CN107177690B - Dual TaqMan fluorescence quantitative PCR (polymerase chain reaction) detection method for pathogen of bee larva putrid disease - Google Patents
Dual TaqMan fluorescence quantitative PCR (polymerase chain reaction) detection method for pathogen of bee larva putrid disease Download PDFInfo
- Publication number
- CN107177690B CN107177690B CN201710562144.XA CN201710562144A CN107177690B CN 107177690 B CN107177690 B CN 107177690B CN 201710562144 A CN201710562144 A CN 201710562144A CN 107177690 B CN107177690 B CN 107177690B
- Authority
- CN
- China
- Prior art keywords
- larvae
- fluorescence
- sample
- fam
- bee
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of pathogen detection, and discloses a dual TaqMan fluorescence quantitative PCR detection method for bee larva rancidity pathogen, which utilizes two probes, wherein a 5 ' end of one probe adopts relatively mature FAM as a fluorescence report group, a 5 ' end of the other probe selects VIC as a marker, and a 3 ' end of the two probes selects BHQ1 non-fluorescence quenching groups. The method of the invention has no cross reaction with other pathogens; positive plasmids with the detection sensitivity of both P.larvae and M.pluton reaching 10 copies/. mu.L; the repeatability test results show that the variation coefficient in batches and between batches is less than 2 percent.
Description
Technical Field
The invention belongs to the technical field of pathogen detection, and particularly relates to a dual TaqMan fluorescence quantitative PCR (polymerase chain reaction) detection method for pathogen of bee larva rancidity.
Background
American Foulbrood of Bees (AFB) and European Foulbrood of Bees (EFB) are two important bacterial diseases of bees, pathogens are respectively Bacillus larvae (P.larvae) and Melissococcus pluton (M.pluton) which are distributed worldwide, the world animal health Organization (OIE) classifies the pathogens as legal report animal epidemic diseases, China classifies the pathogens as two types of animal epidemic diseases and entry animal quarantine diseases, and China is two types of bee epidemic diseases which are mainly inspected in entry bees and bee products of China migratory beekeeping and countries in the world. Larvae can produce spores under certain conditions, has extremely strong viability, and causes are difficult to control and purify; pluton does not produce spores, but has strong resistance to external adverse environment, can survive for years on dead bee bodies, can keep long-term toxicity in honey, and has extremely strong infectivity. Both AFB and EFB infect and harm bee larvae, are similar in disease symptoms and are easy to misdiagnose, so that the development of synchronous identification and early diagnosis research on AFB and EFB is of great significance. At present, the laboratory diagnosis methods of AFB and EFB mainly comprise methods of bacterial smear microscopy, separation culture, agglutination test, nucleic acid detection and the like, the existing diagnosis methods are all based on pathogen separation culture identification, as the requirements of bacillus larvae and bee hive coccus on culture conditions are extremely strict, the separation culture is difficult, the diagnosis methods are difficult to accurately diagnose and popularize and apply the American foul brood and the European foul brood, the reported AFB and EFB multiplex PCR diagnosis method is common PCR, the method can only analyze final products, can not accurately quantify an initial template and monitor amplification reaction in real time, the amplification reaction is analyzed by means of electrophoresis after the end of the amplification reaction, the flow is complex, toxic substances such as EB and the like are used in a laboratory, the reported fluorescence quantitative PCR is a single PCR method, and the aim of simultaneously detecting two pathogens in the same reaction tube can not be realized, a report of the AFB and EFB pathogenic bacteria dual TaqMan fluorescence quantitative PCR detection method is not found at home and abroad.
In summary, the problems of the prior art are as follows:
1. the methods of separation culture, agglutination test and the like are all based on the pathogen separation culture identification, the requirements of the larval bacillus and the honey bee hive coccus on the culture conditions are extremely strict, the separation culture is difficult, the accurate diagnosis of the disease is difficult, and the diagnosis method is difficult to popularize and apply.
2. Various PCR methods are established in laboratory diagnosis of AFB and EFB in China, but the PCR method which has independent intellectual property rights, is rapid, accurate, high-flux and easy to popularize is lacked in China, and is not beneficial to prevention and control of bee blight in China.
3. At present, the established AFB and EFB multiplex PCR diagnosis method is common PCR, only can analyze final products, cannot accurately quantify an initial template and monitor an amplification reaction in real time, must be analyzed by an electrophoresis method after the amplification reaction is finished, has complex flow and uses toxic substances such as EB and the like in a laboratory.
4. At present, the established AFB and EFB fluorescent quantitative PCR methods are single PCR methods, and the purpose of simultaneously detecting two pathogens in the same reaction tube cannot be realized.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a dual TaqMan fluorescence quantitative PCR detection method for pathogens of bee larva rancidity.
The invention is realized in such a way, the dual TaqMan fluorescence quantitative PCR detection method for the pathogen of the bee larva putrid disease utilizes two probes, the 5 ' end of one probe adopts relatively mature FAM as a fluorescence reporter group, the 5 ' end of the other probe selects VIC as a marker, and the 3 ' ends of the two probes select BHQ1 non-fluorescence quenching groups.
Further, the specific detection process is as follows:
1. DNA extraction: extracting DNA in a sample, a positive control and a negative control by adopting a CTAB method or a boiling method or other conventional DNA extraction methods;
2. contrast setting: using Bacillus larvae, Apiococcus alvei or positive plasmid containing target DNA fragment as positive control, using healthy Apis larva DNA as negative control, and simultaneously establishing template-free blank control;
3. 25 μ L PCR reaction configuration: to the PCR tube, 12.5. mu.L of PremixEx Taq (2X), 1. mu.L of P.larvae F (10. mu. mol/L), 1. mu.L of P.larvae R (10. mu. mol/L), 1. mu.L of P.larvae P (10. mu. mol/L), 1. mu.L of M.pluton F (10. mu. mol/L), 1. mu.L of M.pluton R (10. mu. mol/L), 1. mu.L of M.pluton P (10. mu. mol/L), 1. mu.L of template DNA, sterilized ddH, was added2O5.5 mu L, so that the total volume of the reaction is 25.0 mu L;
4. PCR reaction procedure: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 15s and annealing extension at 59 ℃ for 50s for 40 cycles, and collecting fluorescence signals during annealing extension;
5. and (4) judging a result: negative control and blank control have no FAM and VIC fluorescence signal detection, no Ct value and no amplification curve, positive control uses Bacillus larvae DNA or bee hive coccus DNA or mixed positive plasmid, FAM and VIC fluorescence signal detection is carried out simultaneously, a typical amplification curve appears, Ct values are all less than or equal to 35.0, for only using Bacillus larvae DNA or bee hive coccus DNA or positive plasmid thereof, each tube only has FAM or VIC fluorescence signal correspondingly, each fluorescence signal has obvious amplification curve, Ct values are all less than or equal to 35.0, the test is indicated as effective test, otherwise, the test is invalid; under the condition that the test is effective, the FAM and VIC fluorescence of the sample to be tested are detected simultaneously, a typical amplification curve appears, Ct values are both less than or equal to 35.0, the test is judged to be positive, the test shows that the bacillus larvae and the bee hive cocci are detected simultaneously from the sample, only the FAM fluorescence is detected, the typical amplification curve appears, the Ct value is less than or equal to 35.0, the test is judged to be positive, the test shows that only the bee hive cocci are detected from the sample, no FAM or VIC fluorescence is detected, no amplification curve exists, no Ct value is judged to be negative, and the test shows that no bacillus larvae or bee hive cocci are detected from the sample; and (3) re-detecting the sample with the Ct value of the sample to be detected being more than 35.0, detecting no FAM or VIC fluorescence in the re-detection result, judging the sample to be negative, indicating that no bacillus larvae or bee hive coccus is detected in the sample, detecting FAM or VIC fluorescence in the re-detection result, judging the sample to be positive, and indicating that the bacillus larvae or bee hive coccus is detected in the sample. The retesting needs to be started from the extraction of DNA for retesting, the detection rate can be improved from multiple aspects as much as possible, and the detection process can be adjusted and optimized according to various specific conditions in several factors of selectable usage amount, such as increasing the sample sampling amount, reducing the TE dosage for dissolving DNA, increasing the template amount added in PCR reaction, properly increasing the number of PCR reaction cycles and the like. Single fluorescent quantitative PCR detection can also be carried out on one of the suspected pathogenic bacteria.
The invention has the advantages and positive effects that: in order to rapidly identify and diagnose American foulbrood and European foulbrood of bees (AFB) and EFB, specific primers and probes are respectively designed according to gene sequences of bacillus larvae (P.larvae) and melissococcus alvei (M.pluton)16S rRNA logged in GenBank, and a dual TaqMan fluorescence quantitative PCR detection method is established. The results show that: the method of the invention has no cross reaction with other pathogens; positive plasmids with the detection sensitivity of both P.larvae and M.pluton reaching 10 copies/. mu.L; the repeatability test results show that the variation coefficient in batches and between batches is less than 2 percent. 200 laboratory simulated samples and 200 clinical samples were tested, consistent with the expected results.
The method established by the invention can be used for rapid differential diagnosis and early monitoring of AFB and EFB and quantitative analysis of P.larvae and M.pluton in bee products; a dual TaqMan fluorescence quantitative PCR detection method for AFB and EFB pathogens is established, and technical support is provided for early synchronous diagnosis of AFB and EFB and inspection and quarantine of P.larvae and M.pluton in bee and bee products.
The established dual TaqMan fluorescence quantitative PCR detection method for pathogen of the bee larva putrid disease can be directly used for detecting the bacillus larvae and the bee hive in clinical samples and polluted bee products, does not need pathogen culture, has simple operation and accurate result, is suitable for early monitoring and is easy to popularize and apply.
The primers and the probes of the established dual TaqMan fluorescence quantitative PCR detection method for the pathogen of the bee larva rancidity disease are designed by self, an optimal reaction system and reaction conditions are obtained through optimization of test parameters, the blank of carrying out simultaneous differential diagnosis on American bee larva rancidity disease and European bee larva rancidity disease by using the method at home and abroad is filled, the method belongs to a bee disease diagnosis method independently developed in China, and a new effective technical means is provided for prevention and control of the bee disease in China.
The dual TaqMan fluorescence quantitative PCR detection method for detecting pathogen of bee larva putrid disease, which is established by the invention, has the advantages that the test process is totally closed, the instrument automatically analyzes and obtains the test result, no subsequent test operation is needed, the accurate quantification of the initial template and the real-time monitoring of the amplification reaction can be realized, and the specificity, the sensitivity, the automatic control degree and the like of the method are higher than those of the common PCR.
The established dual TaqMan fluorescence quantitative PCR detection method for the pathogens of the bee larva putrid disease can synchronously detect two pathogens of the larval bacillus and the honeycomb bee cocci in the same reaction tube, can also carry out single fluorescence quantitative PCR detection aiming at one suspected pathogen, has the characteristics of rapidness, sensitivity, high flux and the like, and saves the detection time and the detection cost.
Drawings
FIG. 1 is a flow chart of a dual TaqMan fluorescence quantitative PCR detection method for pathogen of foulbrood of honeybee larvae provided by the embodiment of the present invention.
Fig. 2 is a schematic diagram of amplification of a p.larvae positive template provided by an embodiment of the invention;
in the figure: m: DL2000 DNAmarker; 1: PCRproduct; 2: negative control.
Fig. 3 is a schematic diagram of amplification of an m.pluton positive template provided in an embodiment of the present invention;
in the figure: m: DL2000 DNAmarker; 1: PCRproduct; 2: negative control.
FIG. 4 is a schematic diagram of a standard curve for detecting pXT-P standard by dual fluorescent quantitative PCR provided by the embodiment of the invention.
FIG. 5 is a schematic diagram of a standard curve for detecting pXT-M standard by dual fluorescent quantitative PCR provided by the embodiment of the invention.
FIG. 6 is a schematic diagram of a dual fluorescent quantitative PCR specific assay amplification curve provided in an embodiment of the present invention;
in the figure: 1: m.pluton; 2: larvae; 3: nosema apis; 4: asosphaera apis; 5: sacbroudbee virus; 6: a pharmaceutical bee analysis virus; 7: healthy bee larvae.
FIG. 7 is a schematic diagram of a dual fluorescent quantitative PCR sensitivity test provided in an embodiment of the present invention;
in the figure: 1-8: larvae 1.3 × 107copies/μL～1.3×100copies/μL；A-H：M.pluton 1.0×107copies/μL～1.0×100copies/μL；N：Negative control。
FIG. 8 is a diagram of a generic PCR sensitivity assay provided in an embodiment of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
The following detailed description of the principles of the invention is provided in connection with the accompanying drawings.
The dual TaqMan fluorescence quantitative PCR detection method for the pathogen of the foul brood of the bee larvae provided by the embodiment of the invention utilizes the 5 ' end of one probe to adopt relatively mature FAM as a fluorescence reporter group, the 5 ' end of the other probe selects VIC as a marker, and the 3 ' ends of the two probes select BHQ1 non-fluorescence quenching groups. Larvae F/P.larvae R SEQ ID NO: 1 and one probe p.larvae PSEQ ID NO: 2. a pair of melissococcus nidus primers M.pluton F/M.pluton R SEQ ID NO: 3 and one probe m.pluton P SEQ ID NO: 4.
as shown in fig. 1, the dual TaqMan fluorescence quantitative PCR detection method for pathogen of foulbrood of honeybee provided by the embodiment of the present invention includes the following steps:
s101: DNA extraction: extracting DNA in a sample, a positive control and a negative control by adopting a CTAB method or a boiling method or other conventional DNA extraction methods;
s102: contrast setting: using Bacillus larvae, Apiococcus alvei or positive plasmid containing target DNA fragment as positive control, using healthy Apis larva DNA as negative control, and simultaneously establishing template-free blank control;
s103: 25 μ L PCR reaction configuration: to the PCR tube, 12.5. mu.L of PremixEx Taq (2X), 1. mu.L of P.larvae F (10. mu. mol/L), 1. mu.L of P.larvae R (10. mu. mol/L), 1. mu.L of P.larvae P (10. mu. mol/L), 1. mu.L of M.pluton F (10. mu. mol/L), 1. mu.L of M.pluton R (10. mu. mol/L), 1. mu.L of M.pluton P (10. mu. mol/L), 1. mu.L of template DNA, sterilized ddH, was added2O5.5 mu L, so that the total volume of the reaction is 25.0 mu L;
s104: PCR reaction procedure: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 15s and annealing extension at 59 ℃ for 50s for 40 cycles, and collecting fluorescence signals during annealing extension;
s105: and (4) judging a result: negative control and blank control have no FAM and VIC fluorescence signal detection, no Ct value and no amplification curve, positive control uses Bacillus larvae DNA and Beacon bee-coccus DNA or mixed positive plasmid, FAM and VIC fluorescence signal detection is carried out simultaneously, and a typical amplification curve appears, the Ct value is less than or equal to 35.0, for respectively using only Bacillus larvae DNA or Beacon bee-coccus DNA or positive plasmid thereof, each tube only has FAM or VIC fluorescence signal correspondingly, each fluorescence signal has an obvious amplification curve, and the Ct value is less than or equal to 35.0 respectively, the test is indicated as an effective test, otherwise, the test is invalid.
The effects of the present invention will be described in detail with reference to the following experiments.
1 materials and methods
1.1 Strain/Vibrio/insect strain P.larvae is purchased from Beijing Beinanna institute of Biotechnology, M.pluton is purchased from American type culture Collection, and Microsporozoans apis mellifera (Nosema apis), ascosphaera apis (Asosphera apis), Cysticta larva virus (Sacbropodbee virus), and Chronic bee paralysis virus (Chronic bee biology virus) are separated and stored by the Integrated technology service center of Ili Rougo-entry inspection and quarantine.
1.2 the main reagent and instrument genome DNA extraction kit and RNA extraction kit are purchased from QIAGEN company; PremixEx Taq (Probe qPCR), PrimeScript RT-PCR Kit, pXT19-T vector, gel recovery Kit, plasmid miniprep Kit and the like were purchased from Takara Bio Inc. ABI 7500Real Time PCR System was purchased from applied biosystems, USA.
1.3 design and Synthesis of primers and probes A pair of Bacillus larvae primers P.larvae F/P.larvae R SEQ ID NO: 1 and one probe p.larvae PSEQ ID NO: 2. a pair of melissococcus nidus primers M.pluton F/M.pluton R SEQ ID NO: 3 and one probe m.pluton P SEQ ID NO: 4 (table 1). The primers and probes were synthesized by Beijing ancient China Changsheng biotechnology Co.
TABLE 1 primer and Probe sequences
1.4 preparation of standard substance P.larvae and M.pluton genomes are extracted as templates, common PCR amplification is carried out by applying specific primers, PCR products are cloned to pXT19-TVector respectively, recombinant plasmids pXT-P and pXT-M are constructed and transformed to E.coli DH5 alpha competent cells, after overnight shaking at 37 ℃, plasmids are extracted for common PCR and sequencing verification, and correct recombinant plasmid determination concentration is identified to be used as a standard substance of dual fluorescence quantitative PCR.
1.5 reaction system and condition optimization Single-fold and double-fold fluorescence quantitative PCR all adopt PremixEx Taq (Probe qPCR) reagent to perform tests on ABI 7500 type fluorescence quantitative PCR instrument. The concentrations of the primers and the probes in the double fluorescent quantitative PCR reaction system and the annealing and extension temperatures and time in the reaction conditions are optimized on the basis of the single fluorescent quantitative PCR reaction system and the reaction conditions.
1.6 establishment of Standard Curve pXT-P and pXT-M standards were serially diluted 10 times, standards of different dilution gradients were used as templates, and double fluorescent quantitative PCR was performed according to optimized system conditions to draw a Standard Curve.
1.7 specificity test to extract P.larvae, M.pluton, Nosema apis, Asosparaa apis, Sacbrobodbee virus, Chonic bee analysis virus, healthy bee larva nucleic acid, Sacbrood bee virus and Chonic bee analysis virus RNA inverse transcription to cDNA, then single and double fluorescence quantitative PCR detection is carried out to determine the specificity of the method.
1.8 sensitivity assay 10-fold serial dilutions of 8 gradients (10) were made with known concentrations of pXT-P and pXT-M standards (10X-and M-fold)7Copy/. mu.L-100Copy/. mu.L) as templates, respectively, performing double fluorescence quantitative PCR according to optimized system conditions, and determining the minimum detection amount of the reaction. And simultaneously carrying out common PCR reaction, and comparing the sensitivity of the two detection methods.
1.9 repeatability test 5 pXT-P and pXT-M standard substances serially diluted by 10 times are respectively selected as templates, each concentration is repeatedly detected for 3 times, and the variation coefficient in batch is calculated according to the Ct value; and (3) respectively taking the standard substances with different concentrations as templates, carrying out fluorescence quantitative PCR detection at 3 different times, calculating inter-batch variation coefficients according to Ct values, and evaluating the repeatability and stability of the method.
1.10 laboratory simulation sample and clinical sample detection quantitative different dilutions of pXT-P and pXT-M standards were incorporated into larvae, pupae, adult bees, honey, propolis, royal jelly and pollen samples to make 200 laboratory simulation samples; 200 parts of bee larvae and bee products collected from Xinjiang are taken as clinical samples and detected by applying the established double-fluorescence quantitative PCR method.
2 results
2.1 preparation of standard substance P.larvae DNA and M.pluton DNA were amplified by ordinary PCR to obtain target fragments (FIG. 2, FIG. 3) with lengths of about 130bp and 160bp, and the homology of PCR products with the accession sequence in GenBank was up to 100% by sequencing analysis. Cloning the target fragment into pXT19-T Vector to construct pXT-P and pXT-M recombinant plasmid standard, and identifying the recombinant plasmid standard to be correct through common PCR and sequencing.
2.2 reaction system and reaction conditions are optimized by optimizing the optimal concentration ratio of primers and probes and the annealing and extension temperature and time by using a matrix method. And (3) optimizing a double-fluorescence quantitative PCR reaction system and reaction conditions (table 2).
TABLE 2 Dual fluorescent quantitative PCR reaction System and reaction conditions
2.3 establishment of Standard Curve pXT-P and pXT-M Standard substance were serially diluted 10 times and subjected to double fluorescent quantitative PCR to obtain the Standard Curve, the results showed that the Standard substance concentration was 107The copy/. mu.L-10 copies/. mu.L has good linear relativity, and the correlation coefficients of the two standard curves are R20.999. The linear equations are Ct-3.381 × log CO +36.56(pXT-P) (fig. 4) and Ct-3.495 × log CO +41.24(pXT-M) (fig. 5), respectively.
2.4 specific test double fluorescent quantitative PCR specific detection results show that P.larvae and M.pluton both generate amplification curves, and the cycle threshold is less than 35. No amplification curves were generated by any of the other pathogenic, healthy bee larvae (FIG. 6).
2.5 sensitivity assay 8 gradients (10) diluted 10-fold in series7Copy/. mu.L-100Copies/. mu.L) of pXT-P and pXT-M standards, respectivelyThe double fluorescent quantitative PCR and the common PCR detection are carried out on the template, and the result shows that the minimum detection amount of the double fluorescent quantitative PCR is 10 copies/. mu.L (figure 7), and the minimum detection amount of the common PCR is 103Copy/. mu.L (FIG. 8), indicating an approximately 100-fold increase in sensitivity of fluorescent quantitative PCR over conventional PCR.
2.6 repeatability tests in batches and among batches were carried out by selecting 5 pXT-P and pXT-M standards diluted 10 times, and the Coefficient of Variation (CV) was calculated according to the Ct value of the amplification reaction, and the results showed that the coefficient of variation was less than 2% (Table 3), indicating that the established method had better repeatability.
TABLE 3 Dual fluorescent quantitative PCR repeatability test
2.7 sample detection Using the established Dual fluorescent quantitative PCR method and common PCR method to detect 200 laboratory simulation samples and 200 bee larvae and bee product clinical samples collected in Xinjiang, the results show that the laboratory simulation samples with the concentrations of added pXT-P and pXT-M standard substance of 10 copies/. mu.L are positive, and the concentrations of added pXT-P and pXT-M standard substance of 10 copies/. mu.L are positive3Common PCR detection of laboratory simulation samples with copy/microliter is positive, and results of two detection methods of bee larva and bee product clinical samples are negative, which shows that the dual fluorescence quantitative PCR has good clinical sensitivity and applicability.
AFB and EFB pathogens can be widely distributed in pollen, sugar solution, feed trough, honeycomb, etc. which are contacted by sick bees, and these can be used as main infection sources, p.larvae and m.pluton have strong resistance to the outside, meanwhile, the disease is spread in bee colonies by robbers and hives, so that it is very difficult to completely eliminate these pathogens, which also affects the bee colony vigor and the yield and quality of bee products to a great extent. The clinical symptoms of the two epidemic diseases are similar and misdiagnosis is easy, so that the development of synchronous identification and early diagnosis research on AFB and EFB has important significance.
The multiplex fluorescence quantitative PCR method is a technology developed on the basis of single fluorescence quantitative PCR, a plurality of sets of primers and probes are added into the same reaction system, the 5' end of the probe is marked with luminescent groups with different wavelengths, and the multiplex fluorescence quantitative PCR method can be used for simultaneously detecting a plurality of target genes, has the characteristics of rapidness, sensitivity, high flux and the like, and has become one of the main means for detecting pathogens and analyzing pathology in a laboratory. The invention establishes a double TaqMan probe fluorescent quantitative PCR detection method of P.larvae and M.pluton, realizes the purpose of simultaneously detecting two pathogens in the same reaction tube, and saves the detection time and the detection cost. The problem of mutual interference between two pairs of primers and probes is solved through a reaction system and condition optimization, when the probes are designed, FAM and VIC report groups with fluorescence emission wavelengths in different spectral ranges are respectively marked at the 5 'ends of the P.larvae and M.pluton probes, mutual interference is not easy, BHQ1 is marked at the 3' end as a fluorescence quenching group, fluorescence is not generated by the modification group, the quenching efficiency is higher, the intensity of background signals is greatly reduced, and the sensitivity of the method is improved. The results of 200 parts of simulation samples and 200 parts of clinical samples prepared by the double-fluorescence quantitative PCR established by the invention and a common PCR detection laboratory show that the double-fluorescence quantitative PCR method established by the invention has higher sensitivity, and the technical verification tests show that the method has good specificity, repeatability and wide applicability. The TaqMan probe dual fluorescent quantitative PCR method established by the invention can be used for rapid differential diagnosis, early monitoring and epidemiological investigation of AFB and EFB and quantitative analysis of P.larvae and M.pluton in bee products.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
<110> Yili entry and exit inspection and quarantine bureau comprehensive technical service center, Xinjiang entry and exit inspection and quarantine technical center, Yili professional technical college
<120> dual TaqMan fluorescence quantitative PCR detection method for pathogen of bee larva putrid disease
<160> 4
<210> 1
<211>45
<212>RNA
<213> Artificial sequence
<400> nucleotide sequence
P.larvae F CTAATACATGCAAGTCGAGCGGA
P.larvae R GGTATTAGCTCACGTTTCCGCA
<210> 2
<211>25
<212>RNA
<213> Artificial sequence
<400> nucleotide sequence
P.larvae P FAM-CTTGTGTTTCTTTCGGGAGACGCCA-BHQ1
<210> 3
<211>43
<212>RNA
<213> Artificial sequence
<400> nucleotide sequence
M.pluton F CCATCAGAAGGGGATAACACTTG
M.pluton R ATCGTTGCCTTGGTGAGCCT
<210> 4
<211>25
<212>RNA
<213> Artificial sequence
<400> nucleotide sequence
M.pluton P VIC-CGCATGAAGAGGAGTTAAAAGGCGC-BHQ1
Claims (1)
1. A probe and a primer applied in dual TaqMan fluorescence quantitative PCR detection of pathogen of bee larva foul brood are characterized in that the probe is two probes, FAM is adopted as a fluorescence reporter group at the 5 ' end of one probe, VIC is selected as a marker at the 5 ' end of the other probe, and BHQ1 non-fluorescence quenching groups are selected as non-fluorescence quenching groups at the 3 ' ends of the two probes; larvae F/P.larvae R SEQ ID NO: 1 and one probe p.larvae P SEQ ID NO: 2. a pair of melissococcus nidus primers M.pluton F/M.pluton R SEQ ID NO: 3 and one probe m.pluton P SEQ ID NO: 4;
the application process of the probe and the primer in the dual TaqMan fluorescence quantitative PCR detection of the pathogen of the bee larva putrid disease comprises the following steps:
DNA extraction: extracting DNA in a sample, a positive control and a negative control by adopting a CTAB method or a boiling method or other conventional DNA extraction methods;
contrast setting: using Bacillus larvae, Apiococcus alvei or positive plasmid containing target DNA fragment as positive control, using healthy Apis larva DNA as negative control, and simultaneously establishing template-free blank control;
25 μ L PCR reaction configuration: add PremixEx Taq 12.5. mu.L, P.larvae F1. mu.L, P.larvae R1. mu.L, P.larvae P1. mu.L, M.pluton F1. mu.L, M.pluton R1. mu.L, M.pluton P1. mu.L, template DNA 1. mu.L to PCR tube, add sterilized ddH2O5.5 mu L, so that the total volume of the reaction is 25.0 mu L;
PCR reaction procedure: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 15s and annealing extension at 59 ℃ for 50s for 40 cycles, and collecting fluorescence signals during annealing extension;
and (4) judging a result: negative control and blank control have no FAM and VIC fluorescence signal detection, no Ct value and no amplification curve, positive control uses Bacillus larvae DNA or bee hive coccus DNA or mixed positive plasmid, FAM and VIC fluorescence signal detection is carried out simultaneously, a typical amplification curve appears, Ct values are all less than or equal to 35.0, for only using Bacillus larvae DNA or bee hive coccus DNA or positive plasmid thereof, each tube only has FAM or VIC fluorescence signal correspondingly, each fluorescence signal has obvious amplification curve, Ct values are all less than or equal to 35.0, the test is indicated as effective test, otherwise, the test is invalid; under the condition that the test is effective, the FAM and VIC fluorescence of the sample to be tested are detected simultaneously, a typical amplification curve appears, Ct values are both less than or equal to 35.0, the test is judged to be positive, the test shows that the bacillus larvae and the bee hive cocci are detected simultaneously from the sample, only the FAM fluorescence is detected, the typical amplification curve appears, the Ct value is less than or equal to 35.0, the test is judged to be positive, the test shows that only the bee hive cocci are detected from the sample, no FAM or VIC fluorescence is detected, no amplification curve exists, no Ct value is judged to be negative, and the test shows that no bacillus larvae or bee hive cocci are detected from the sample; and (3) re-detecting the sample with the Ct value of the sample to be detected being more than 35.0, detecting no FAM or VIC fluorescence in the re-detection result, judging the sample to be negative, indicating that no bacillus larvae or bee hive coccus is detected in the sample, detecting FAM or VIC fluorescence in the re-detection result, judging the sample to be positive, and indicating that the bacillus larvae or bee hive coccus is detected in the sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710562144.XA CN107177690B (en) | 2017-07-11 | 2017-07-11 | Dual TaqMan fluorescence quantitative PCR (polymerase chain reaction) detection method for pathogen of bee larva putrid disease |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710562144.XA CN107177690B (en) | 2017-07-11 | 2017-07-11 | Dual TaqMan fluorescence quantitative PCR (polymerase chain reaction) detection method for pathogen of bee larva putrid disease |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107177690A CN107177690A (en) | 2017-09-19 |
| CN107177690B true CN107177690B (en) | 2020-11-24 |
Family
ID=59837333
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710562144.XA Expired - Fee Related CN107177690B (en) | 2017-07-11 | 2017-07-11 | Dual TaqMan fluorescence quantitative PCR (polymerase chain reaction) detection method for pathogen of bee larva putrid disease |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107177690B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109825618B (en) * | 2019-04-01 | 2022-11-22 | 福建出入境检验检疫局检验检疫技术中心 | Dual PCR detection method for detecting bee-brood cocci and bee larva bacillus |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101792799A (en) * | 2010-01-15 | 2010-08-04 | 吉林出入境检验检疫局检验检疫技术中心 | PCR quick detection method for bee European foul brood |
| WO2015113175A1 (en) * | 2014-01-30 | 2015-08-06 | Universidad Del Desarrollo | Biocide composition for controlling pests affecting european honey bees, comprising a water-soluble olea europaea extract |
| CN106755494A (en) * | 2017-01-26 | 2017-05-31 | 福建出入境检验检疫局检验检疫技术中心 | Bee venoms fluorescent quantificationally PCR detecting kit and its detection method |
-
2017
- 2017-07-11 CN CN201710562144.XA patent/CN107177690B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101792799A (en) * | 2010-01-15 | 2010-08-04 | 吉林出入境检验检疫局检验检疫技术中心 | PCR quick detection method for bee European foul brood |
| WO2015113175A1 (en) * | 2014-01-30 | 2015-08-06 | Universidad Del Desarrollo | Biocide composition for controlling pests affecting european honey bees, comprising a water-soluble olea europaea extract |
| CN106755494A (en) * | 2017-01-26 | 2017-05-31 | 福建出入境检验检疫局检验检疫技术中心 | Bee venoms fluorescent quantificationally PCR detecting kit and its detection method |
Non-Patent Citations (1)
| Title |
|---|
| The prevalence of the honeybee brood pathogens Ascosphaera apis, Paenibacillus larvae and Melissococcus plutonius in Spanish apiaries determined with a new multiplex PCR assay;Encarna Garrido-Bailon等;《Microbial Biotechnology》;20130806;第6卷(第6期);第731页摘要、第737页左栏第3-5段、第738页表4及左栏第1段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107177690A (en) | 2017-09-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102146466B (en) | Reagent for detecting brucella and complex probe fluorescence quantitative PCR (polymerase chain reaction) brucella detection method | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN106947838A (en) | African swine fever virus nonstructural gene real-time fluorescence LAMP detection primer group, kit and detection method | |
| CN108384899B (en) | Fluorescent quantitative PCR kit for detecting novel goose astrovirus and application thereof | |
| CN113957172B (en) | Kit for simultaneously detecting various cat pathogens and detection method and application thereof | |
| CN109439801B (en) | Real-time fluorescence RT-PCR detection kit and detection method for israel acute paralysis virus of bees | |
| CN101613751A (en) | The PCR kit for fluorescence quantitative of rapid detection toxoplasma gondii | |
| CN107177690B (en) | Dual TaqMan fluorescence quantitative PCR (polymerase chain reaction) detection method for pathogen of bee larva putrid disease | |
| CN104911277B (en) | A kind of kit and its detection method for detecting human immunodeficiency virus type 1 in dry blood cake sample | |
| CN101381767A (en) | Universal real time fluorescent PCR detection method of trichinella | |
| CN110607398B (en) | RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus | |
| CN109811073B (en) | Primer for rapidly detecting streptococcus agalactiae and streptococcus iniae at early stage by double PCR (polymerase chain reaction) and application of primer | |
| CN112301163A (en) | Kit for detecting and identifying capripoxvirus viruses and use method thereof | |
| CN111979355A (en) | TaqMan probe method fluorescent quantitative PCR detection kit for large yellow croaker iridovirus and preparation method thereof | |
| CN108103152B (en) | Rapid detection method for Listonella anguillarum | |
| CN109628640B (en) | RPA-LFD primer, method and kit for rapidly detecting spring viremia of carp virus | |
| CN107190081A (en) | Bee venoms TaqMan fluorescent quantitative PCR detection methods | |
| CN107974516A (en) | For detecting primer and probe, the PCR kit for fluorescence quantitative and methods and applications of porcine circovirus 2 type | |
| CN109825618B (en) | Dual PCR detection method for detecting bee-brood cocci and bee larva bacillus | |
| Zhao et al. | Development and application of isothermal amplification methods for rapid detection of F4 fimbriae producing Escherichia coli | |
| Zhu et al. | Onsite and visual detection of ranavirus in largemouth bass (Micropterus salmoides) by an isothermal recombinase polymerase amplification method | |
| CN112342317A (en) | Nucleic acid sequence combination, kit and detection method for LAMP-CRISPR (loop-mediated isothermal amplification-CRISPR) isothermal detection of IHHNV (infectious bronchitis Virus) | |
| CN111996294A (en) | Primer pair and kit for quantitatively detecting eel herpesvirus | |
| CN111004868A (en) | Fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting goat intranasal tumor virus | |
| Al-Talib et al. | A quadriplex PCR assay for rapid detection of diarrhoea-causing parasitic protozoa from spiked stool samples. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20201124 Termination date: 20210711 |