CN107177560A

CN107177560A - A kind of genotype VII NDV low virulent strain of structure

Info

Publication number: CN107177560A
Application number: CN201710404089.1A
Authority: CN
Inventors: 李明义; 孙化露; 金红岩; 李思菲; 于泽坤; 毕云英; 刘阳; 单学强; 栾志舫; 马礼照; 李朝阳
Original assignee: Qingdao Sinder Pharmaceutical Co ltd; Shandong Sinder Technology Co ltd
Current assignee: Shandong XinDa Gene Technology Co.,Ltd.
Priority date: 2017-05-27
Filing date: 2017-05-27
Publication date: 2017-09-19
Anticipated expiration: 2037-05-27
Also published as: CN107177560B

Abstract

The present invention provides a kind of genotype VII NDV low virulent strain, is that the amino acid of 237 of the P albumen of VII type NDVs and 240 are sported into threonine T and isoleucine I respectively；F protein is also carried out to what hypotoxicity mutation was built simultaneously.Vaccine prepared by the genotype VII NDV low virulent strain that the present invention is built, which can be induced, produces higher neutralizing antibody, can resist the infringement of strong virus force genotype VII NDV, have broad application prospects.

Description

A kind of genotype VII NDV low virulent strain of structure

Technical field

The invention belongs to vaccine virus strain constructing technology field, and in particular to a kind of genotype VII Newcastle Disease of structure Malicious low virulent strain.

Technical background

Ewcastle disease is a kind of acute deadly infectious disease as caused by NDV, to the very harmful of aviculture, once A classes disease is classified as by International Office of Epizootics (OIE).ND is found in Indonesia Java first in nineteen twenty-six, and the same year is found in English The Newcastle city of state, it is hereafter rapid to propagating all over the world.Current ND worldwide there occurs four times to be very popular, and And host range constantly expands.

29 plants of NDVs that Liu Xiu Buddhist etc. is isolated from Zhejiang And Jiangsu area to 1985-2003 carry out sequence analysis, As a result 17 plants are shown and belongs to genotype VII, wherein 10 plants of separation idiopathy gaggles.Liu Hualei etc. was isolated from China to 2005 83 plants of NDVs of Continental Area carry out analysis and shown, wherein 64 plants belong to genotype VII.Lien etc. is to 2003-2006 20 plants of NDVs that Taiwan is isolated between year are genotype VII.In addition the South Korea with stage Chinese periphery and day This popular NDV is also mostly genotype VII.The part NDV strains that we separate in recent years to this laboratory are also sequenced Analysis, as a result shows, more than 70% strain is genotype VII.It is therefore seen that, genotype VII NDV is in Chinese Poultry It is widely current in group, is current absolute predominance genotype.

Vaccine strain Lasota, clone30 and II systems of IV systems epidemic disease is mainly used to the prevention and control of NDV on Vehicles Collected from Market The strain of the gene II types such as seedling strain B1, although they can provide certain immunoprotection, ewcastle disease can not be prevented completely The propagation of virus, the prevalence of diffusion, particularly genotype VII NDV cause huge economic loss to aquaculture. Because popular genotype VII NDV is all strong poison, therefore most of strains are not suitable as vaccine strain and used, unless It is Natural Avirulent Strain or the exquisite weak strain of genetic engineering means people.It is the key for producing vaccine to obtain low virulent strain.

The content of the invention

It is an object of the invention to provide a kind of genotype VII NDV low virulent strain of structure, obtained so as to build The genotype VII NDV low virulent strain of low toxicity power is obtained, and for preparing vaccine.

The VII type NDV low virulent strains that the present invention is provided, be by 237 of the P albumen of VII type NDVs and The amino acid of 240 sports threonine T and isoleucine I respectively；F protein is also carried out to what hypotoxicity mutation was built simultaneously.

Above-mentioned VII type NDV low virulent strains, a kind of its concrete operation method is by reverse genetic manipulation method To build VII type NDV low virulent strains, it includes the steps：

The cell line of construction expression t7 rna polymerase,

Described cell line, is to transfect DF1 cells after the gene for expressing t7 rna polymerase is connected with carrier PCI-neo Obtain；

The auxiliary recombinant plasmid and a full-length genome needed during genotype VII NDV NDV rescues is provided Recombinant vector, auxiliary recombinant plasmid includes NDV NP albumen, P albumen, F protein and L GFPs respectively；Wherein P albumen The amino acid of 237 and 240 is respectively T and I；

Recombinant plasmid and a full-length genome recombinant vector will be aided in be transferred in the cell line of expression t7 rna polymerase, Culture obtains genotype VII NDV low virulent strain.

The low virulent strain for the structure that the present invention is screened, is rSL plants of genotype VII NDV, and it was on March 20th, 2017 Wuhan, China, the China typical culture collection center of Wuhan University are preserved in, deposit number is CCTCC NO:V201709；

Low virulent strain constructed by the present invention can be used for preparing inactivated vaccine.

Vaccine prepared by the genotype VII NDV low virulent strain that the present invention is built, which can be induced, produces higher neutralization Antibody, can resist the infringement of strong virus force genotype VII NDV, have broad application prospects.

Brief description of the drawings

Fig. 1：Ewcastle disease F genetic fragment PCR qualification figures；

Fig. 2：The phylogenetic tree of NDV strains (WF plants, SL plants) based on F genetic fragments；

Fig. 3：9 genetic fragment PCR qualification result figures of ewcastle disease；

Fig. 4：Full-length genome segmentation builds PCR qualification result figures；

Fig. 5：NP, P, L helper plasmid digestion qualification figure.

Embodiment

The present invention is by studying two pnca gene VII types NDV being clinically separated, and it is medium virulence on the weak side to find one plant Strain (WF plants), one plant is velogen strain (SL plants)；By the gene order-checking to them, and the genotype VII announced with NCBI NDV P genes are largely compared, and WF plants of discovery is different from other strains in the 237th of P albumen and the 240th amino acids, Speculate that it may be relevant with the virulence of ewcastle disease.P genes according to SL plants of the sequence pair of WF plants of P albumen are transformed, as a result Obtain a plant height degree and cause weak genotype VII newcastle disease vaccine candidate strain.WF plants and improved SL plants life are studied respectively Thing characteristic, and make respectively after the immune animal of inactivated vaccine, good immune protective effect can be provided；So as to facilitate this hair It is bright.

The present invention is described in detail with reference to embodiment.

The screening and sequence analysis of the genotype VII NDV street strains of embodiment 1

Two plants of doubtful NDV strains are separated to from clinical onset chicken, inoculated into chick embryo collects allantoic fluid, determines HA potency.Root Primer is designed according to the NCBI NDV announced F gene orders, ewcastle disease strain is identified.Sense primer：NDV F‐F： ATGGGCTCCAAACCTTCTACCAG；Anti-sense primer：NDV F‐R：AAACTGCTGCATCTTCCCAACCG.

The allantoic fluid 250uL collected is taken to extract RNA, reverse transcription according to a conventional method.Expand by primer of NDV F-F/NDV F-R Increase the Partial Fragment of F genes, clip size about 500bp.After nucleic acid electrophoresis, positive band is cut, is reclaimed, connection carrier T sequencing. The sequence between F gene 47nt-420 nt is taken to draw phylogenetic trees, the genotype of Analyze ＆ separate strain.For analysis of experiments Strain GenBank accession number be：1‐2(AY935499)、1‐2(AY935500)、 18719‐03(GQ288385)、B1(NC_ 002617)、HB92(AY225110)、 Herts(AY741404)、Italien(EU293914)、JS‐07(FJ766527)、La sota (AF077761)、NA‐1(DQ659677)、paramyxovirus‐1(AJ880277)、 ZJ1(AF431744)、 Mukteswar(EF201805)。

As a result show, two plants of isolated strains are NDV, and the amino acid sequence of F gene cracking sites is¹¹²R-R- Q-K-R-F¹¹⁷, meet the feature of velogen strain, further gene evolution analysis shows that they are genotype VII strain.HA potency Display is determined, the potency of two strain virus chick embryo allantoic liquids is stablized 2 respectively⁹With 2⁷‐2⁸.The NDV strains of separation are respectively designated as WF plants and SL plants.Wherein genotype VII NDV WF plants, it is big that it is preserved in Wuhan, China, Wuhan on March 7th, 2017 China typical culture collection center, deposit number is CCTCC NO:V201708.

2 ewcastle disease of embodiment SL plants and WF plants MDT, ICPI measure

MDT refers to that minimum lethal dose can make the average time of chicken embryo death, and MDT is strong virus force NDV strains less than 60h； MDT values are medium virulence strain between 60h-90h；MDT be more than 90h for low virulent strain.Received with sterile saline by fresh The toxic allantoic fluid obtained is made 10 times and is serially diluted, and takes 10^‐6、10^‐7、10^‐8With 10^‐94 dilution factors, are inoculated with 10 age in days chickens respectively Embryo, each dilution factor is inoculated with 5 pieces, per embryo allantois intracavitary administration 0.1mL.Every morning and afternoon respectively shine embryo once, record each The death time of chicken embryo, Continuous Observation 7 days.(the results are shown in Table 1) MDT calculation formula are：

ICPI refers to 1 Japanese instar chickling ICPI.Take 1 age in days SPF chick 15, each intracerebral injection 10^‐1Dilution Fresh toxic allantoic fluid 0.05mL.It is another to take 5 each 0.05mL conducts of sterile saline in kind injecting same dose Control.After inoculation, daily in the time observation being accordingly inoculated with, the situation of chick is recorded, point normal (flexibly, action is without altogether for activity Ji detuning phenomena), morbidity (including paralysis, sleeping ground do not rise, but do not include only showing blunt chicken) and dead.

Observation 8 days, calculates normal, morbidity, the sum of dead chicken, (is normally 0, falls ill for 1, extremely according to different weights Die 2) to add up gross score.

ICPI is the average value (the results are shown in Table 1) of the cumulative total of accumulative total score divided by normal, morbidity and dead animal.

Table 1：WF plants and SL plants MDT, ICPI measure

The above results show, SL plants meet velogen strain feature, it is consistent with the velogen strain characteristic of F gene cracking sites；And Although WF plants of F genes cracking site also complies with the feature of velogen strain, but the result of table 1 shows that WF plants belong to medium strain on the weak side, Prove that the virulence of ewcastle disease is not only relevant with F protein, thus it is speculated that may be also relevant with other albumen such as P albumen etc..

Embodiment 3：The measure of WF plants, SL plants whole genome sequences of ewcastle disease

In order to determine whether that p albumen also generates variation, the NDV gene orders announced according to NCBI design 9 pairs of primers, There is partial nucleic acid sequence overlapped between adjacent amplified fragments.Primer is synthesized by Shanghai Sheng Gong bioengineering Co., Ltd, sequence Row are shown in Table 2.

Table 2 expands the primer sequence of SL plants of full-length genomes of NDV

Conventional method extracts viral RNA, reverse transcription, and above-mentioned primer enters performing PCR amplification, and connection PMD 19-T carriers are sequenced, The sequence of survey is compared in NCBI websites, is spliced with Lasergene softwares, obtains WF plants and SL plants of complete genome sequences.

As a result show, WF plants and SL pnca gene group total length 15192bp, compared with the strains such as Lasota, in 1646-1647 There are 6 unnecessary bases between bit base, meet the characteristic of genotype VII ewcastle disease strain.

Further the P genes of WF plants and SL plants of P genes and the NCBI other genotype VII NDVs announced are entered Row, which is compared, to be found, (its amino acid sequence is seqID NO to WF plants of P albumen:1) the 237th and the 240th amino acids with it is other Strain is variant, and the amino acid that other strains include SL plants of the 237th and 240, P albumen is K/R and K, and WF plants are distinguished For T and I.

Embodiment 4：The structure of genotype VII new castle disease virus weakening strain

Verify whether the variation of WF plants of P albumen causes WF plants to turn into low virulent strain by reverse genetics manipulation technology Where reason.Reverse genetics manipulation technology generally refer to by build virus Genomic cDNA clone, culture cell or/and Again virus " is brought back to life " in susceptible host, by the genome sequence of the method modification virus such as gene insertion or missing, is come with this Carry out the development of the functional genome research and new generation vaccine of virus.The NDV of the present embodiment rescue process is by the complete of structure Genomic cDNA clone (transcription vector) and helper plasmid (expression vector) cotransfection cells respectively containing NP, P and L gene, Helper plasmid is provided in the presence of relevant enzyme, and cDNA clone carries out transcription and the expression of each gene, is finally assembling to infectious Virion, the NDV of rescue is then obtained come a large amount of amplicon virus by inoculated into chick embryo.The NDV genomes saved out are most CDNA clone is derived from eventually.

Specific step is described below.

1) structure of the cell line of expression t7 rna polymerase

The single clone of picking e. coli bl21, test tube shakes bacterium, takes 400uL bacterium solutions, and 13000 rpm/min centrifuge 10 points Clock, removes supernatant；Centrifuged after being resuspended with ultra-pure water, remove supernatant；It is resuspended with 100uL ultra-pure water, boils 10min, ice bath 10min； Centrifugation, takes supernatant as DNA profiling.The BL21 bacterial strain t7 rna polymerase gene orders announced according to NCBI, design primer：T7‐ F：5'CTGCTCGAGCCACCATGAACACGATTAACATCGCTAAGAACGAC 3', T7-R：5' CTGTCTAGATTACGCGAACGCGAAGTCCGACTCTAAGATGT, sense primer I containing Xho restriction enzyme site, anti-sense primer contain Xba I restriction enzyme sites.Enter performing PCR amplification, amplified fragments size about 2.6Kb using the DNA of preparation as template.

Take 5uL PCR primers to carry out nucleic acid electrophoresis identification, if band is correct, remaining PCR products are tried with nucleic acid purification Agent box is purified.Purified product carries out the reaction of Xba I/Xho I double digestions together with carrier for expression of eukaryon PCI-neo.Reclaim Positive band, is attached with T4DNA Ligase.Convert, a small amount of extractions of plasmid, digestion identification etc. is entered according to a conventional method OK.Positive plasmid serves the sequencing of Hai Shenggong bioengineering Co., Ltd, obtains recombinant plasmid PCI-T7.

With the DMEM medium culture DF1 cells containing 10% hyclone, 60mm Dish culture dishes are uniformly inoculated in, Transfected when cell length is to 70%-90%.2ug PCI-T7 recombinant plasmids are taken, by wanting for calcium phosphate transfection kit specification Seek transfection DF1 cells.4h changes G418 containing 400ng/mL into after changing the fresh growth medium without G418,24h into after transfection Growth medium.First passage changes the growth medium of the G418 containing 600ng/mL into, and passage later gradually steps up the dense of G418 Degree, until G418 concentration reaches 1mg/mL.In the generation of cell continuous passage 20, extract RNA, reverse transcription after being handled with DNA enzymatic, with drawing Thing T7-F/T7-R is expanded, and identifies the expression of t7 rna polymerase.

Identified, the cell line of structure, which can be stablized, to pass on, and transfects the sustainable table of t7 rna polymerase gene of acquisition Reach.The cell line of the stable expression t7 rna polymerase of structure is named as DF1-T7.

2) structure of SL plants of full length cDNA clone carriers

According to the SL strain whole genome sequences measured, with its restriction enzyme site of the software analysis of Oligo 7., by full genome component Into 7 sections, segmentation is connected on the carrier PBRT by transformation.Wherein, the 710th in P genes and the mutation of 719 bit bases are transformed It is attached again afterwards, the full length cDNA clone carrier of structure is named as PBRT-NDV-P, after sequencing is correct, saves backup.In structure On the basis of the PBRT-NDV-P carriers built, the basic amino acid cracking site that F genes in the 3rd section are represented into velogen strain characteristic is mutated For the sequence of low pathogenicity feature, the full length cDNA clone carrier of structure is named as PBRT-NDV, after sequencing is correct, preserved standby With.Primer is synthesized by Shanghai Sheng Gong bioengineering Co., Ltd, and primer sequence is shown in Table 3.Wherein CL2-T1/CL2-T2/CL2- T3/CL2-T4 is F gene mutation primers, and CL2-2F/CL2-T5/CL2-T6/CL2-2R is P gene mutation primers.

Table 3：NDV full-length genome vector construction primer sequences

3) structure of helper plasmid

Restriction enzyme site is introduced in the upstream and downstream of SL plants of NP, P and L genes respectively, digestion after PCR amplifications is connected through identical interior The treated PCI-neo carriers of enzyme cutting, preserve after sequencing, are respectively designated as PCI-NP, PCI-P and PCI-L.The primer is by upper Hai Shenggong bioengineering Co., Ltd synthesizes, and primer sequence is shown in Table 4.

Table 4：NDV helper plasmid structure primer sequences

4) virus rescue

DF1-T7 cells are inoculated in when growing to 70%-80% individual layers in the orifice plates of 35mm six, will transcribe plasmid PBRT-NDV- P and helper plasmid PCI-NP, PCI-P and PCI-L are respectively with 5ug, 2.5ug, 1.25ug, 1.25ug ratio, cotransfection DF1- T7 cell lines, using calcium phosphate transfection kit, operation is carried out by kit specification.Meanwhile, plasmid PBRT-NDV will be transcribed Identical amount and method cotransfection DF1-T7 cell lines are pressed with above-mentioned helper plasmid.After transfection 3-5 days, harvest culture supernatant connects The SPF chick embryo allantoic cavities of 9-11 ages in days are planted, are cultivated 3-5 days, take chick embryo allantoic liquid to survey HA potency.Harvest HA result of the test positive urines Cyst fluid, -70 DEG C freeze after packing.

The strain of the only P genetic modifications of rescue is named as rSL-P plants, rSL-P plants of genotype VII NDV, its Wuhan, China, the China typical culture collection center of Wuhan University are preserved on March 20th, 2017, deposit number is CCTCC NO:V201710；

The strain that the P and F genes of rescue are transformed jointly is named as rSL plants；RSL plants of genotype VII NDV, its Wuhan, China, the China typical culture collection center of Wuhan University are preserved on March 20th, 2017, deposit number is CCTCC NO:V201709；

Transfection liquid harvests allantoic fluid after connecing embryo 4 days, blood clotting (HA) experiment is positive, and chicken embryo potency is 2⁶‐2⁸Between.Harvest Allantoic fluid 1:1000‐1:10000 dilutions, continue to receive embryo after connecing embryo, 0.1mL/ pieces, 4-5 days；Continue to be passaged to for the 15th generation.Respectively Take rSL-P plants and rSL plant primary, the 5th generation, the 10th generation and the 15th generation viral allantoic fluid extract RNA, the sequence that PCR amplifications are mutated Row site (P genes and P/F genes) are simultaneously sequenced, and qualification result is consistent with expected result.Show virus rescue success, and passage Stable, back mutation does not occur again for the site of transformation.

The chicken embryo median lethal time (MDT) of embodiment 5, new Revive virus (rSL-P plants and rSL plants)

The toxic allantoic fluid newly harvested work is serially diluted for 10 times with sterile saline, 10 are taken^‐7、10^‐8、10^‐93 Dilution factor, is inoculated with instar chicken embryo on the 10th respectively, and each dilution factor is inoculated with 5 chicken embryos, per embryo allantois intracavitary administration 0.1mL, exists daily The same time of inoculation shines egg 1 time, records the death time of each chicken embryo, and determines HA activity.Continuous Observation 7 days, is inoculated with chicken The whole dead highest dilutions of embryo are minimum lethal dose.

As a result show, rSL-P plants of MDT values are 108h, and rSL plants of MDT values are 128h, and concrete outcome is shown in Table 5.

Table 5：The measure of rSL-P plants, rSL plants chicken embryo median lethal times (MDT)

The measure (ICPI) of embodiment 6, rSL-P plants, rSL plants ICPIs

Take 1 age in days SPF chick 10, each intracerebral injection 10^‐1The fresh toxic allantoic fluid 0.05mL of dilution.It is another take 5 with Each 0.05 mL of physiological saline of same method injection dilution virus.

After inoculation, observed daily in corresponding inoculation time, record the situation of chick, divide normal, morbidity and dead.Observation 8 Day, normal, morbidity, the sum of dead chicken are calculated, (is normally 0, falls ill for 1,2) death is add up total score according to different weights Number.ICPI is the average value of the cumulative total of accumulative total score divided by normal, morbidity and dead chicken.

As a result show, rSL-P plants of ICPI values are that 0.9, rSL plants of ICPI is 0.35, and concrete outcome is shown in Table 6.

Table 6：RSL-P plants, rSL plants ICPI measure

The measure (IVPI) of embodiment 7, rSL-P plants, rSL plants vein pathogenic index

Take 6 week old SPF chickens 10, each intravenous inoculation 10^‐1The toxic allantoic fluid 0.1mL of dilution, separately takes 5 inoculation physiology salts Water is compared.The daily corresponding time in inoculation is observed, and record is inoculated with chicken situation, point normal, morbidity, paralysis and death.

After observation 10 days, add up normal, morbidity, paralysis and dead animal number, (be normally 0, falling ill is according to different weights 1, benumb as 2,3) death is add up gross score.IVPI is the accumulative total of accumulative total score divided by normal, morbidity and dead animal Number.

As a result show, rSL-P plants, rSL plants of IVPI values are 0, and concrete outcome is shown in Table 7.

With reference to the measurement result analysis of two plants of rescue strain MDT, ICPI and IVPI values, rSL-P plants of virulence is compared with wild strain SL plants of virulence has declined to a great extent, and illustrates that two sites of P genes affect SL plants of virulence really, and passes through P genes and F The rSL strains virulence that gene association transformation is obtained declines completely, complies fully with the characteristic of low virulence strain, is used as vaccine candidate strain The security that vaccine is used can more be ensured.

Table 7：RSL-P plants, rSL plants IVPI measure

Stability test after the inactivation and inactivation of embodiment 8, WF plants, rSL-P plants and rSL strain virus

By it is above-mentioned it is a series of checking find, WF plant with rSL-P plants, rSL plants it is guaranteed on biological safety, have It is used as the potentiality of vaccine candidate strain.

By the WF strains of harvest, rSL-P plants, (EID50 is 10 to rSL plants of fresh viral allantoic fluids^9.5/ 0.1 mL) in, add eventually Concentration is 0.1% formalin, and 37 DEG C of inactivation 24h are placed in 4 DEG C of preservations.Respectively at 0h after inactivation, 24h, 48h, 7 days, 15 My god, 1 month determine HA potency, determine inactivation of viruses stability, the results are shown in Table 8.The another stoste taken after inactivation, is inoculated with 10 10 pieces of age SPF chicken embryo, 0.1mL/ pieces, 37 DEG C of culture 120h receive embryo and survey potency, examine inactivation completeness.

As a result show, it is viral relatively stable after inactivation, place after a period of time, HA potency is not remarkably decreased.And Inactivation is more thorough, and the antigen stock inoculated into chick embryo after inactivation is without death, HA potency total negatives.

Table 8：Antigen HA potency after inactivation

The preparation of embodiment 9, WF plants, rSL-P plants, rSL plants oil adjuvant killed vaccines and safety testing, steriling test

Virus stock solution used after inactivation, prepares oil adjuvant killed vaccine according to a conventional method.Every group of inactivated vaccine uses 7 ages in days respectively Vaccine 1.0mL is subcutaneously injected in SPF chickens 10, every neck, while respectively setting control 5, raises under the same conditions, continuous to see Examine 14, the feeding of record test chicken, drinking-water and clinical setting.As a result show, vaccine assimilation effect is good after being immunized, and immune chicken does not have Any adverse reaction locally and systemically is occurred, the state of chicken is completely normal.

The WF strains of preparation, rSL-P plants, rSL plants of oil-adjuvant vaccines are taken, by version in 2010《Chinese veterinary pharmacopoeia》Annex carries out nothing Bacterium is examined, and as a result meets standard, without germ contamination.

The Efficacy evaluation of embodiment 10, WF plants, rSL-P plants, rSL plants oil adjuvant killed vaccines

21 age in days SPF chickens 50, are randomly divided into five groups, and one group is negative control group, and one group is WF strain vaccine immune groups, one Group is rSL-P strain vaccine immune groups, and one group is rSL strain vaccine immune groups, and another group is Lasota plants of immune groups.Immune group every Vaccine 0.2mL is subcutaneously injected in neck, and the PBS of same dose, immune group and control group isolated rearing is immunized in control group.Respectively at exempting from Take a blood sample within 21 days afterwards, 28 days, separate serum, determine antibody.It is malicious by force with the genotype VII street strain being clinically separated after blood sampling in 28 days WH plants are attacked poison, every chicken muscle injection 10⁶EID50, isolator is raised, and is observed 14 days, the morbidity of record chicken daily and dead feelings Condition；Attack after poison the 3rd day, the throat swab and cloacal swab of four groups of immune group chickens of collection connect embryo, detect toxin expelling situation.

As a result show, can produce higher level antibody after immune group is immune 21 days, antibody level is higher within 28 days, as a result sees Shown in table 9.Attack after poison, any death does not occur in immune group, and negative control group chicken is all dead after 5 days.Toxin expelling situation shows Show, immune WF plants, rSL-P plants, the animal of rSL strain vaccines there is not toxin expelling, and Lasota plants still have toxin expelling phenomenon, are shown in Table 10 and table 11 shown in.

Table 9：Antibody titer is determined after immune

Table 10：Immune efficacy experimental result

Table 11:Attack the 3rd day virus purification result after poison

In summary, the low virulent strain constructed by the present invention, is found after vaccine immunity animal by the way that they are made, can lured Higher neutralizing antibody is given birth in artificial delivery, can resist the infringement of strong virus force genotype VII NDV, have broad application prospects.

SEQUENCE LISTING

<110>Shandong Sinder Technology Co., Ltd.

<120>A kind of genotype VII NDV low virulent strain of structure

<130>

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 395

<212> PRT

<213> 1

<400> 1

Met Ala Thr Phe Thr Asp Ala Glu Ile Asp Asp Ile Phe Glu Thr Ser

1 5 10 15

Gly Thr Val Ile Asp Ser Ile Ile Thr Ala Gln Gly Lys Ser Ala Glu

20 25 30

Thr Val Gly Arg Ser Ala Ile Pro Gln Gly Lys Thr Lys Gly Leu Ser

35 40 45

Thr Ala Trp Glu Lys His Gly Ser Val Gln Pro His Ala Ser Gln Asp

50 55 60

Ala Pro Asp Gln Pro Asp Arg Thr Glu Lys Gln Pro Ser Thr Pro Gly

65 70 75 80

Gln Ala Thr Pro His Asn Asn Pro Pro Ile Thr Ser Thr Glu Pro Pro

85 90 95

Pro Thr Gln Ala Ala Ser Glu Thr Ser Asp Thr Gln Leu Lys Thr Gly

100 105 110

Ala Ser Asn Ser Leu Leu Ser Met Leu Asp Lys Leu Ser Asn Lys Ser

115 120 125

Ser Asn Ala Lys Lys Gly Pro Trp Ser Gly Pro Gln Glu Gly His His

130 135 140

Gln Ser Pro Ala Gln Gln His Gly Asp Gln Pro Ser His Gly Ser Asn

145 150 155 160

Gln Gly Arg Pro Gln His Gln Ala Lys Ala Val Pro Gly Asn Arg Gly

165 170 175

Ile Asp Glu Asn Thr Ala Tyr His Gly Gln Arg Lys Glu Ser Gln Pro

180 185 190

Ser Ala Gly Ala Thr Pro His Ala Pro Gln Ser Gly Gln Ser Gln Asp

195 200 205

Asn Ile Pro Val Pro Val Asp Arg Val Gln Leu Pro Ala Asp Phe Ala

210 215 220

Gln Ala Met Met Ser Met Met Glu Ala Leu Ser Gln Thr Val Ser Ile

225 230 235 240

Val Asp His Gln Leu Asp Leu Val Leu Lys Gln Thr Ser Ser Ile Pro

245 250 255

Met Met Arg Ser Glu Ile Gln Gln Leu Lys Thr Ser Val Ala Ile Met

260 265 270

Glu Ala Asn Leu Gly Met Met Lys Ile Leu Asp Pro Gly Cys Ala Asn

275 280 285

Val Ser Ser Leu Ser Asp Leu Arg Ala Val Ala Arg Ser His Pro Val

290 295 300

Leu Val Ser Gly Pro Gly Asp Pro Ser Pro Tyr Val Thr Gln Glu Gly

305 310 315 320

Glu Met Thr Leu Asn Lys Leu Ser Gln Pro Val Gln His Pro Ser Glu

325 330 335

Leu Ile Lys Ser Ala Thr Ala Ser Gly Pro Asp Met Gly Val Glu Lys

340 345 350

Asp Thr Val Arg Ala Leu Ile Thr Ser Arg Pro Met His Pro Ser Ser

355 360 365

Ser Ala Lys Leu Leu Ser Lys Leu Asp Ala Ala Lys Ser Ile Glu Glu

370 375 380

Ile Arg Lys Ile Lys Arg Leu Ala Leu Asn Gly

385 390 395

<210> 2

<211> 1188

<212> DNA

<213> 2

<400> 2

atggctactt ttacagatgc ggagatagat gacatatttg agaccagcgg gactgtcatt 60

gatagcataa ttacggccca gggcaaatca gctgagaccg tcggaagaag cgcgatcccg 120

cagggcaaga ccaaaggtct aagcacagca tgggagaagc acgggagtgt ccagccacac 180

gccagtcagg acgcccctga ccaaccagac agaacagaaa aacagccatc cacacctggg 240

caggcgactc cacacaacaa cccgccgatc acatccactg aaccgccccc cactcaggcc 300

gcaagcgaga ccagcgacac acagctcaaa accggagcaa gcaactccct tctgtccatg 360

ctcgacaaat tgagcaataa atcgtctaat gctaaaaagg gcccatggtc gggtccccaa 420

gaagggcatc accaatctcc ggcccaacaa cacggggacc agccgagcca tggaagcaac 480

cagggaagac cacagcacca ggccaaagcc gtccctggaa accggggcat agacgagaac 540

acagcatatc atggacaacg gaaggagtca caaccatcag ctggtgcaac ccctcatgcg 600

ccccagtcag ggcagagcca agacaatatt cctgtacctg tggatcgtgt ccagctacct 660

gccgactttg cgcaggcgat gatgtctatg atggaggcat tatctcagac ggtaagtata 720

gttgatcatc agctggacct agtcttgaaa cagacatcct ctattcctat gatgcgatct 780

gaaatccaac agctcaagac atctgttgcg atcatggaag ctaacttagg catgatgaaa 840

attctggacc ctggttgtgc caacgtttca tccttaagtg atctccgggc agtagcccga 900

tcccacccag tcctagtttc aggccccgga gacccatctc cttacgtgac acaagaaggt 960

gaaatgacgc tcaataaact ctcacaacca gtgcagcacc cttctgaatt gattaagtct 1020

gccaccgcaa gcgggcctga catgggagtg gagaaggaca ctgtccgcgc attaatcacc 1080

tcacgcccga tgcatccaag ctcctcggct aagctcctga gcaagctaga tgcagccaag 1140

tcaattgaag agatcaggaa gattaaacgc cttgcgctga atggttga 1188

Claims

1. a kind of VII types NDV low virulent strain, it is characterised in that described low virulent strain is by the P of VII type NDVs The amino acid of 237 of albumen and 240 sports threonine T and isoleucine I respectively；Simultaneously by VII type NDVs F protein simultaneously carry out hypotoxicity mutation build.

2. low virulent strain as claimed in claim 1, it is characterised in that described low virulent strain be by reverse genetic manipulation method come Build.

3. low virulent strain as claimed in claim 2, it is characterised in that described reverse genetic manipulation method includes following step Suddenly：

The cell line of construction expression t7 rna polymerase；

The auxiliary recombinant plasmid needed during genotype VII NDV NDV rescues and a full-length genome restructuring are provided Carrier, auxiliary recombinant plasmid includes NDV NP albumen, P albumen, F protein and L GFPs respectively；Wherein 237 of P albumen Amino acid with 240 is respectively T and I；

Recombinant plasmid and a full-length genome recombinant vector will be aided in be transferred in the cell line of expression t7 rna polymerase, culture Obtain genotype VII NDV low virulent strain.

4. low virulent strain as claimed in claim 3, it is characterised in that described cell line, is by the base of expression t7 rna polymerase Transfection DF1 cells are obtained after because being connected with carrier PCI-neo.

5. low virulent strain as claimed in claim 1, it is characterised in that the deposit number of described low virulent strain is CCTCC NO: V201709。

6. application of the low virulent strain described in claim any one of 1-5 in vaccine is prepared.

7. application as claimed in claim 6, it is characterised in that described vaccine is inactivated vaccine.