CN107164500B - Primer, kit and detection method for detecting ips typographus - Google Patents
Primer, kit and detection method for detecting ips typographus Download PDFInfo
- Publication number
- CN107164500B CN107164500B CN201710448505.8A CN201710448505A CN107164500B CN 107164500 B CN107164500 B CN 107164500B CN 201710448505 A CN201710448505 A CN 201710448505A CN 107164500 B CN107164500 B CN 107164500B
- Authority
- CN
- China
- Prior art keywords
- primer
- pcr
- dna
- kit
- bark
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer, a kit and a detection method for detecting ips typographus. The detection method is nested PCR, and the used primers are shown as SEQ ID NO.1 and SEQ ID NO. 2. The invention also provides a kit for detecting the ips typographus and the like, which comprises the primer. The detection method and the kit thereof have the advantages of simple operation, accuracy, reliability, short detection time, good specificity and the like, can distinguish the bark beetles from other bark beetles, and has the detection limit of 20 pg.
Description
Technical Field
The invention relates to the field of molecular biology, in particular to a primer, a kit and a detection method for detecting ips typographus.
Background
The yellow fir bark beetle (Dendroctonus pseudosupersae Hopkins) is the bark beetle which is most frequently captured by the port in recent years, and seriously harms forest and wood resources. In recent years, wood pests carried by a large number of inbound wood, wood products and wood packages are extremely complex, and common pests are longicorn, bark beetle, gerbil, weevil and the like. Among them, bark beetles are difficult to identify rapidly due to their complex epidemic situation and small adult bodies (often less than 9mm), and the population of the bark beetles can be identified by less than 12% at present. According to statistics, the trapping frequency of the bark beetles of the yellow fir accounts for 36.31 percent of the total trapping frequency of the bark beetles, and is 29.3 percent higher than that of the bark beetles of the second frequency. In order to effectively control the foreign pests, the foreign pests are firstly identified accurately and rapidly in the field inspection of the port. How to purposefully intercept and judge the bark beetle epidemic situation, improve the pertinence and effectiveness of quarantine, protect the production safety and ecological safety of the forestry in China, and solve the rapid identification work of the bark beetle is very important.
At present, researches on the bark beetles of the yellow fir at home and abroad are few, the researches are mainly focused on the aspect of adult morphology, meanwhile, the identification on the bark beetles at home and abroad is mainly carried out by an adult morphology method, the method needs professional insect taxonomy knowledge and has high requirements on personnel, the bark beetles carried in a large number of inbound wood, wooden products and wood packages are complex in state, the research on the adult morphology is difficult to deal with, the requirement on clearance speed during port quarantine is high, and the eggs and the larvae cannot be bred to adults and then identified.
The DNA barcode technology is a species identification means established on the basis of modern advanced DNA amplification, sequencing and comparison technologies by using a section of gene fragment which is moderate in conservation and easy to obtain and commonly owned by organisms as a standard. Compared with the traditional morphological identification, the species identification by using the DNA barcode has the following advantages: species identification is not limited by species development state any more, and the defect that eggs, larvae, pupae and the like cannot be directly identified is overcome; the method greatly reduces the experience and professional background knowledge of an identifier, reduces the interference of subjective judgment, and ensures that the species identification is more accurate and rapid.
In recent years, identification and phylogenetic relationship research of species by molecular techniques have become a fast and effective method, wherein the 5' end sequence of mitochondrial gene has the characteristics of large genetic distance between species, conservation of the internal sequence of species, and conservation of sequences at both ends, so that universal primers can be designed, and the like, and the method becomes an ideal gene for species identification and species evolution research. The rapid identification method based on the insect mitochondrion COI gene segment is widely applied in recent years, and the rapid detection kits for lepidoptera, hymenoptera and coleoptera insects are also endless, thereby effectively supplementing the defects of morphological classification.
Disclosure of Invention
Technical problem to be solved
The invention aims to solve the technical problem of how to effectively identify the bark beetles of the yellow fir.
(II) technical scheme
In order to solve the above technical problem or at least partially solve the above problem, the present invention provides a primer for detecting ips typographus, the primer comprising a specific primer pair, the nucleotide sequence of which is:
a forward primer: 5'-AGCCCCAAGGATAGATGA-3', as shown in SEQ ID NO. 1;
reverse primer: 5'-AGGAATCCCAGGAAGACT-3', as shown in SEQ ID NO. 2.
The invention compares and screens the mtDNA COI gene of the bark beetle of the yellow fir with the mtDNA COI gene sequences of other insects published on NCBI, finds that the homology between the mtDNA COI gene species of the bark beetle of the yellow fir can reach more than 99 percent, and has large difference with the mtDNA COI gene of other insects, thereby proving that the fragment has specificity to the bark beetle of the yellow fir, and can well distinguish the bark beetle from other species insects.
In a preferred embodiment of the present invention, in order to better amplify the COI gene and efficiently detect the bark beetle, the primers for detecting the bark beetle further comprise a universal primer, and the nucleotide sequence of the universal primer is preferably:
LCO 1490: 5'-GGTCAACAAATCATAAAGATATTGG-3', as shown in SEQ ID NO. 3;
HCO 2198: 5'-TAAACTTCAGGGTGACCAAAAAATCA-3', as shown in SEQ ID NO. 4.
The invention also provides a kit containing the primer.
The invention also provides a detection reagent containing the primer.
Further, the kit or the detection reagent also comprises Taq enzyme, PCR Buffer and dNTP mix.
The kit or the detection reagent comprises a primer for detecting the ips typographus, and the ips typographus can be efficiently detected through the primer.
The invention also provides a method for detecting the bark beetles of the yellow fir, which comprises the following steps:
(1) extracting sample DNA;
(2) using the DNA extracted in the step (1) as a template, and carrying out PCR amplification reaction by using the forward primer and the reverse primer, wherein,
a forward primer: 5'-AGCCCCAAGGATAGATGA-3', as shown in SEQ ID NO. 1;
reverse primer: 5'-AGGAATCCCAGGAAGACT-3', as shown in SEQ ID NO. 2;
(3) the PCR products were analyzed.
The detection method is a nested PCR method.
Further, in order to better amplify the COI gene, the step (2) is specifically as follows:
(21) taking the DNA extracted in the step (1) as a template, and performing a first round of PCR amplification by using a universal primer, wherein the amplified band is 650-750bp, preferably 700 bp;
(22) taking a product obtained by diluting the first round of PCR amplification product according to the ratio of 1: 50-100 as a template, and carrying out second round of PCR amplification by using a forward primer and a reverse primer;
wherein, the universal primers are LCO1490 and HCO 2198; the nucleotide sequences of the forward primer and the reverse primer are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.
In a preferred embodiment of the present invention, in step (21), the PCR reaction system comprises, in terms of 25. mu.L, 0.125. mu.L of Taq enzyme, 2.5. mu.L of 10 × PCR Buffer, 2. mu.L of dNTP mix, 1. mu.L of DNA, 1. mu.L of primer LCO1490, 1. mu.L of primer HCO2198 and 17.375. mu.L of sterilized deionized water.
Further, in this step (21), the PCR reaction conditions were pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, renaturation at 56 ℃ for 30s, and extension at 72 ℃ for 1.5min for 35 cycles; extension at 72 ℃ for 5 min.
In a preferred embodiment of the present invention, in step (22), the PCR reaction system is 0.125. mu.L of Taq enzyme, 2.5. mu.L of 10 × PCR Buffer, 2. mu.L of dNTP mix, 1. mu.L of DNA, 1. mu.L of forward primer, 1. mu.L of reverse primer and 17.375. mu.L of sterilized deionized water, measured in 25. mu.L.
Further, in this step (22), the PCR reaction conditions are: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, renaturation at 50 ℃ for 30s, extension at 72 ℃ for 1.5min, 35 cycles; extension at 72 ℃ for 5 min.
Among them, in the step (22), the amplification ratio is preferably 1: 50.
In a preferred embodiment of the present invention, the step (3) is: when the amplified band size of the PCR product is 343bp, the result is positive.
The invention also provides application of the method for detecting the ips typographus in plant protection.
The invention can effectively solve the problem that the bark beetles are different in insect state and difficult to identify in port field capture by applying molecular biology technology, designs and screens a pair of specific primers of the bark beetles according to mitochondrial DNA COI sequences measured by experiments, and further verifies the specificity and sensitivity of the primers through a real-time fluorescence PCR experiment, wherein the specific primers of the bark beetles designed in the experiments can specifically distinguish the bark beetles from other bark beetles, the detection limit of the bark beetles is 20pg, and other five bark beetles cannot be amplified when being 20ng, which indicates that the sensitivity of the primers to the bark beetles of the bark beetles is at least 1000 times higher than that of the bark beetles of other species, and the specificity is good.
Drawings
FIG. 1 is a diagram showing the detection of the first PCR amplification products of five bark beetles by agarose gel electrophoresis in the present invention; wherein, lanes: 1, bark beetle of the masson pine; 2, larch bark beetle; 3, northern bark beetle; 4, bark beetle of yellow fir; 5, pine bark beetle; CK is negative control; m is DL2000 Marker (100,250,500,750,1000,2000 bp);
FIG. 2 is a diagram showing the detection of the second round PCR amplification products of five bark beetles at 50 ℃ by agarose gel electrophoresis according to the present invention; wherein, lanes: 1, bark beetle of the masson pine; 2, larch bark beetle; 3, northern bark beetle; 4, bark beetle of yellow fir; 5, pine bark beetle; CK is negative control; m is DL2000 Marker (100,250,500,750,1000,2000 bp);
FIG. 3 is a graph showing the amplification curve of real-time quantitative PCR of bark beetle of the species Abies junior in the example of the present invention; wherein, the 20ng, 2ng, 200pg and 20pg marked in the figure are the adding amount of the bark beetle template of the yellow fir in the real-time quantitative PCR;
FIG. 4 shows template concentration and C of real-time quantitative PCR reaction in an embodiment of the present inventionTStandard graph therebetween;
FIG. 5 is a melting curve diagram of real-time quantitative PCR of bark beetle of the yellow fir in the embodiment of the present invention.
Detailed Description
The following examples are given to further illustrate the embodiments of the present invention. The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.
Unless otherwise specified, the technical means used in the examples are conventional technical means well known to those skilled in the art. The reagents used in the examples are commercially available unless otherwise specified.
Example 1 nested PCR detection method of bark beetle of yellow fir
(1) The reagents used were EZgene insert gDNA Kit, available from BIOMIGA, SYBR PremixEx Taq II (Perfect Real time), available from Bao bioengineering (Dalian) Ltd, DL2000 DNA Marker, available from Bao bioengineering (Dalian) Ltd, 1 × Loading Buffer, available from Bao bioengineering (Dalian) Ltd.
(2) DNA extraction: the Kit EZgene insert gDNA Kit from BIOMIGA corporation was used to extract gDNA of target insects including the bark beetles of the Mesona, the bark beetles of the Larix gmelini, the northern tumor bark beetles, the bark beetles of the Yew and the bark beetles of the Pinus sylvestris, and the DNA was diluted to 50 ng/. mu.L.
(3) The gDNA was used as template for the first round of PCR amplification of COI sequence with fragment size of 700bp using universal primers (Table 1-1).
TABLE 1 Universal primers LCO1490 and HCO2198 sequences
The PCR reaction system is shown in Table 2.
TABLE 2 PCR reaction System
The PCR reaction condition is pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, renaturation at 56 ℃ for 30s, and extension at 72 ℃ for 1.5min for 35 cycles; extension at 72 ℃ for 5 min.
(4) And (3) selecting a positive PCR product to perform sequencing according to the first round of PCR detection result, wherein the sequencing work is finished by the company of Biotechnology engineering (Shanghai). And processing the sequencing result, analyzing by adopting bio-edge software, reserving the consensus sequence for carrying out homologous comparison, and finding out a sequence with obvious difference between the bark beetle and the kindred species of the bark beetle. The treated bark beetle sequence was introduced into the Primer Premier 5.0 software to design specific primers for bark beetle, as shown in Table 3.
(5) The first round of PCR products was diluted 50 times as template and the second round of PCR amplification was performed using specific primers (Table 3), and the result was positive if the fragment size was 343 bp.
TABLE 3 primer pair sequences specific for bark beetles of yellow fir
The PCR reaction was identical to the first round of PCR reaction, namely, 0.125. mu.L of TaKaRa Taq (5U/. mu.L), 2.5. mu.L of 10 × PCR Buffer, 2. mu.L of dNTP mix (2.5 mM each), 1. mu.L of template DNA, 1. mu.L of forward primer, 1. mu.L of reverse primer, and 17.375. mu.L of sterilized deionized water, in 25. mu.L.
The PCR reaction condition is pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, renaturation at 50 ℃ for 30s, and extension at 72 ℃ for 1.5min for 35 cycles; extension at 72 ℃ for 5 min.
(6) 5 kinds of insect genome DNA (1: Mesona dentata bark beetle; 2: Larix dahurica bark beetle; 3: northern tumor bark beetle; 4: yellow fir bark beetle; 5: pine dodecadentate bark beetle) are used as templates, meanwhile, negative control is set, detection is carried out according to the established nested PCR method, as can be seen from figure 1, through the first round of PCR amplification, the universal primer selected in the experiment can successfully amplify five kinds of bark beetles, the size of the product is about 700bp, the integrity of the DNA sequence of a target region is shown, and reliable guarantee is provided for subsequent sequence comparison and identification work.
FIG. 2 shows the second round of PCR amplification results at 50 deg.C, and it can be clearly seen from FIG. 2 that the primers designed at 50 deg.C can distinguish the bark beetle from other 4 bark beetles and the control, and meet the requirement of rapid identification.
(7) Evaluation of specificity
The specificity of the nested PCR primer is verified by a real-time fluorescent quantitative PCR method.
As is clear from the reaction results of ABI PRISM 7500 Real Time System, as shown in FIG. 3, the C of the bark beetle is 20pgTThe value is still less than 20, while the C of other species bark beetle is at 20ngTThe values are all larger than 25, which indicates that the bark beetle of the yellow fir can be amplified at 20pg, while the other five bark beetles can not be amplified at 20ng, and the specificity of the primer is better. As shown in FIG. 4, the results of the standard curve show template concentration and CTThe values show good correlation, the slope of a standard curve of the reaction is-3.627, R2 is 0.99, and the Eff% is 88.66, which indicates that the amplification efficiency of the experiment is high, and the experiment result is reliable. Meanwhile, as shown in fig. 5, the melting curve is a quality control approach in the whole reaction process, and the melting curve of the reaction is a single peak, and has no secondary peak and abnormal amplification, which indicates that the number of primer dimers is small and the specificity of PCR is high.
Finally, the method of the present invention is only a preferred embodiment and is not intended to limit the scope of the present invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> Beijing university of forestry
<120> primer, kit and detection method for detecting ips typographus
<130>KHP171111002.4
<160>4
<170>PatentIn version 3.5
<210>1
<211>18
<212>DNA
<213> Artificial sequence
<400>1
<210>2
<211>18
<212>DNA
<213> Artificial sequence
<400>2
<210>3
<211>25
<212>DNA
<213> Artificial sequence
<400>3
<210>4
<211>26
<212>DNA
<213> Artificial sequence
<400>4
taaacttcagggtgaccaaaaaatca 26
Claims (8)
1. A primer for detecting ips typographus is characterized by comprising the following components:
a forward primer: 5’-AGCCCCAAGGATAGATGA-3’；
Reverse primer: 5’-AGGAATCCCAGGAAGACT-3’；
Also comprises a pair of universal primers:
LCO1490：5’-GGTCAACAAATCATAAAGATATTGG-3’；
HCO2198：5’-TAAACTTCAGGGTGACCAAAAAATCA-3’。
2. a kit comprising the primer of claim 1.
3. The kit of claim 2, further comprising Taq enzyme, PCR Buffer and dNTP mix.
4. A method for detecting ips typographus is characterized by comprising the following steps:
(1) extracting sample DNA;
(2) performing PCR amplification reaction by using the DNA extracted in the step (1) as a template and using the forward primer and the reverse primer of claim 1;
(3) analyzing the PCR product;
wherein, the step (2) is specifically as follows:
(21) taking the DNA extracted in the step (1) as a template, and utilizing the universal primer in the claim 1 to carry out the first round of PCR amplification, wherein the band of the amplification is 650-750 bp;
(22) and (3) taking a product obtained by diluting the first round PCR amplification product by 1: 50-100 as a template, and carrying out second round PCR amplification by using the forward primer and the reverse primer in claim 1.
5. The method of claim 4, wherein in step (21), the PCR reaction system comprises 25. mu.L of 0.125. mu.L of LTaq enzyme, 2.5. mu.L of 10 × PCR Buffer, 2.5. mu.L of dNTP mix, 1. mu.L of DNA, 1. mu.L of primer LCO1490, 1. mu.L of primer HCO2198 and 17.375. mu.L of sterilized deionized water.
6. The method of claim 4 or 5, wherein in step (22), the PCR reaction system comprises 25 μ L of 0.125 μ L of LTaq enzyme, 2.5 μ L of 10 × PCR Buffer, 2 μ L of dNTP mix, 1 μ L of DNA, 1 μ L of forward primer, 1 μ L of reverse primer and 17.375 μ L of sterile deionized water.
7. The method of claim 6, wherein the PCR reaction conditions in step (22) are: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, renaturation at 50 ℃ for 30s, extension at 72 ℃ for 1.5min, 35 cycles; extension at 72 ℃ for 5 min.
8. Use of the method according to any one of claims 4 to 7 for plant protection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710448505.8A CN107164500B (en) | 2017-06-14 | 2017-06-14 | Primer, kit and detection method for detecting ips typographus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710448505.8A CN107164500B (en) | 2017-06-14 | 2017-06-14 | Primer, kit and detection method for detecting ips typographus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107164500A CN107164500A (en) | 2017-09-15 |
| CN107164500B true CN107164500B (en) | 2020-06-26 |
Family
ID=59818520
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710448505.8A Expired - Fee Related CN107164500B (en) | 2017-06-14 | 2017-06-14 | Primer, kit and detection method for detecting ips typographus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107164500B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110804664B (en) * | 2019-11-26 | 2022-12-06 | 拱北海关技术中心 | Primer pair and kit for identifying bark beetles in Meidiao and application of primer pair and kit |
| CN111500745B (en) * | 2020-04-29 | 2022-04-26 | 北京林业大学 | Long fragment amplification primer for eliminating interference of mitochondrion pseudogene of dendroctonus valens |
| CN111748638A (en) * | 2020-07-28 | 2020-10-09 | 南京海关动植物与食品检测中心 | Specific primer, kit and method for identifying ips insects based on DNA bar code |
| CN113025724B (en) * | 2021-03-10 | 2023-01-17 | 华南农业大学 | Dual PCR primer, method and kit for identifying small pissodes punctatus |
| CN113025727A (en) * | 2021-04-22 | 2021-06-25 | 海口海关热带植物隔离检疫中心 | Real-time fluorescent PCR detection method for ips typographus and primer and probe for detection |
| CN112941207A (en) * | 2021-04-22 | 2021-06-11 | 海口海关热带植物隔离检疫中心 | Real-time fluorescent PCR detection method for bark beetle of Pinus massoniana, and primer and probe for detection |
| CN112921106A (en) * | 2021-04-22 | 2021-06-08 | 海口海关热带植物隔离检疫中心 | Real-time fluorescent PCR detection method for bark beetle of yellow fir, and primer and probe for detection |
| CN113604586A (en) * | 2021-09-03 | 2021-11-05 | 上海市园林科学规划研究院 | Specific primer of bark beetle of black branch |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146811A (en) * | 2012-12-28 | 2013-06-12 | 北京林业大学 | Method to detect dendroctonus valens and detection kit |
| CN104232634A (en) * | 2014-09-25 | 2014-12-24 | 北京林业大学 | SS-COI (Sirex noctilio F. specific cytochrome oxidase I) primer pair and quick molecular detection method |
-
2017
- 2017-06-14 CN CN201710448505.8A patent/CN107164500B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146811A (en) * | 2012-12-28 | 2013-06-12 | 北京林业大学 | Method to detect dendroctonus valens and detection kit |
| CN104232634A (en) * | 2014-09-25 | 2014-12-24 | 北京林业大学 | SS-COI (Sirex noctilio F. specific cytochrome oxidase I) primer pair and quick molecular detection method |
Non-Patent Citations (2)
| Title |
|---|
| Molecular and Morphological Analysis of Dendroctonus pseudotsugae (Coleoptera: Curculionidae: Scolytinae): An Assessment of the Taxonomic Status of Subspecies;ENRICO A. RUIZ等;《ANNALS OF THE ENTOMOLOGICAL SOCIETY OF AMERICA》;20091130;第982-997页 * |
| 基于线粒体COI基因鉴定大小蠹属昆虫;殷玉生等;《福建林业科技》;20140430;第63-68页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107164500A (en) | 2017-09-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107164500B (en) | Primer, kit and detection method for detecting ips typographus | |
| Trachsel et al. | Identification of taeniid eggs in the faeces from carnivores based on multiplex PCR using targets in mitochondrial DNA | |
| Duan et al. | Development and evaluation of a novel and rapid detection assay for Botrytis cinerea based on loop-mediated isothermal amplification | |
| Chen et al. | Rapid Sanger sequencing of the 16S rRNA gene for identification of some common pathogens | |
| Przybylska et al. | Detection of the quarantine species Thrips palmi by loop-mediated isothermal amplification | |
| US20210246499A1 (en) | Detection of short homopolymeric repeats | |
| Hedman et al. | Pre-PCR processing in bioterrorism preparedness: improved diagnostic capabilities for laboratory response networks | |
| CN105331743A (en) | Kit for rapidly detecting various viruses in muskmelon by one step and rapid detection method adopting kit | |
| CN105779611B (en) | High-throughput method for detecting transgenic crop elements and strains by multiplex enrichment quantitative PCR (ME-qPCR) | |
| Pisal et al. | Detection of mycoplasma contamination directly from culture supernatant using polymerase chain reaction | |
| Hantula et al. | Specific primers for the differentiation of Heterobasidion annosum (s. str.) and H. parviporum infected stumps in northern Europe | |
| CN110184387B (en) | RT-LAMP detection primer for detecting ANSVV, application thereof, detection reagent and detection method | |
| CN102031313A (en) | RT-PCR (reverse transcription-polymerase chain reaction) method for detecting the infection reality of host by arabis mosaic virus, bean yellow mosaic virus and lily symptomless virus | |
| CN101864476B (en) | Method for identifying coilia ectenes and coilia mystus by using PCR | |
| Yu et al. | Rapid identification of Bactrocera latifrons (Dipt., Tephritidae) by real‐time PCR using SYBR Green chemistry | |
| KR102146421B1 (en) | Primer set for simultaneously diagnosing viruses of Ligusticum chuanxiong and Cnidium officinale, method for diagnosing viruses of Ligusticum chuanxiong and Cnidium officinale by using the same and kit using the same | |
| CN107345250A (en) | Authentication method and primer special are expanded based on 16SrRNA quail meat derived components PCR | |
| CN114958875B (en) | Screening and application of reference gene metG of citrus yellow-long pathogen | |
| Bracalini et al. | Alien pest molecular diagnostics: can DNA traces be exploited to assess the damage caused by the western conifer seed bug on stone pine fructification? | |
| KR102213231B1 (en) | Primer set for detecting of virus infected Pepper, and uses thereof | |
| Minarovič et al. | Animal species identification by PCR–RFLP of cytochrome b | |
| CN108192986B (en) | Culex pipiens pallens and Culex fatigus ND5 gene identification kit based on high-resolution melting curve and identification method thereof | |
| KR101835006B1 (en) | Method of enhancing efficiency and sensitivity in polymerase chain reaction and composition therefor | |
| EP3245297B1 (en) | Method and kit for identification of nematodes, forest plant pests, by real-time pcr | |
| JP6421295B2 (en) | Mushroom identification method and identification kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200626 |