins

Abstract

The invention discloses a kind of helicobacter pylori oral vaccine based on withered grass gemma carrier.It is that CotC UreB or Cotc CTB UreB genetic fragments are transferred in expression vector, then the expression vector conversion containing CotC UreB or Cotc CTB UreB is entered in bacillus subtilis, so as to obtain the helicobacter pylori oral vaccine based on withered grass gemma carrier, described CotC nucleotide sequence is as shown in SEQ ID NO.1, described CTB nucleotide sequence is as shown in SEQ ID NO.2, and described UreB nucleotide sequence is as shown in SEQ ID NO.3.The present invention to strengthen restructuring Ure withered grass gemma inducing mouse specific mucosal immunes, and carries out prevention exploration using recombinant bacillus gemma first by mucosal adjuvants cholera toxin B and helicobacter pylori UreB amalgamation and expressions in withered grass spore surface to Hp.

Description

A kind of helicobacter pylori oral vaccine based on withered grass gemma carrier
Technical field：
The invention belongs to biomedicine field, and in particular to a kind of helicobacter pylorus fungus oral epidemic disease based on withered grass gemma carrier Seedling.
Background technology：
Helicobacter pylori (Helicobacter pylori) is the Main Pathogenic Bacteria of disease of upper digestive tract, and its infection is not But it is relevant with gastritis, gastric ulcer and non-ulcer dyspepsia, and with mucous membrane associated lymphoid tissue (MALT) lymthoma and Stomach cancer also has important relationship.Hp global population chronic infection rate up to more than 50%, the average rate of population of China is up to 58.07%, it seriously endangers the health and safety of the mankind.
" three " therapy of the additional two kinds of antibiotic of proton pump inhibitor is used the treatment of Hp infection more.Although this scheme energy The Hp infected is effectively removed, but it is poor to there is inducible resistance bacterial strain prevalence, drug side-effect, costly and patient dependence The problems such as.Therefore, inoculated with Hp vaccine is the effective measures of prevention and control Hp infection.
But, protein vaccine is inoculated with by oral administration, due to pass through the harsh environment of hydrochloric acid in gastric juice barrier and alimentary canal, immunogenicity It is all very weak.Therefore suitable intestines and stomach field planting microorganism is used as potential carrier for oral vaccine delivery, to develop the effective way of Hp vaccines.And mesh The alimentary canal vaccine delivery system (carrier system) that preceding Hp vaccine developments are used, usually alimentary canal attenuated bacteria (such as typhoid fever) Or virus, but they still have back mutation and safety issue.It is primarily present following defect：1. Hp whole-bacterial-vaccine masters are showed It is thalline ultrasonication thing and the whole cell of formalin-inactivated to want composition.Exempted from using the HpSS1 whole cells after formalin-inactivated with mucous membrane Mouse is immunized in epidemic disease adjuvant cholera toxin (CT), it is found that it can effectively suppress Hp and infect and control subinfection again.But Hp whole cells Crude antigen complicated component, has that side effect is larger, immune effect is poor, easily cause LADA disease by cross-immune reaction Disease and intestinal bacilli illness, be difficult standardization the shortcomings of, be not suitable for human vaccination.Meanwhile, Hp is microaerobion, in culture Very harsh is required to conditions such as oxygen content, nutrition, temperature, humidity, and incubation time is long, it is costly, yield poorly, be unsuitable for big Scale evaluation is produced.Therefore, the exploitation of Hp whole cells vaccine does not have realistic meaning.2. subunit antigen lamps structure is simple, safe Property is good, suitable for industrialized production the advantages of.But protein vaccine is by oral administration, it is difficult to pass through intestines and stomach harsh environment, most of egg White degraded, reduces immunogenicity.
Withered grass gemma has the advantages that many conventional vaccine carriers are incomparable as oral type vaccine carrier：Its life Thing is safe：It belongs to gram positive bacteria, does not produce toxin, but also is one of conventional probiotics, with the function of being people Property food, animal feed additive etc..1. bacillus subtilis can produce a variety of digestive ferments, and it has stronger protease, formed sediment Powder enzyme and lipase active, while also there is the enzyme of degraded complex carbohydrates, such as pectin, glucan, cellulose enzyme, side Help and nutriment is digested and assimilated.2. bacillus subtilis can produce a variety of nutriments, and it can synthesize multivitamin Such as niacin, folic acid, nicotinic acid, vitamin B1, B2, B6, B12, promote digestion, absorption of the body to protein.3. withered grass bud Spore bacillus produces antibiotic and bacteriocin, can suppress the growth of pathogenic bacteria by antagonism, so as to play the effect of disease preventing and treating Really.4. withered grass gemma has the immunological characteristic of uniqueness：Oral gemma can be by intestines and stomach associated lymphoid tissue in animal intestinal tract (MALT) recognize, play the associated lymphoid tissue on immunoadjuvant function, activation intestinal mucosa, make secreting type (SIgA) antibody-secreting Enhancing, improves Immune discrimination ability, and induces T, bone-marrow-derived lymphocyte and macrophage to produce cell factor, by lymphocyte again Circulate and activate systemic immune system, so as to strengthen the non-specificity and specific immune system of body.
Cholera toxin Cholera toxin (CT) are the exotoxins produced by comma bacillus, are the main causes of comma bacillus Cause of disease, with A, B Liang Ge subunits.Wherein A subunits (CTA) have ADP ribosyltransferase activity, are the activity of toxin Center.5 B subunits (CTB) are assembled into pentamer, and the GMl being expressed on karyocyte cell membrane god is combined with high-affinity Warp knuckle glycosides ester, combines internalization after cell surface receptor required by spherical A subunits.Though CT can effectively strengthen the office for antigen Portion is immunized and systemic immunity, but is due to its toxicity, limits its application.Choleratoxin B subunit is non-toxic, with very strong Immunogenicity, can stimulate generation mucous membrane IgA and serum IgG antibody, with can strengthen antigenic feature of epitope, therefore this Invention uses CTB as vaccine adjuvant.
The content of the invention：
It is an object of the invention to provide a kind of cheap, safe and efficient helicobacter pylori based on withered grass gemma carrier mouthful Take vaccine and its construction method.
The present invention is to use probiotics bacillus subtilis as carrier, and CTB merges CTB with Hp UreB as adjuvant Withered grass spore surface is expressed in, helicobacter pylori infections are prevented using recombinant bacillus gemma.Specifically by mucosal adjuvants Cholera toxin B (CTB), in withered grass spore surface, builds surface expression with Hp Vaccine molecules urease B (UreB) amalgamation and expression CTB-UreB gemma vaccines.
The helicobacter pylori oral vaccine based on withered grass gemma carrier of the present invention, it is characterised in that it is by CotC- UreB or Cotc-CTB-UreB genetic fragments are transferred in expression vector, then will contain CotC-UreB or Cotc-CTB-UreB Expression vector conversion enter bacillus subtilis in, so as to obtain the helicobacter pylorus fungus oral epidemic disease based on withered grass gemma carrier Seedling, described CotC nucleotide sequence is as shown in SEQ ID NO.1, described CTB nucleotide sequence such as SEQ ID NO.2 Shown, described UreB nucleotide sequence is as shown in SEQ ID NO.3.
Described CotC-UreB is that 3 ' ends of CotC genetic fragments are connected with 5 ' ends of UreB genetic fragments, described Cotc-CTB-UreB is that 3 ' ends of CotC genetic fragments are connected with 5 ' ends of CTB genetic fragments, then by CTB genetic fragments 3 ' ends be connected to hold with the 5 ' of UreB genetic fragments and be connected.
Described expression vector it is preferred with spore coat PROTEIN C otC fusion expression vectors pUS186-CotC.
Beneficial effects of the present invention are as follows：
1st, as probiotics, oral bacillus subtilis can directly supplement normal physiological flora, suppress pathogenic bacteria, promote battalion Support the digestion of material, absorb, suppress the generation and absorption of intestines source property toxin, reach the purpose of adjustment intestinal flora imbalance.I Using its as the carrier of Hp vaccines, on the one hand can play its prebiotic function, at the same the mankind can generally be infected and have seriously The Hp of harmfulness is prevented.The effect killed two birds with one stone will be played.The vaccine form has a good safety, unique resistance and Amynologic characteristic, is the ideal vaccine form for infection of digestive canal pathogen, and the vaccine is easy to use, is easy to promote.
2nd, the present invention is first by mucosal adjuvants cholera toxin B and helicobacter pylori UreB amalgamation and expressions in withered grass gemma table Face, to strengthen restructuring Ure withered grass gemma inducing mouse specific mucosal immunes, and is prevented Hp using recombinant bacillus gemma Explore.
Brief description of the drawings：
Fig. 1 is the double digestion identification of restructuring pET28aCTB-UreB plasmids, wherein Lane1：Marker；Lane2： PET28aCTB-UreB is through EcoR I, Not I double digestions；Lane 3：PET28a plasmids are through EcoR I, Not I double digestions；
Fig. 2 is the double digestion identification of restructuring pUS186CotC-CTB-UreB plasmids, wherein Lane1：Marker；Lane2： PUS186CotC-CTB-UreB is through Xbal I, Pst I double digestions.
Fig. 3 is spore coat protein SDS-PAGE and Western blotting analyses, a) spore coat Protein S DS- PAGE；B) spore coat albumen Western blotting are analyzed, and arrow meaning is fusion protein, Lane1：Marker； Lane2：PUS186CotC-CTB/WB600 gemma；Lane3：PUS186CotC-UreB/WB600 gemma； Lane4.pUS186CotC-CTB-UreB/WB600 gemma；Lane5：PUS186CotC/WB600 gemma；
Fig. 4 is recombinant spore oral immunity rise mouse Ure B serological specificities IgG and excrement specificity IgA, a) serum Ure B specific IgGs；B) Ure B excrement specificity IgA (* * P<0.01 is compared with CotC groups), wherein naive represents negative right According to distilled water gavage, Cotc represents withered grass plasmid bacterial pUS186CotC/WB600 gemma gavages, and Cotc-CTB represents withered grass plasmid Bacterium pUS186CotC-CTB/WB600 gemma gavages, Cotc-UreB represents withered grass plasmid bacterial pUS186CotC-UreB/WB600 buds Spore gavage, Cotc-CTB-UreB represents withered grass plasmid bacterial pUS186CotC-CTB-UreB/WB600 gemma gavages.
Fig. 5 is splenocyte cytokine levels, and Ure B and spleen cell cultures 72h ELISA detect IL-4, IFN-γ, IL- 10(**p<0.01,*p<0.05.), wherein naive represents negative control distilled water gavage group, and Cotc represents withered grass plasmid bacterial PUS186CotC/WB600 gemma gavage groups, Cotc-CTB represents withered grass plasmid bacterial pUS186CotC-CTB/WB600 gemma gavages Group, Cotc-UreB represents withered grass plasmid bacterial pUS186CotC-UreB/WB600 gemma gavage groups, and Cotc-CTB-UreB represents withered Careless plasmid bacterial pUS186CotC-CTB-UreB/WB600 gemma gavage group.
Fig. 6 is recombinant spore orally immune Mouse Stomach Hp infection quantity (the * * p of reduction<0.01,*p<0.05.), wherein Naive represents negative control distilled water gavage group, and Cotc represents withered grass plasmid bacterial pUS186CotC/WB600 gemma gavage groups, Cotc-CTB represents withered grass plasmid bacterial pUS186CotC-CTB/WB600 gemma gavage groups, and Cotc-UreB represents withered grass plasmid bacterial PUS186CotC-UreB/WB600 gemma gavage groups, Cotc-CTB-UreB represents withered grass plasmid bacterial pUS186CotC-CTB- UreB/WB600 gemma gavage groups.
Embodiment：
Following examples are that the present invention is further illustrated, rather than limitation of the present invention.
Embodiment 1：
Described CotC nucleotide sequence is as shown in SEQ ID NO.1, described CTB nucleotide sequence such as SEQ ID Shown in NO.2, described UreB nucleotide sequence is as shown in SEQ ID NO.3
1st, the clone of CTB, UreB, CTB-Ure in escherichia coli plasmid pET28a
CTB base sequences are synthesized, specific primer (P1 is used：CGAGGATCCACACCTCAAAATATTACTGAT；P2： CCGAAGCTTTTAATTTGCCATACTAATT CTB genes) are expanded, pET28a plasmids are cloned into.Extract helicobacter pylori gene Group DNA, uses specific primer (P1:5′-CGCGTCGACATGAAAAAGATTAGCAGAAAAGAA-3′；P2:5′- AAAGCGGCCGCCTAGAAAATGCTAAAGAGTTGT-3 ') amplification UreB genes, pET28a plasmids are cloned into, are obtained pET28a-UreB.Using Similar strategies, the CTB UreB 5 ' for being cloned into pET28a-UreB are held into (primer P1：5′- CGCGAATTCACACCTCAAAATATTACTGATTTG-3′；P2：5′-CGAGTCGACATTTGCCATACTAATTGCGGCAA- 3 ') pET28a-CTB-UreB plasmids (i.e. 3 ' the ends of CTB are connected with the ends of UreB 5 '), are built, EcoR I, Not I counterweights is used Group pET28a-CTB-UreB plasmids double digestion obtains CTB-UreB genetic fragments, with expected consistent (Fig. 1), gene sequencing Fusion is demonstrated in the success of pET28a plasmid clonings.
2nd, the clone of CTB, UreB, CTB-UreB in Bacillus subtilis plasmid pUS186-CotC
The use of the restructuring pET28a-CTB-UreB plasmids built is template, amplifies CTB (primers:P1:5′- CGGTCTAGAGACACCTCAAAATATTACTGATT-3′；P2：5 '-CCGAAGCTTTTAATTTGCCATACTAATT-3 '), UreB (primer P1:5′-CGCTCTAGACATGAAAAAGATTAGCAGAAAAG-3′；P2: CGCCTGCAGCTAGAAAATGCTAAAGAGTTGTG), CTB-UreB (primers：P1:5′- CGCTCTAGACACACCTCAAAATATTACTG-3′；P2:5′-CACCTGCAGCTAGAAAATGCTAAAGAGTTGT-3 ') base Because of fragment, then Bacillus subtilis plasmid pUS186-CotC is cloned into, thus respectively obtains pUS186CotC-CTB, pUS186CotC- UreB and pUS186CotC-CTB-UreB plasmids.Using Xbal I, Pst I to restructuring pUS186CotC-CTB-U reB Plasmid double digestion obtains CTB-UreB genetic fragments, and with expected consistent (Fig. 2), gene sequencing demonstrates fusion CTB, UreB, CTB-UreB are in the success of pUS186CotC plasmid clonings.
3rd, expression of CTB, UreB, the CTB-UreB fusion protein on withered grass gemma
By pUS186-CotC, pUS186CotC-CTB, pUS186CotC-UreB and pUS186CotC-CTB-UreB matter Conversion enters in bacillus subtilis WB600 grain respectively, thus respectively obtains withered grass plasmid bacterial pUS186CotC/WB600, pUS186CotC-CTB/WB600,pUS186CotC-UreB/WB600,pUS186CotC-CTB-UreB/WB600。
The inductive formation of gemma：By withered grass plasmid bacterial pUS186CotC/WB600, pUS186CotC-CTB/WB600, PUS186CotC-UreB/WB600, pUS186CotC-CTB-UreB/WB600 streak inoculation in LB plates (g/ml of μ containing kana20), 37 DEG C of overnight incubations, picking monoclonal colony inoculation is in 5ml LB nutrient solutions (the μ g/ml containing kana 20), 37 DEG C of shaking table culture mistakes Night.By 1:100 inoculation DSM gemma culture mediums (Difco Sporulation Medium), 37 DEG C of 250r/min shaking table cultures 24h After collect gemma.
Bacillus subtilis brood body is removed using SDS-DTT liquid and lysozyme, ultrasound makes bacillus subtilis broken wall.Often 1010Individual gemma extracts coat protein about 0.39mg, equivalent to each gemma 0.039pg, thus respectively obtains expression Cotc- CTB recombinant spores (correspondence pUS186CotC-CTB/WB600), expression Cotc-UreB recombinant spores (correspondence pUS186Cot C- UreB/WB600), expression Cotc-CTB-UreB recombinant spores (correspondence pUS186CotC-CTB-UreB/WB600).Cotc genes The protein molecular weight of coding is 8.8kDa, and CTB, UreB molecular weight are respectively 12kDa, 61kDa, the recombinant C otc- of expression CTB, Cotc-UreB, Cotc-CTB-UreB predicted molecular weight are respectively 20.8,69.8,81.8,12%SDS-PAGE show, 3 fusion proteins are in all visible clear purpose band (Fig. 3 a) of expected molecular weight ranges.Use corresponding antiserum, Western Blotting can detect specific recognition band (Fig. 3 b).
The preparation of specific immunity serum：With the 100 μ g recombinant C TB albumen purified or UreB albumen (in pET/E.coli Expression system expression, purifying) mixed respectively with isometric Freund's complete adjuvant, it is big that immune SD is subcutaneously injected in back, foot pad position Mouse；Same procedure, is spaced 2 weeks and carries out the 2nd booster immunization (with same dose plus incomplete Freund's complete adjuvant)；Interval 2 weeks Carry out last time booster immunization (being not added with adjuvant).Final immunization one week after gather blood, separation serum be stored in -20 DEG C it is standby With.
4th, oral CTB-UreB recombinant spores inducing mouse immune response
Respectively with 1 × 108Individual gemma (withered grass plasmid bacterial pUS186CotC/WB600, pUS186CotC-CTB/WB600, PUS186CotC-UreB/WB600 or pUS186CotC-CTB-UreB/WB600) the 0th, 1,2,16,17,18,33,34,35 It uses gastric perfusion needle peroral immunity each group mouse, and oral recombinant bacillus gemma is immune 2nd week；CotC-UreB (correspondence withered grass plasmid bacterials pUS186CotC-UreB/WB600)；CotC-CTB-UreB (correspondence withered grass plasmid bacterial pUS186CotC-CTB-UreB/WB600) Oral group mice serum UreB specific IgGs are significantly raised, are peaked (Fig. 4 a) within the 4th week.CotC-UreB, CotC-CTB- UreB orally organizes stool in mice specificity IgA and also significantly raised (Fig. 4 b) at the 2nd week, peaks within the 4th week, and CotC- CTB-UreB groups are significantly higher than CotC-UreB.Naive, Cotc-CTB and Cotc group are compared, and serological specificity IgG and excrement are special Different in nature IgA is showed no rise.Show that UreB recombinant bacillus gemma can induce mucous membrane and the system response for fused antigen.
5th, oral recombinant spore mouse boosting cell IFN-γ, IL-10, IL-4 levels
The neck that breaks after Hp attack four weekss puts to death mouse, separating Morr. cell (4 × 106/ well/ml) with recombinating Ure B albumen (2.5 μ g/ml) co-cultures 72h, and ELISA detects culture supernatant IFN-γ, IL-10, IL-4 level, compared with Cotc groups, Cotc- Mouse IL-10 is immunized in CTB, CotC-UreB, CotC-CTB-UreB, and IFN-γ significantly raises (CotC-CTB-UreB vs CotC, p<0.01；CotC-CTB, CotC-UreB vs CotC, p<0.05)；Also, IL- produced by CotC-CTB-UreB groups 10, IFN-γ is significantly higher than CotC-CTB, CotC-UreB group (p<0.05)；However, restructuring IL-4 horizontal each group indifference (figures 5)。
6th, oral CTB-UreB recombinant spores inducing mouse resistance Hp challenge infections
Gavage oral (withered grass plasmid bacterial pUS186CotC/WB600, pUS186CotC-CTB/WB600, pUS186CotC- UreB/WB600 or pUS186CotC-CTB-UreB/WB600 gemma) final immunization is after 2 weeks, every mouse stomach oral 3 × 108Individual H.p SS1 plants, attack after four weeks the neck that breaks and put to death mouse.Compared with CotC gemma immune groups, CotC-CTB-UreB and CotC-UreB recombinant spore oral immunity mouse can significantly reduce the Hp stomach carrying capacity (p after Hp attacks<0.01) (Hp stomaches carrying capacity point It is not:CotC groups 5.56 ± 1.64 × 105CFU/g；CotC-UreB groups 1.11 ± 0.36 × 105CFU/g；CotC-CTB-UreB Group 0.53 ± 0.21 × 105CFU/g) (Fig. 6).CotC groups and CotC-CTB groups andGroup indifference (p>0.05).Also, CotC-CTB-UreB gemma immune group stomach carrying capacity is substantially less than CotC-UreB (p<0.05).
Sequence table
<110>Zhou Zhenwen
<120>A kind of helicobacter pylori oral vaccine based on withered grass gemma carrier
<160>3
<210>1
<211>377
<212> DNA
<213>Bacillus subtilis（Bacillus subtilis）
<400> 1
tgtaggataa atcgtttggg ccgatgaaaa atcggctctt tattttgatt tgtttttgtg 60
tcatctgtct ttttctatca tttggacagc ccttttttcc ttctatgatt ttaactgtcc 120
aagccgcaaa atctactcgc cgtataataa agcgtagtaa aaataaagga ggagtatata 180
tgggttatta caaaaaatac aaagaagagt attatacggt caaaaaaacg tattataaga 240
agtattacga atatgataaa aaagattatg actgtgatta cgacaaaaaa tatgatgact 300
atgataaaaa atattatgat cacgataaaa aagactatga ttatgttgta gagtataaaa 360
agcataaaaa acactac 377
<210>2
<211>312
<212> DNA
<213>Comma bacillus (Vibrio cholerae)
<400> 2
acacctcaaa atattactga tttgtgtgca gaataccaca acacacaaat acatacgcta 60
aatgataaga tattttcgta tacagaatct ctagctggaa aaagagagat ggctatcatt 120
acttttaaga atggtgcaac ttttcaagta gaagtaccag gtagtcaaca tatagattca 180
caaaaaaaag cgattgaaag gatgaaggat accctgagga ttgcatatct tactgaagct 240
aaagtcgaaa agttatgtgt atggaataat aaaacgcctc atgcgattgc cgcaattagt 300
atggcaaatt aa 312
<210>3
<211>1680
<212> DNA
<213>Helicobacter pylori（Helicobacter pylori）
<400> 3
atgaaaaaga ttagcagaaa agaatatgtt tctatgtatg gccctactac aggcgataaa 60
gtgagattgg gcgatacaga cttgatcgct gaagtagaac atgactacac catttatggc 120
gaagagctta aattcggtgg cggtaagact ttgagagaag gcatgagcca atccaacaac 180
cctagcaaag aagaactaga tttaatcatc actaacgctt taatcgtgga ttacactggt 240
atttataaag cggatattgg tattaaagat ggcaaaatcg ctggcattgg caaaggcggt 300
aacaaagaca tgcaagatgg cgttaaaaac aatcttagcg tgggtcctgc tactgaagca 360
ctagctggtg aaggtttgat cgtaactgct ggtggtattg acacacacat ccacttcatc 420
tccccccaac aaatccctac agcttttgca agcggtataa caactatgat tggtggcgga 480
actggccctg ctgatggcac taacgcaacc actatcactc caggcagaag aaacttaaaa 540
tggatgctca gagcggctga agaatattct atgaacttag gtttcttggc taaaggtaac 600
acttctaacg atgcgagctt agccgatcaa attgaagccg gtgcgattgg ctttaaaatc 660
cacgaagact ggggaacaac tccttctgca atcaatcatg cgttagatgt tgcggacaaa 720
tatgatgtgc aagtcgctat ccacacagac actttgaatg aagccggttg tgtagaagac 780
actatggcag ccattgccgg acgcactatg cacactttcc acactgaagg tgctggtggc 840
ggacacgctc ctgatattat taaagtagcc ggcgaacaca acattctgcc cgcttccact 900
aaccccacta tccctttcac cgtgaataca gaagcagaac acatggacat gcttatggtg 960
tgccaccact tggataaaag cattaaagaa gatgttcagt tcgctgattc aaggattcgc 1020
cctcaaacca ttgcggctga agacactttg catgacatgg ggatcttctc aatcactagt 1080
tctgactctc aagctatggg tcgtgtgggt gaagttatca ccagaacttg gcaaacagct 1140
gacaaaaaca aaaaagaatt tggccgcttg aaagaagaaa aaggcgataa cgacaacttc 1200
aggatcaaac gctacttgtc taaatacacc attaacccag cgatcgctca tgggattagc 1260
gagtatgtag gttctgtaga agtgggcaaa gtggctgact tggtattgtg gagtccagca 1320
ttctttggcg tgaaacccaa catgatcatc aaaggtgggt tcattgcgtt aagtcaaatg 1380
ggcgatgcga acgcttctat ccctacccca caaccagttt attacagaga aatgttcgct 1440
catcatggta aagccaaata cgatgcaaac atcacttttg tgtctaaagc ggcttatgac 1500
aaaggcatta aagaagaatt agggcttgaa agacaagtgt tgccggtaaa aaattgcaga 1560
aacatcacta aaaaagacat gcaattcaac gacactaccg ctcacattga agtcaatcct 1620
gaaacttacc atgtgttcgt ggatggcaaa gaagtaactt ctaaaccagc cactaaagtg 1680

Claims (2)

1. a kind of helicobacter pylori oral vaccine based on withered grass gemma carrier, it is characterised in that its be by CotC-UreB or Cotc-CTB-UreB genetic fragments are transferred in expression vector, then by the expression containing CotC-UreB or Cotc-CTB-UreB Carrier conversion enters in bacillus subtilis, so that the helicobacter pylori oral vaccine based on withered grass gemma carrier is obtained, it is described CotC nucleotide sequence as shown in SEQ ID NO.1, described CTB nucleotide sequence is as shown in SEQ ID NO.2, institute The UreB stated nucleotide sequence is as shown in SEQ ID NO.3.
2. the helicobacter pylori oral vaccine according to claim 1 based on withered grass gemma carrier, it is characterised in that described Carrier be withered grass spore coat PROTEIN C otC fusion expression vectors pUS186-CotC.
CN201710188754.8A 2017-03-27 2017-03-27 A kind of helicobacter pylori oral vaccine based on withered grass gemma carrier Pending CN107184967A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710188754.8A CN107184967A (en) 2017-03-27 2017-03-27 A kind of helicobacter pylori oral vaccine based on withered grass gemma carrier

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710188754.8A CN107184967A (en) 2017-03-27 2017-03-27 A kind of helicobacter pylori oral vaccine based on withered grass gemma carrier

Publications (1)

Publication Number Publication Date
CN107184967A true CN107184967A (en) 2017-09-22

Family

ID=59871629

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710188754.8A Pending CN107184967A (en) 2017-03-27 2017-03-27 A kind of helicobacter pylori oral vaccine based on withered grass gemma carrier

Country Status (1)

Country Link
CN (1) CN107184967A (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1927394A (en) * 2006-09-05 2007-03-14 重庆康卫生物科技有限公司 Oral administration recombinant helicobacterpylori vaccine and preparing method thereof
CN101611143A (en) * 2006-11-10 2009-12-23 巴里·J·马沙尔 Delivery of peptides is gone into the method and apparatus of stomach mucous membrane
CN102133238A (en) * 2011-03-25 2011-07-27 南昌大学 Application of bacillus subtilis in antagonism helicobacter pylori
CN102604993A (en) * 2012-01-10 2012-07-25 天津耀宇生物技术有限公司 Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof
CN105801707A (en) * 2016-04-07 2016-07-27 中山大学 Oral vaccine for treating grass carp hemorrage as well as preparation and application thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1927394A (en) * 2006-09-05 2007-03-14 重庆康卫生物科技有限公司 Oral administration recombinant helicobacterpylori vaccine and preparing method thereof
CN101611143A (en) * 2006-11-10 2009-12-23 巴里·J·马沙尔 Delivery of peptides is gone into the method and apparatus of stomach mucous membrane
CN102133238A (en) * 2011-03-25 2011-07-27 南昌大学 Application of bacillus subtilis in antagonism helicobacter pylori
CN102604993A (en) * 2012-01-10 2012-07-25 天津耀宇生物技术有限公司 Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof
CN105801707A (en) * 2016-04-07 2016-07-27 中山大学 Oral vaccine for treating grass carp hemorrage as well as preparation and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ZHENWEN ZHOU等: "Expression of Helicobacter Pylori Urease B on the Surface of Bacillus Subtilis Spores", 《JOURNAL OF MEDICAL MICROBIOLOGY》 *
ZHENWEN ZHOU等: "Recombinant Bacillus subtilis spores expressing cholera toxin B subunit and Helicobacter pylori urease B confer protection against H. pylori in mice", 《JOURNAL OF MEDICAL MICROBIOLOGY》 *
周珍文等: "表面表达幽门螺杆菌中性粒细胞激活蛋白枯草芽孢的免疫原性", 《中华生物医学工程杂志》 *

Similar Documents

Publication Publication Date Title
US8900594B2 (en) Oral recombinant Helicobacter pylori vaccine and preparing method thereof
Clark-Curtiss et al. Salmonella vaccines: conduits for protective antigens
Abkar et al. Oral immunization of mice with Omp31-loaded N-trimethyl chitosan nanoparticles induces high protection against Brucella melitensis infection
Chen et al. Enhancement of Helicobacter pylori outer inflammatory protein DNA vaccine efficacy by co‐delivery of interleukin‐2 and B subunit heat‐labile toxin gene encoded plasmids
Ascón et al. Oral immunization with a Salmonella typhimurium vaccine vector expressing recombinant enterotoxigenic Escherichia coli K99 fimbriae elicits elevated antibody titers for protective immunity
Tarahomjoo Development of vaccine delivery vehicles based on lactic acid bacteria
Qiao et al. Recombinant lactic acid bacteria as promising vectors for mucosal vaccination
Bhatia et al. Edible vaccines
Hongli et al. Transgenic tobacco expressed HPV16-L1 and LT-B combined immunization induces strong mucosal and systemic immune responses in mice
Liu et al. Recombinant invasive Lactobacillus plantarum expressing the Eimeria tenella fusion gene TA4 and AMA1 induces protection against coccidiosis in chickens
Yang et al. Alleviation of enterotoxigenic Escherichia coli challenge by recombinant Lactobacillus plantarum expressing a FaeG-and DC-targeting peptide fusion protein
Artnzen Edible vaccines.
Levit et al. Use of genetically modified lactic acid bacteria and bifidobacteria as live delivery vectors for human and animal health
Wang et al. Oral immunization of chickens with Lactococcus lactis expressing cjaA temporarily reduces Campylobacter jejuni colonization
CN100537749C (en) Express the reorganization bacterium of enterotoxin colibacillus adhesin gene and the application in Yolk antibody feed thereof
CN100579578C (en) Pyloric spiral bacillus antigen recombinant vaccine
Cai et al. Oral immunization with surface immunogenic protein from Streptococcus agalactiae expressed in Lactococcus lactis induces protective immune responses of tilapia (Oreochromis niloticus)
CN107961373A (en) A kind of strain of gene engineered subunit oral vaccine and its construction method and purposes for being used to prevent pig epidemic diarrhea
Saggese et al. The bacterial spore as a mucosal vaccine delivery system
Villena et al. Oral immunization with recombinant Lactococcus lactis confers protection against respiratory pneumococcal infection
Pan et al. Oral delivery of novel recombinant lactobacillus elicit high protection against staphylococcus aureus pulmonary and skin infections
CN107184967A (en) A kind of helicobacter pylori oral vaccine based on withered grass gemma carrier
CN107098976B (en) Recombinate LTB-CTB carrier proteins and its preparation method and application
Bai et al. Immunogenicity of 987P fimbriae of enterotoxigenic Escherichia coli surface-displayed on Lactobacillus casei
CN116785418A (en) Fish-source streptococcus agalactiae subunit vaccine and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination