CN107177590A - A kind of permanent method for efficiently preserving DNA in giant panda excrement - Google Patents
A kind of permanent method for efficiently preserving DNA in giant panda excrement Download PDFInfo
- Publication number
- CN107177590A CN107177590A CN201710625579.4A CN201710625579A CN107177590A CN 107177590 A CN107177590 A CN 107177590A CN 201710625579 A CN201710625579 A CN 201710625579A CN 107177590 A CN107177590 A CN 107177590A
- Authority
- CN
- China
- Prior art keywords
- giant panda
- dna
- months
- panda excrement
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Analytical Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of biological specimen Techniques of preserving field, and in particular to a kind of permanent method for efficiently preserving DNA in giant panda excrement.The inventive method includes：A, sample collection：Gather defecation time ＜ 12h giant panda excrement；B, sample pretreatment：The top layer of the giant panda excrement of collection is removed, 22~26h in absolute ethyl alcohol is immersed in；C, Sample storage：The fecal specimens after immersion are taken, is dried, is transferred to bottom and is paved with the centrifuge tube of silica-gel bead, sterile absorbent cotton is added, drains air in bottle.DNA store method preservation timeliness length, preservation effect are good, easy to carry and transport in giant panda excrement of the present invention, from the amplification of giant panda mitochondrial DNA, giant panda faeces DNA is preserved 6 months and 12 months with ethanol seasoning, and amplification success rate is 100%；Preserve 24 months, amplification success rate still reaches more than 90%, in the previous work that can be used for the research of the conservative genetics such as investigation, the analysis of genetic diversity of giant panda field quantity.
Description
Technical field
The present invention relates to a kind of biological specimen Techniques of preserving field, and in particular to a kind of permanent efficiently preservation giant panda excrement
Middle DNA method.
Background technology
Giant panda is the endangered wildlife of China, and in the conservative genetics research of giant panda, scholar is needed by commenting
Estimate the genetic diversity of giant panda to propose corresponding conservation suggestion, and sample collection is the base that scholar obtains data on genetics
Plinth.Aboundresources, easily acquisition, and do not disturb the activity of giant panda, damaged to it due to giant panda fecal specimens, are added
The progress of DNA extractive techniques, faeces DNA has turned into scholar and has obtained the relatively broad and feasible sampling of field Animal genetics data
Method.
Although fecal specimens have the advantages that the above, faeces DNA exist concentration and poor quality, it is degradable, contain PCR
The problems such as inhibitor, often result in PCR and expand and successfully fail（Tende T, Hansson B, Ottosson U et al:
Evaluating preservation medium for the storage of DNA in African lion
Panthera leo faecal samples. Current Zoology 2014, 60(3):351-358.；Reddy PA,
Bhavanishankar M, Bhagavatula J et al: Improved Methods of Carnivore Faecal
Sample Preservation, DNA Extraction and Quantification for Accurate
Genotyping of Wild Tigers. Plos One 2012, 7(10).）, and then cause the unreliable of science of heredity conclusion
Property, while reducing the confidence level of the management thereby proposed or conservation suggestion.Research confirms that effective Preservation methods of faeces can
To improve PCR amplification success rates（Tende T, Hansson B, Ottosson U et al: Evaluating
preservation medium for the storage of DNA in African lion Panthera leo
faecal samples. Current Zoology 2014, 60(3):351-358.）.Guarantor on giant panda fecal specimens
Deposit only formaldehyde and ethanol, -20 DEG C of freezings of method report（Fang Shengguo, Feng Wen and Zhang Anju etc.. Fuping San Guanmiao
The DNA fingerprint analysis of area's Giant Panda Population quantity is applied and environmental organism journal 1996,2 (3):289- 293.；Zhang Bao
Defend, Wei Fuwen, the simple and easy method animals journal 50 that the such as Li Ming giant pandas and lesser panda faeces DNA are extracted（3）：452-458）.
Because formaldehyde toxicity is larger and preservation effect is not good, it has been not used in recent years；Ethanol is although nontoxic and preservation effect is good, but second
Alcohol is easily revealed, and forbids carrying in air transportation, not readily transportable；- 20 DEG C of freezings are long due to needing multigelation DNA
Phase preservation effect is not good.Although other species optimal faeces DNA store method it has been reported that faeces DNA store method
Effect with species, living environment it is different and different.Therefore, we, which still need, invents a kind of suitable for the long-term of giant panda
Preservation effect is good, convenient transport Preservation methods of faeces, and this has important for the conservative genetics research of giant panda
Meaning.
The content of the invention
It is an object of the invention to overcome the deficiencies of the prior art and provide in a kind of long-term efficiently preservation giant panda excrement
DNA method.
A kind of permanent method for efficiently preserving DNA in giant panda excrement of the present invention, comprises the following steps：
A, sample collection：Gather defecation time ＜ 12h giant panda excrement；
B, sample pretreatment：The top layer for the giant panda excrement that a steps are gathered is removed, and is immersed in 22~26h in absolute ethyl alcohol；
C, Sample storage：The fecal specimens after b step immersion are taken out, is dried, is transferred to bottom and is paved with the centrifuge tube of silica-gel bead, are arranged
Air in most bottle.
Further, a kind of above-mentioned permanent method for efficiently preserving DNA in giant panda excrement, uses nothing wherein in b step
The top layer for the giant panda excrement that bacterium tweezers gather a steps is removed, and is immersed in 24h in absolute ethyl alcohol.
A kind of above-mentioned permanent method for efficiently preserving DNA in giant panda excrement, drying temperature is 60 wherein described in step c
~70 DEG C, drying time is 1.5~2.5h.
Further, a kind of above-mentioned permanent method for efficiently preserving DNA in giant panda excrement, does wherein described in step c
Dry temperature is 65 DEG C, and drying time is 2h.
A kind of above-mentioned permanent method for efficiently preserving DNA in giant panda excrement, wherein drains bottle in step c using absorbent cotton
Middle air.
Further, a kind of above-mentioned permanent method for efficiently preserving DNA in giant panda excrement, wherein the Sample storage it
Also include DNA afterwards to extract and detecting step.
Further, a kind of above-mentioned permanent method for efficiently preserving DNA in giant panda excrement, wherein the DNA extract and
Detecting step specifically includes following steps：
Ith, DNA is extracted：Sample is preserved after 6 months, 12 months, 24 months respectively, and giant panda excrement is extracted with phenol-chloroform extraction process
DNA；
IIth, primer is synthesized：Using PAGE method of purification synthetic primers, the upstream sequence of primer is
ptp:5’CTCCCTAAGACTCAAGGAAG3’；
Downstream sequence is p12s:5’TAGGAAGGCTAGGACCAAACC3’；
IIIth, PCR is expanded：The DNA sample that step I is extracted is expanded with the primer of synthesis；
IVth, mitochondrial 10uL PCR amplification systems：1 μ L contain Mg2+10xBuffer, 0.8 μ L 2.5mM dNTP, 0.4 μ L
10mM sense primer, 0.4 μ L 10mM anti-sense primer, 0.1 μ L BSA, 0.1 μ L 5U/ μ L rTaq enzymes, 1 μ L genomes
DNA, 6.2 μ L sterilizing ultra-pure water；
Vth, PCR amplification conditions：95 DEG C are always denatured 5 minutes, and 95 DEG C are denatured 30 seconds, and 55 DEG C are annealed 30 seconds, and 72 DEG C extend 1 point 30 seconds,
Totally 35 circulations；Last 72 DEG C of overall elongations 5 minutes；
VIth, amplification is detected：Amplified production carries out electrophoresis detection with 1.5% agarose；Statistics expands successfully sample, calculates
Amplification success rate.
Further, a kind of above-mentioned permanent method for efficiently preserving DNA in giant panda excrement, wherein base described in IV step
Because group DNA is using sterile ultra-pure water, according to volume ratio 1:10 are diluted.
The inventive method is referred to as ethanol-seasoning, generally comprises two big steps, and the first step uses giant panda fecal specimens top layer
Aseptic nipper is peelled off, and is put into reagent bottle, and the absolute ethyl alcohol preservation 24 hours or so of fecal specimens can be completely covered by adding；The
Two steps, outwell absolute ethyl alcohol, and sample is transferred into 50mL centrifuge tubes, are put into 65 DEG C of baking ovens and dry 2 hours, then be transferred to bottom and contain
In the 50mL centrifuge tubes of silica-gel bead（The volume of silica-gel bead is about 1/3rd of fecal specimens）, add absorbent cotton exclusion unnecessary
Preserved at room temperature after air.During preservation, the water imbibition of silica-gel bead is periodically checked, if silica-gel bead is changed into from blueness
Pink colour, illustrates that silica-gel bead suction has moisture, it is necessary to change silica-gel bead.
Effect to above-mentioned store method is detected as follows：Above-mentioned sample is preserved 6 months, 12 respectively at room temperature
The moon, 24 months, in different timing nodes, take 3g giant pandas excrement to carry out phenol-chloroform method and extract DNA, then use what is delivered
Mitochondria primer（Upstream ptp:5 ' CTCCCTAAGACTCAAGGAAG3 ', downstream
p12s:5’TAGGAAGGCTAGGACCAAACC3’）Amplification under 10ulPCR system specified conditions is carried out to DNA profiling.
Mitochondrial 10ulPCR systems：1 μ L contain Mg2+10xBuffer, 0.8 μ L 2.5mM dNTP, 0.4 μ L 10mM
Sense primer, 0.4 μ L 10mM anti-sense primer, 0.1 μ L BSA, 0.1 μ L 5U/ μ L rTaq enzymes, 1 μ L genomic DNAs (1:
10 dilutions), 6.2 μ L sterilizing ultra-pure waters.
Mitochondrial amplification condition：95 DEG C are always denatured 5 minutes, and 95 DEG C are denatured 30 seconds, and 55 DEG C are annealed 30 seconds, 72 DEG C of extensions 1
Divide 30 seconds, totally 35 circulations, last 72 DEG C of overall elongations 5 minutes.The μ L of PCR primer 5 are taken to carry out agarose electrophoresis detection.
DNA store method is simple, efficient in giant panda excrement of the present invention, the characteristics of both having make use of ethanol rapid dehydration,
Dried using oven drying and silica-gel bead and remove liquid, further improve the shortcoming of the not portable transport of ethanol.And present invention side
Method preservation timeliness length, preservation effect are good, easy to carry and transport, the amplification of giant panda mitochondrial DNA are understood, giant panda
Faeces DNA is preserved 6 months and 12 months with ethanol seasoning, and amplification success rate is 100%；Preserve 24 months, amplification success rate
Still more than 90% is reached, can be used for the research of the conservative genetics such as investigation, the analysis of genetic diversity of giant panda field quantity
In previous work.
Brief description of the drawings
Fig. 1 is the result that mitochondria amplification is carried out to preserving the giant panda faeces DNA of 6 months；
Fig. 2 is the result that mitochondria amplification is carried out to preserving the giant panda faeces DNA of 12 months；
Fig. 3 is the result that mitochondria amplification is carried out to preserving the giant panda faeces DNA of 24 months.
Embodiment
Technical scheme is described in further detail with reference to specific embodiment, but protection scope of the present invention is not
It is confined to as described below.
Embodiment 1
1. sample collection：17 fecal specimens are picked up from Giant Panda in China Protective strategy center.The giant panda excrement of collection
Excrement age（Defecation time）Respectively less than 12 hours；
2. preparation of samples：Fecal specimens top layer is peelled off with sterilized tweezers, the top layer peeled off is put into the anhydrous second of 150mL
In the reagent bottle of alcohol；
3. Sample storage：After absolute ethyl alcohol is preserved 24 hours, absolute ethyl alcohol is outwelled, sample is transferred to 50 milliliters of centrifuge tubes
In, 65 DEG C of baking ovens are put into, are dried 2 hours；By dried sample（15~20g of dry weight）It is transferred to bottom and contains 15mL silica-gel beads
In 50mL centrifuge tubes, add the absorbent cotton of enough volumes to exclude remaining air.During this preservation, exist respectively
Changed silica-gel bead within 3 months, 6 months, 12 months, 24 months；
4. DNA is extracted：Sample is preserved after 6 months, 12 months, 24 months respectively, and giant panda excrement is extracted with phenol-chloroform extraction process
Just DNA；
5. primer is synthesized：The upstream sequence of primer is ptp:5’CTCCCTAAGACTCAAGGAAG3’；Downstream sequence is p12s:
5 ' TAGGAAGGCTAGGACCAAACC3 ', the sequence of primer comes from document（The flat great Xiong of Zhang Baowei, Wei Fuwen, Li Ming, Lv Xiao
The simple and easy method animals journal 50 that cat and lesser panda faeces DNA are extracted（3）：452-458）, the limited public affairs of bioengineering in Shanghai
Department's PAGE method of purification synthetic primers；
6. PCR is expanded：Above-mentioned all giant panda faeces DNA samples are expanded with the primer of synthesis；
7. PCR amplification system：1 μ L contain Mg2+10xBuffer, 0.8 μ L 2.5mM dNTP, 0.4 μ L 10mM upstream is drawn
Thing, 0.4 μ L 10mM anti-sense primer, 0.1 μ L BSA, 0.1 μ L 5U/ μ L rTaq enzymes, 1 μ L genomic DNAs (1:10 dilutions),
6.2 μ L sterilizing ultra-pure waters.All reagents in system come from the precious biotech firm in Dalian；
8. PCR amplification conditions：95 DEG C are always denatured 5 minutes, and 95 DEG C are denatured 30 seconds, and 55 DEG C are annealed 30 seconds, and 72 DEG C extend 1 point 30 seconds,
Totally 35 circulations.Last 72 DEG C of overall elongations 5 minutes；
9. amplification is detected：Amplified production carries out electrophoresis detection with 1.5% agarose.As a result show 6 months and 12 months
17 samples preserved are all expanded successfully,（Fig. 1~2）；In 17 samples that 24 months preserve, only 1 sample amplification is lost
Lose, amplification success rate is 94.1%（Fig. 3）.
Fig. 1 carries out the result of mitochondria amplification to the giant panda faeces DNA for preserving 6 months.Each swimming lane represents different
Giant panda individual.M represents DL2000 molecule Marker, band be followed successively by from top to bottom 2000bp, 1000bp, 750bp,
500bp、250bp、100bp；
Fig. 2 carries out the result of mitochondria amplification to the giant panda faeces DNA for preserving 12 months.Each swimming lane represents different great Xiong
Cat individual.M represents DL2000 molecule Marker, band be followed successively by from top to bottom 2000bp, 1000bp, 750bp, 500bp,
250bp、100bp；
Fig. 3 carries out the result of mitochondria amplification to the giant panda faeces DNA for preserving 24 months.Each swimming lane represents different great Xiong
Cat individual.M represents DL2000 molecule Marker, band be followed successively by from top to bottom 2000bp, 1000bp, 750bp, 500bp,
250bp、100bp。
Embodiment 2
1. sample collection：15 fecal specimens are picked up from Giant Panda in China Protective strategy center.The giant panda excrement of collection
Excrement age（Defecation time）Respectively less than 12 hours；
2. preparation of samples：Fecal specimens top layer is peelled off with sterilized tweezers, the top layer peeled off is put into the anhydrous second of 150mL
In the reagent bottle of alcohol；
3. Sample storage：After absolute ethyl alcohol is preserved 22 hours, absolute ethyl alcohol is outwelled, sample is transferred in 50mL centrifuge tubes,
60 DEG C of baking ovens are put into, are dried 2.5 hours；By dried sample（15~20g of dry weight）It is transferred to bottom and contains 15mL silica-gel beads
In 50mL centrifuge tubes, add the absorbent cotton of enough volumes to exclude remaining air；During this preservation, exist respectively
Changed silica-gel bead within 3 months, 6 months, 12 months, 24 months；
4. DNA is extracted：Sample is preserved after 6 months, 12 months, 24 months respectively, and giant panda excrement is extracted with phenol-chloroform extraction process
Just DNA；
5. primer is synthesized：The upstream sequence of primer is ptp:5’CTCCCTAAGACTCAAGGAAG3’；Downstream sequence is p12s:
5 ' TAGGAAGGCTAGGACCAAACC3 ', the sequence of primer comes from document（The flat great Xiong of Zhang Baowei, Wei Fuwen, Li Ming, Lv Xiao
The simple and easy method animals journal 50 that cat and lesser panda faeces DNA are extracted（3）：452-458）, the limited public affairs of bioengineering in Shanghai
Department's PAGE method of purification synthetic primers；
6. PCR is expanded：Above-mentioned all giant panda faeces DNA samples are expanded with the primer of synthesis；
7. PCR amplification system：1 μ L contain Mg2+10xBuffer, 0.8 μ L 2.5mM dNTP, 0.4 μ L 10mM upstream is drawn
Thing, 0.4 μ L 10mM anti-sense primer, 0.1 μ L BSA, 0.1 μ L 5U/ μ L rTaq enzymes, 1 μ L genomic DNAs (1:10 dilutions),
6.2 μ L sterilizing ultra-pure waters.All reagents in system come from the precious biotech firm in Dalian；
8. PCR amplification conditions：95 DEG C are always denatured 5 minutes, and 95 DEG C are denatured 30 seconds, and 55 DEG C are annealed 30 seconds, and 72 DEG C extend 1 point 30 seconds,
Totally 35 circulations.Last 72 DEG C of overall elongations 5 minutes；
9. amplification is detected：Amplified production carries out electrophoresis detection with 1.5% agarose.As a result show 6 months, 12 months
15 samples are all expanded successfully, and amplification success rate is 100%, and 15 samples preserved for 24 months only have 1 amplification unsuccessful,
Amplification success rate is 93.33%.
Embodiment 3
1. sample collection：12 fecal specimens are picked up from Giant Panda in China Protective strategy center.The giant panda excrement of collection
Excrement age（Defecation time）Respectively less than 12 hours；
2. preparation of samples：Fecal specimens top layer is peelled off with sterilized tweezers, the top layer peeled off is put into the anhydrous second of 150mL
In the reagent bottle of alcohol；
3. Sample storage：After absolute ethyl alcohol is preserved 26 hours, absolute ethyl alcohol is outwelled, sample is transferred in 50mL centrifuge tubes,
70 DEG C of baking ovens are put into, are dried 1.5 hours；By dried sample（15~20g of dry weight）It is transferred to bottom and contains 15mL silica-gel beads
In 50mL centrifuge tubes, add the absorbent cotton of enough volumes to exclude remaining air.During this preservation, exist respectively
Changed silica-gel bead within 3 months, 6 months, 12 months, 24 months；
4. DNA is extracted：Sample is preserved after 6 months, 12 months, 24 months respectively, and giant panda excrement is extracted with phenol-chloroform extraction process
Just DNA；
5. primer is synthesized：The upstream sequence of primer is ptp:5’CTCCCTAAGACTCAAGGAAG3’；Downstream sequence is p12s:
5 ' TAGGAAGGCTAGGACCAAACC3 ', the sequence of primer comes from document（The flat great Xiong of Zhang Baowei, Wei Fuwen, Li Ming, Lv Xiao
The simple and easy method animals journal 50 that cat and lesser panda faeces DNA are extracted（3）：452-458）, the limited public affairs of bioengineering in Shanghai
Department's PAGE method of purification synthetic primers；
6. PCR is expanded：Above-mentioned all giant panda faeces DNA samples are expanded with the primer of synthesis；
7. PCR amplification system：1 μ L contain Mg2+10xBuffer, 0.8 μ L, 2.5mM dNTP, 0.4 μ L, 10mM upstream is drawn
Thing, 0.4 μ L, 10mM anti-sense primer, 0.1 μ L BSA, 0.1 μ L, 5U/ μ L rTaq enzymes, 1 μ L genomic DNAs (1:10 is dilute
Release), 6.2 μ L sterilizing ultra-pure waters.All reagents in system come from the precious biotech firm in Dalian；
8. PCR amplification conditions：95 DEG C are always denatured 5 minutes, and 95 DEG C are denatured 30 seconds, and 55 DEG C are annealed 30 seconds, and 72 DEG C extend 1 point 30 seconds,
Totally 35 circulations.Last 72 DEG C of overall elongations 5 minutes；
9. amplification is detected：Amplified production carries out electrophoresis detection with 1.5% agarose.As a result show 6 months, 12 months and
12 samples preserved for 24 months are all expanded successfully, and amplification success rate is 100%.
From the amplification of giant panda mitochondrial DNA, giant panda faeces DNA preserved 6 months with ethanol-seasoning and
12 months, amplification success rate was 100%；Preserve 24 months, amplification success rate still reaches more than 90%.It can be seen that the method for
The long-term preservation of giant panda faeces DNA sample has a significant effect.It is rapid that the first step in ethanol-seasoning remains ethanol
The characteristics of dehydration, the oven drying and silica-gel bead of second step, which are dried, removes liquid, improves the shortcoming of the not portable transport of ethanol.
Ethanol-seasoning preserves that timeliness length, preservation effect are good, easy to carry and transport, can be used for giant panda field quantity investigation,
In the previous work of the conservative genetics such as analysis of genetic diversity research.
Described above is only the preferred embodiment of the present invention, it should be understood that the present invention is not limited to described herein
Form, is not to be taken as the exclusion to other embodiment, and available for various other combinations, modification and environment, and can be at this
In the text contemplated scope, it is modified by the technology or knowledge of above-mentioned teaching or association area.And those skilled in the art are entered
Capable change and change does not depart from the spirit and scope of the present invention, then all should appended claims of the present invention protection domain
It is interior.
Claims (8)
1. a kind of permanent method for efficiently preserving DNA in giant panda excrement, it is characterised in that comprise the following steps：
A, sample collection：Gather defecation time ＜ 12h giant panda excrement；
B, sample pretreatment：The top layer for the giant panda excrement that a steps are gathered is removed, and is immersed in 22~26h in absolute ethyl alcohol；
C, Sample storage：The fecal specimens after b step immersion are taken out, is dried, is transferred to bottom and is paved with the centrifuge tube of silica-gel bead, are arranged
Air in most bottle.
2. a kind of permanent method for efficiently preserving DNA in giant panda excrement according to claim 1, it is characterised in that b step
The top layer for the giant panda excrement that middle use aseptic nipper gathers a steps is removed, and is immersed in 24h in absolute ethyl alcohol.
3. a kind of permanent method for efficiently preserving DNA in giant panda excrement according to claim 1, it is characterised in that step c
Described in drying temperature be 60~70 DEG C, drying time be 1.5~2.5h.
4. a kind of permanent method for efficiently preserving DNA in giant panda excrement according to claim 3, it is characterised in that step c
Described in drying temperature be 65 DEG C, drying time is 2h.
5. a kind of permanent method for efficiently preserving DNA in giant panda excrement according to claim 1, it is characterised in that step c
Middle use absorbent cotton drains air in bottle.
6. a kind of permanent method for efficiently preserving DNA in giant panda excrement according to claim 1, it is characterised in that described
Also include DNA after Sample storage to extract and detecting step.
7. a kind of permanent method for efficiently preserving DNA in giant panda excrement according to claim 6, it is characterised in that described
DNA is extracted and detecting step specifically includes following steps：
Ith, DNA is extracted：Sample is preserved after 6 months, 12 months, 24 months respectively, and giant panda excrement is extracted with phenol-chloroform extraction process
DNA；
IIth, primer is synthesized：Using PAGE method of purification synthetic primers, the upstream sequence of primer is
ptp:5’CTCCCTAAGACTCAAGGAAG3’；
Downstream sequence is p12s:5’TAGGAAGGCTAGGACCAAACC3’；
IIIth, PCR is expanded：The DNA sample that step I is extracted is expanded with the primer of synthesis；
IVth, PCR amplification system：1 μ L contain Mg2+10xBuffer, 0.8 μ L 2.5mM dNTP, 0.4 μ L 10mM upstream is drawn
Thing, 0.4 μ L 10mM anti-sense primer, 0.1 μ L BSA, 0.1 μ L 5U/ μ L rTaq enzymes, 1 μ L genomic DNAs, 6.2 μ L sterilizings
Ultra-pure water；
Vth, PCR amplification conditions：95 DEG C are always denatured 5 minutes, and 95 DEG C are denatured 30 seconds, and 55 DEG C are annealed 30 seconds, and 72 DEG C extend 1 point 30 seconds,
Totally 35 circulations；Last 72 DEG C of overall elongations 5 minutes；
VIth, amplification is detected：Amplified production carries out electrophoresis detection with 1.5% agarose；Statistics expands successfully sample, calculates
Amplification success rate.
8. a kind of permanent method for efficiently preserving DNA in giant panda excrement according to claim 7, it is characterised in that IV step
Genomic DNA is using sterile ultra-pure water, according to volume ratio 1 described in rapid:10 are diluted.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710625579.4A CN107177590A (en) | 2017-07-27 | 2017-07-27 | A kind of permanent method for efficiently preserving DNA in giant panda excrement |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710625579.4A CN107177590A (en) | 2017-07-27 | 2017-07-27 | A kind of permanent method for efficiently preserving DNA in giant panda excrement |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107177590A true CN107177590A (en) | 2017-09-19 |
Family
ID=59838469
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710625579.4A Pending CN107177590A (en) | 2017-07-27 | 2017-07-27 | A kind of permanent method for efficiently preserving DNA in giant panda excrement |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107177590A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113091800A (en) * | 2021-02-23 | 2021-07-09 | 武汉轻工大学 | Wild biological fecal sample collecting method, device, equipment and storage medium |
| CN114921455A (en) * | 2022-03-18 | 2022-08-19 | 西华师范大学 | Method for rapidly and efficiently extracting panda excrement microorganism DNA |
-
2017
- 2017-07-27 CN CN201710625579.4A patent/CN107177590A/en active Pending
Non-Patent Citations (5)
| Title |
|---|
| PATLOLLA ANURADHA REDDY等: "Improved Methods of Carnivore Faecal Sample Preservation, DNA Extraction and Quantification for Accurate Genotyping of Wild Tigers", 《PLOS ONE》 * |
| TENDE TALATU等: "Evaluating preservation medium for the storage of DNA in African lion Panthera leo faecal samples", 《CURRENT ZOOLOGY》 * |
| ZHU YING等: "Factors affecting genotyping success in giant panda fecal samples", 《PEERJ》 * |
| 张保卫等: "大熊猫和小熊猫粪便DNA 提取的简易方法", 《动物学报》 * |
| 赵健元，李进华: "对影响哺乳动物粪便DNA提取相关因素的探讨", 《生物学杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113091800A (en) * | 2021-02-23 | 2021-07-09 | 武汉轻工大学 | Wild biological fecal sample collecting method, device, equipment and storage medium |
| CN114921455A (en) * | 2022-03-18 | 2022-08-19 | 西华师范大学 | Method for rapidly and efficiently extracting panda excrement microorganism DNA |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Balasingham et al. | Residual eDNA detection sensitivity assessed by quantitative real‐time PCR in a river ecosystem | |
| Atwill et al. | Prevalence of and associated risk factors for shedding Cryptosporidium parvum oocysts and Giardia cysts within feral pig populations in California | |
| CN101307311A (en) | Process for abstracting total DNA of swine waste sample | |
| CN1904066B (en) | Extraction method of mammal faeces DNA | |
| CN103397091A (en) | Polymerase chain reaction (PCR) method for identifying sex of young pigeons | |
| CN109679946B (en) | Blood virus RNA protective agent and blood collection tube | |
| CN107177590A (en) | A kind of permanent method for efficiently preserving DNA in giant panda excrement | |
| Huber et al. | Sex determination of red deer using polymerase chain reaction of DNA from feces | |
| Intisar et al. | Natural exposure of Dromedary camels in Sudan to infectious bovine rhinotracheitis virus (bovine herpes virus-1) | |
| CN101338311A (en) | Method for extracting total DNA from milk | |
| Retief et al. | A protocol for molecular detection of Phaeomoniella chlamydospora in grapevine wood: research in action | |
| CN101368179B (en) | Reagent kit for extracting DNA in Chinese alligator chorion film and use method thereof | |
| Salant et al. | Neospora caninum in crows from Israel | |
| CN105886651B (en) | A kind of and the associated functional label of rape seedling drought resistance and its application | |
| CN102382876A (en) | Method for detecting avermectin pesticide resistance produced by diamondback moth | |
| CN104293922B (en) | With the closely linked molecule marker GmSSR18-24 of Soybean Resistance To Rust ospc gene and application | |
| Holt et al. | Use of FTA technology for detection of Trichomonas gallinae | |
| Lalonde et al. | Effect of storage media, temperature, and time on preservation of Cryptosporidium parvum oocysts for PCR analysis | |
| Wimsatt et al. | Detection of pathogenic Batrachochytrium dendrobatidis using water filtration, animal and bait testing | |
| CN107177692A (en) | Cryptosporidium, the quick detection of giardia lamblia and source tracing method in a kind of municipal sewage | |
| Steinman et al. | Demographic and environmental risk factors for exposure to Lawsonia intracellularis in horses in Israel | |
| Telmadarraiy et al. | Molecular detection of Crimean-Congo Hemorrhagic fever virus in ticks in Qom Province, Iran, 2011-2012 | |
| Wynne | Detection of ranavirus in endemic and threatened amphibian populations of the Australian Wet Tropics Region | |
| CN103981282B (en) | The collection of carapuru virus normal temperature, preservation and detection method | |
| Omoigui et al. | Molecular characterization of cowpea breeding lines for Striga resistance using SCAR markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170919 |