CN107164498A - A kind of method for identifying molecules for Paeonia papaveracea and Central Plains tree peony - Google Patents
A kind of method for identifying molecules for Paeonia papaveracea and Central Plains tree peony Download PDFInfo
- Publication number
- CN107164498A CN107164498A CN201710444509.9A CN201710444509A CN107164498A CN 107164498 A CN107164498 A CN 107164498A CN 201710444509 A CN201710444509 A CN 201710444509A CN 107164498 A CN107164498 A CN 107164498A
- Authority
- CN
- China
- Prior art keywords
- tree peony
- central plains
- paeonia papaveracea
- sequence
- sequences
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of method for identifying molecules for Paeonia papaveracea and Central Plains tree peony, this method comprises the following steps：DNA extractions are carried out to sample to be identified；PCR is expanded；Sequence calibration, comparison；Sequence analysis.The present invention by experimental studies have found that, at two sites of 31bp and 79bp with all Central Plains tree peony sequences difference occurs for the matK sequences of Paeonia papaveracea, it is 2 most conservative difference sites, therefore the two sites can be used as the informative site for identifying Paeonia papaveracea and Central Plains tree peony.Found based on more than, the application the invention provides matK sequences as DNA bar code in identification Paeonia papaveracea.
Description
Technical field
The invention belongs to technical field of molecular biology, specifically, being related to one kind is used for Paeonia papaveracea and Central Plains tree peony
Method for identifying molecules.
Background technology
Paeonia papaveracea [Peaonia rockii (S.G.Haw et L.A.Lauener) T.Hong et J.J.Li] belongs to hair
Gelsemium section, Paeonia, Section Moutan, petal base portion tool purple spot, is famous ornamental flower, and cultivating and growing integrated distribution is blue in Gansu
The areas such as state city, Linxia and Lintao, cultivation improved seeds about more than 2000 are planted, because Paeonia papaveracea traditional category is by wild species
Introduction and acclimatization, afterwards by hybridizing with Central Plains tree peony formed by shape, and current new cultigen be with Central Plains tree peony again
What backcrossing was obtained, therefore its introduces a collection is complicated, different regions are each named, and often have homonym, synonym phenomenon, in seedling life
Production, marketing and promoting there are problems that it is chaotic, mutually generation, influence local industries prestige.With pushing away for Paeonia papaveracea
Extensive farming is planted and rearing new variety, and following variety source troop is huge, will be related to the dispute of intellectual property.Paeonia papaveracea is male with Central Plains
The result that pellet hybridizes for a long time, affiliation is complicated, form of diverse, distinguishes smaller between kind, and tree peony is with kind and with plant tool
There is metamorphosis affected by environment to enrich.Carry out identifying extremely difficult using traditional morphology, histologic characteristics, this gives purple plague purpura
Varieties of Peony intellectual property protection and identification bring difficulty.
The content of the invention
It is an object of the invention to provide a kind of method for identifying molecules for Paeonia papaveracea and Central Plains tree peony, using the party
Method identifies Paeonia papaveracea, with it is quick, accurate the features such as, be adapted to popularization and application.
Its concrete technical scheme is：
A kind of method for identifying molecules for Paeonia papaveracea and Central Plains tree peony, comprises the following steps：
(1) DNA extractions are carried out to sample to be identified；
(2) PCR is expanded
STb gene using step (1) extraction is expanded, P1 with the forward and reverse primer of matK sequences respectively as template
(5 '-CCTATATCCGCTACTCCTTC-3 ') and P2 (5 '-CTCAGTGAATTTCACCACG-3 '), respectively obtains amplified production；
(3) sequence calibration, comparison
By the sample sequence after the Paeonia papaveracea matK sequences (AF033592.1) from GeneBank and all amplifications, warp
Manual synchronizing is crossed, is alignd and is removed the fragment in guiding region and the poor region of sequencing quality, it is final to obtain the consistent sequence of clean, length
Row are compared；
(4) sequence analysis
Utilize the variant sites between MEGA (5.05) analytical sequence.
Compared with prior art, beneficial effects of the present invention：
The present invention by experimental studies have found that, the matK sequences of Paeonia papaveracea are at two sites of 31bp and 79bp and institute
There is Central Plains tree peony sequence to occur difference, be 2 most conservative difference sites, thus the two sites can as identification Paeonia papaveracea and
The informative site of Central Plains tree peony.Found based on more than, it is male in identification purple plague purpura as DNA bar code the invention provides matK sequences
Application in pellet.
The present invention can be compared on the basis of traditional taxonomy by extracting DNA, PCR amplification technique and sequence analysis,
Paeonia papaveracea and Central Plains tree peony cultivars can effectively be made a distinction, due to the complexity of tree peony genetic background, utilize matK points
The method of son mark can avoid the error occurred in traditional taxonomy, can it is more effective and rapid must for domestic tree peony market and
Kind breeds the basis for bringing theory and practice.
Brief description of the drawings
Fig. 1 Paeonia papaveraceas and Central Plains tree peony matK sequence 31bp differences site figure；
Fig. 2 Paeonia papaveraceas and Central Plains tree peony matK sequence 79bp differences site figure；
Fig. 3, which is based on Paeonia papaveracea and Central Plains tree peony part cultivar matK sequences, and maximum parsimony method (MP) is built is
System development tree graph.
Embodiment
Technical scheme is described in more detail with reference to specific embodiment.
Embodiment
With 4 parts of Paeonia papaveracea wild species materials of Gansu different regions, 42 parts of Paeonia papaveracea cultigens and from Luoyang
11 parts of Central Plains tree peony germplasm are examination material, and sample DNA, the forward primer of use are extracted with TIANGEN companies DNA extraction kit：
CCTATATCCGCTACTCCTTC, reverse primer CTCAGTGAATTTCACCACG, PCR amplification condition are 95 DEG C of pre-degeneration 5min,
Following 95 DEG C of 30s, 48 DEG C of annealing 45s, 72 DEG C of extension 30s, carry out 35 circulations, last 72 DEG C extend 7min, acquisition altogether
Product is compared after sequencing, is that Paeonia papaveracea is consolidated with 2 that Central Plains tree peony is identified in 31bp (base T) and 79bp (base C) place
Determine difference site.
As shown in Figure 1, Figure 2, Figure 3 shows, in Fig. 1, Fig. 2,1-20 represents Cultivar, and 21-24 is Central Plains tree peony cultivars,
S is the Paeonia papaveracea matK sequences from Genebank.The sequence of all Paeonia papaveraceas and Central Plains tree peony cultivars is compared
After analysis, two fixed difference sites are can obtain, can be clearly by Paeonia papaveracea and Central Plains tree peony product from the two sites
Plant and make a distinction.Then the maximum brief trees of MP of all samples are constructed, as can be seen that each product of Central Plains tree peony from chadogram
Plant and gather first for together, the affiliation between them is nearer, and Cultivar does not enter with Central Plains tree peony cultivars at one
Change in branch, and affiliation is farther out, therefore, can be effectively separated by Paeonia papaveracea and Central Plains tree peony from phylogenetic tree.
The foregoing is only a preferred embodiment of the present invention, protection scope of the present invention not limited to this, any ripe
Those skilled in the art are known in the technical scope of present disclosure, the letter for the technical scheme that can be become apparent to
Altered or equivalence replacement are each fallen within protection scope of the present invention.
SEQUENCE LISTING
<110>Gansu Agriculture University
<120>A kind of method for identifying molecules for Paeonia papaveracea and Central Plains tree peony
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<400> 1
cctatatccg ctactccttc 20
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence
<400> 2
ctcagtgaat ttcaccacg 19
Claims (1)
1. a kind of method for identifying molecules for Paeonia papaveracea and Central Plains tree peony, it is characterised in that comprise the following steps：
(1) DNA extractions are carried out to sample to be identified；
(2) PCR is expanded
STb gene using step (1) extraction is expanded with the forward and reverse primer of matK sequences respectively as template, and P1 5 '-
CCTATATCCGCTACTCCTTC-3 ' and-the CTCAGTGAATTTCACCACG-3 ' of P2 5 ', respectively obtains amplified production；
(3) sequence calibration, comparison
By the sample sequence after the Paeonia papaveracea matK sequences AF033592.1 from GeneBank and all amplifications, by artificial
The fragment in guiding region and the poor region of sequencing quality is corrected, aligns and remove, the final consistent sequence of clean, length that obtains is carried out
Compare；
(4) sequence analysis
Utilize the variant sites between MEGA5.05 analytical sequences.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710444509.9A CN107164498A (en) | 2017-06-13 | 2017-06-13 | A kind of method for identifying molecules for Paeonia papaveracea and Central Plains tree peony |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710444509.9A CN107164498A (en) | 2017-06-13 | 2017-06-13 | A kind of method for identifying molecules for Paeonia papaveracea and Central Plains tree peony |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107164498A true CN107164498A (en) | 2017-09-15 |
Family
ID=59825462
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710444509.9A Pending CN107164498A (en) | 2017-06-13 | 2017-06-13 | A kind of method for identifying molecules for Paeonia papaveracea and Central Plains tree peony |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107164498A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592261A (en) * | 2019-10-11 | 2019-12-20 | 广州康和药业有限公司 | Method for identifying DNA bar code of flaccid anemone/flaccid anemone plant |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105734153A (en) * | 2016-04-20 | 2016-07-06 | 上海派森诺生物科技股份有限公司 | Method of using genes for species identification of plants |
| CN106047999A (en) * | 2016-05-26 | 2016-10-26 | 甘肃农业大学 | Method for screening DNA bar code universal sequences of seven major forage grass varieties of gramineous family |
-
2017
- 2017-06-13 CN CN201710444509.9A patent/CN107164498A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105734153A (en) * | 2016-04-20 | 2016-07-06 | 上海派森诺生物科技股份有限公司 | Method of using genes for species identification of plants |
| CN106047999A (en) * | 2016-05-26 | 2016-10-26 | 甘肃农业大学 | Method for screening DNA bar code universal sequences of seven major forage grass varieties of gramineous family |
Non-Patent Citations (1)
| Title |
|---|
| W.J.KIM ET AL.: "Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rDNA-ITS,matK,and rbcL DNA barcode sequences", 《GENETICS AND MOLECULAR RESEARCH》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592261A (en) * | 2019-10-11 | 2019-12-20 | 广州康和药业有限公司 | Method for identifying DNA bar code of flaccid anemone/flaccid anemone plant |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105296475B (en) | Chain molecular labeling and its application with capsicum anti cucumber mosaic virus ospc gene qcmv 21 | |
| CN108754013B (en) | Molecular marker closely linked with hot pepper cytoplasmic male sterility restoring gene and obtaining method and application thereof | |
| JP2012210205A (en) | Method for producing rice f1 seed, rice f1 seed, and rice male sterile line | |
| Choudhary et al. | SSR and morphological trait based population structure analysis of 130 diverse flax (Linum usitatissimum L.) accessions | |
| CN102703586B (en) | Method for constructing Prunus mume Sieb.et Zucc SSR (simple sequence repeat) genetic map | |
| CN104004828B (en) | A kind of molecule marker and application thereof identifying onion cytoplasmic type | |
| CN105368935A (en) | SSR primer set and method for seed purity identification of hot pepper variety F1 hybrid-Huifeng No. 2 | |
| CN105132570B (en) | A kind of primer sets of assistantly screening anti-stripe rust wheat and its application | |
| CN106834469B (en) | Specific molecular marker of male gametophyte of kelp and application of specific molecular marker | |
| CN106929594A (en) | The molecular labeling of the complete red bud mutation character site of the operatic circle skin and its primer and application | |
| CN107058338A (en) | The ethylene responses transcription factor gene of one yield and property of cotton association | |
| CN106498063B (en) | Breeding method for directionally improving tobacco black shank resistance through molecular marker-assisted selection | |
| Tahir et al. | Genetic and leaf characteristic diversity on 10 mutant progenies of patchouli (Pogostemon cablin) provide insights to selection strategies | |
| CN107164498A (en) | A kind of method for identifying molecules for Paeonia papaveracea and Central Plains tree peony | |
| CN106755465A (en) | The molecular labeling of QTL QFll.sicau 2D close linkage long with wheat flag leaf and application | |
| Jia et al. | Cotton germplasm resources in China | |
| CN106399498A (en) | Molecular marker assisted selection method for cauliflower flower ball pedicel length | |
| CN103627799B (en) | A kind of longan filial generation Purity method based on EST-SSR mark | |
| Chaturvedi et al. | PCR detection assay for sex determination in papaya using SCAR marker | |
| Loor Solórzano et al. | Revealing the diversity of introduced Coffea canephora germplasm in Ecuador: towards a national strategy to improve robusta | |
| CN103947541A (en) | Method for breeding rice cytoplasmic male sterile line | |
| CN105624277B (en) | Method for obtaining molecular marker closely linked with tobacco plant height development character | |
| CN113637791A (en) | Molecular marker for simultaneously identifying restorability and authenticity of pepper male sterile three-line hybrid and identification method thereof | |
| Sakhanokho et al. | Morphological and cytomolecular assessment of intraspecific variability in Scarlet eggplant (Solanum aethiopicum L.) | |
| Touchell et al. | Genetic diversity, cytogenetics, and biomass yields among taxa of Giant Reeds (Arundo species) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170915 |