CN107164369B - A kind of corynebacteria constitutive expression carrier promoter, the expression vector containing the promoter and lrp gene - Google Patents
A kind of corynebacteria constitutive expression carrier promoter, the expression vector containing the promoter and lrp gene Download PDFInfo
- Publication number
- CN107164369B CN107164369B CN201710169454.5A CN201710169454A CN107164369B CN 107164369 B CN107164369 B CN 107164369B CN 201710169454 A CN201710169454 A CN 201710169454A CN 107164369 B CN107164369 B CN 107164369B
- Authority
- CN
- China
- Prior art keywords
- promoter
- plasmid
- expression
- corynebacteria
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of methods that building corynebacteria constitutive expression carrier promoter is sequenced based on transcript profile, and the invention also discloses the corynebacteria constitutive expression carrier promoters constructed based on transcript profile sequencing, the recombinant bacterial strain obtained containing the expression vector of the promoter and expression vector conversion host cell corynebacterium glutamicum.With the expression vector for the promoter building that the present invention obtains, logarithmic phase target gene expressing quantity is low, but stationary phase destination protein expression quantity is increased substantially relative to logarithmic phase, and host germ grew is influenced low, plasmid mitotic stability is high, it is suitable for logarithmic phase not needing to express, and stationary phase needs the vector construction of the target gene of height expression, is particularly suitable for the building of amino acid fermentation engineered strain.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to corynebacteria constitutive expression carrier promoter and its building side
Method, the invention further relates to expression vectors and recombinant bacterial strain containing the promoter.
Background technique
Corynebacteria is a kind of gram-positive bacteria, three main representatives of corynebacteria: corynebacterium glutamicum, yellow
Brevibacterium and brevibacterium lactofermentum have been widely used for production a variety of chemical substance (Liebl such as amino acid and nucleotide
Deng 1991).Have stronger synthesis purpose useful by the corynebacteria mutant strain that either physically or chemically mutagenic treatment obtains
The ability of substance, and corynebacteria wild strain or mutant strain are transformed by genetic engineering and metabolic engineering, it can obtain
There must be the bacterial strain of more high production intensity.Metabolic engineering is that crucial generation is found in the multiple metabolic pathways of bar bacterium
It thanks to enzyme, the gene expression of regulation key metabolic enzymes is transformed by genetic engineering.Usual gene is all the control following table in promoter
It reaches, expression intensity depends on promoter element.Promoter from Escherichia coli, streptomycete and bacillus subtilis can be
It is expressed in Corynebacterium sp. bacteria, can be applied to the carrier system building of corynebacteria, if application is from Escherichia coli
The expression plasmid PXMJ19 of Ptac, Ptrc promoter building, PEC-XK99E, gene is in lacIqControl under carry out induction table
It reaches, but expression quantity is low, and needs to add inducer IPTG in process of production, and IPTG is fairly expensive, is unsuitable for being used as big rule
The Inducer of gene expression of mould production purpose product；Lactose can be used to substitute IPTG as inducer and be applied to large-scale life
It produces, and for most of corynebacterium strain, lactose not can enter in its cell (Brabetz etc., 1991), this
Also limit application of the inducible expression system in corynebacteria.
Constitutive promoter be not required to the specific conditions such as induction can in thallus survival period continuously expression alien gene,
To simplify operating process and there is relatively high safety, therefore it is more suitable for applying in actual production.Different thin
The constitutive gene with strongly expressed is screened and purified using means such as pcr amplified DNA probes in the house-keeping gene of bacterium, is screened
The strong promoter of composing type out, building (Jensen P R et al., the Appl Environ for recombinant vector
Microbiol,1998,64(1):82-87.).Willow etc. utilizes the endogenous strong promoter of corynebacterium glutamicum ATCC 13032
Pgro effectively promote foreign gene xylA in corynebacterium glutamicum ATCC 13032 expression (willow etc., new energy progress,
2014,5 (2): 353-357), Wang little Yuan etc. obtains the tac-M promoter of transcripting starting function by mutation, constructs composing type table
Up to carrier PDXW-10, in corynebacteria, which expresses horizontal moderate (CN:200910210962.9) of foreign protein.Group
Although constitutive promoter expression has lot of advantages, current screening technique is complicated, and suitable promoter how to be selected to carry out
Regulation to avoid causing host germ grew to be stagnated because of excessive protein expression or dysbolism, or makes host's energy exhaustion
And plasmid loss is industrialized production urgent problem to be solved.Presently, there are using if Pgro is as promoter, with purpose base
Because building composition expressive plasmid, this kind of plasmid also carry out the expression of target gene in bacteria log growth period, lead to matter together
Grain is lost before stationary phase seriously, to reduce expression effect.
The object of the invention is to establish a kind of method, bacteria log growth period silencing is found, bacterial growth deadtime is high
The promotor gene for imitating expression, composing type efficient expression plasmid is constructed with it.In the present invention, we are using transcript profile sequencing
Analyze data, find one kind and can regulate and control target gene and express weak, and the promoter of stationary phase great expression in logarithmic phase, it is general this
Class promoter is all Inducible promoter, we intercept the different genetic fragment of these promoters, is constructed a series of rodlike
Bacillus constitutive expression carrier, the series expression vector application green fluorescent protein (EGFP) are used as marker gene, and detection is respectively opened
Promoter fragment activity is strong and weak, and examines each detection plasmid mitotic stability, to filter out a series of logarithmic phase promoter vigor
Promoter low, stationary phase starting vigor is high, and the plasmid mitotic stability containing each promoter is examined, further screening makes matter
The stable promoter of grain.
Summary of the invention
The technical problem to be solved by the present invention is current constitutive promoter screening technique is complicated, and that screens opens
The expression plasmid of mover building is easily lost in host growth, also will affect the growth and metabolism of host.How one is established
The rapid screening method of constitutive promoter, and the high endogenesis promoter of stationary phase starting vigor is filtered out, and promoter constructs
Plasmid can guarantee that the stability of plasmid is our problems to be solved in the stationary phase of thalli growth.
Technical solution used by present aspect is:
A method of building corynebacteria constitutive expression carrier promoter is sequenced based on transcript profile, analyzes corynebacteria
In the transcriptional level of logarithmic phase and stationary phase each gene, is analyzed, filtered out by the transcript abundance to each gene two periods
A kind of logarithmic phase transcriptional level is low, and the gene that stationary phase transcriptional level is high, analyzes opening for gene by promoter prediction software
Sub-area is connected into expression vector using the promoter fragment of this genoid of PCR amplification, and by the DNA fragmentation of promoter, is inserted
Enter marker gene, construct promoter style, electrotransformation carrier detection is into host cell, culture host cell to logarithmic phase
And stationary phase, the OD and fluorescent protein expression situation of the growth of multi-function microplate reader detection bacterium, while in the feelings of non-resistant pressure
Under condition, continuous passage is carried out, selects low carrier detection logarithmic phase fluorescent value, stationary phase fluorescent value height and 50 Dai Erzhi of continuous passage
The host cell that grain is not lost, the promoter contained is corynebacteria constitutive expression carrier promoter.
A kind of corynebacteria constitutive expression carrier promoter based on transcript profile sequencing building, nucleotide sequence is such as
Shown in SEQ ID NO:1.
A kind of corynebacteria constitutive expression carrier, contains above-described promoter.
The corynebacteria constitutive expression carrier, it be plasmid HY-P19 restriction enzyme site insertion it is above-described
Promoter and target gene are built-up, and the nucleotide sequence of the plasmid HY-P19 is as shown in SEQ ID NO:2, the purpose
The nucleotide sequence of gene is as shown in SEQ ID NO:3.
The recombinant bacterial strain that the expression vector electrotransformation host cell corynebacterium glutamicum obtains.
Application of the recombinant bacterial strain in production isoleucine.
Beneficial effects of the present invention: the expression vector of such promoter building, logarithmic phase target gene expressing quantity is low,
But stationary phase destination protein expression quantity is increased substantially relative to logarithmic phase, and low on host germ grew influence, and plasmid passage is steady
Qualitative height is suitable for logarithmic phase and does not need to express, and stationary phase needs the vector construction of the target gene of height expression.It is especially suitable
Together in the building of amino acid fermentation engineered strain.
Production acid can be improved in fermenting and producing isoleucine in promoter, expression vector and the recombinant bacterial strain that the present invention constructs
Amount and saccharic acid conversion ratio reduce heteroacid content, have very high application prospect.
Detailed description of the invention
Fig. 1 is the building flow chart of promoter style HY-P19-Promoter-EGFP.
Specific embodiment
The present invention is described in detail below by embodiment.
Embodiment 1
1, transcript profile sequencing sample preparation and transcriptional information are analyzed:
Bacteria Culture: a ring is chosen without corynebacterium glutamicum (the H5 bacterial strain, from preservation of the production isoleucine of plasmid
The heart obtains, and deposit number is CCTCC NO:M2016609), in LB culture medium, bacterium solution is taken out and is centrifuged by 31 DEG C of overnight incubations,
Be resuspended with isometric sterile water, in the culture medium of the 5% inoculum concentration access fresh sterilizing of LBG, 31 DEG C, 200rpm cultivate to
Logarithmic phase mid-term and early stage stationary phase take out fermentation liquid, rapidly and in equal volumeBacteria Reagent
(QIAGEN) it mixes, 5000rpm is centrifuged 10min, weighs 100mg wet thallus, is put into liquid nitrogen saves rapidly.
RNA is extracted: the sample saved in liquid nitrogen being put into the mortar with Liquid nitrogen precooler, appropriate liquid nitrogen is added, guarantees to grind
Liquid nitrogen in alms bowl is not done, and sample is ground into powder, then according to the experiment of QIAGEN RNeasy Plant Mini Kit
Step carries out RNA extraction.Sample after extraction runs 1% Ago-Gel detection, it is desirable that without protein contamination, i.e. agarose gel
Glue hole is without obvious bright band.Nucleic acid concentration detection, logarithmic phase sample concentration are carried out with NanoDrop Spectrophotometer
421ng/ul, stationary phase sample concentration 237ng/ul reach sample presentation and want without obvious protein contamination, nucleic acid concentration > 60ng/ul sequencing
It asks.
2, transcript profile is sequenced: extracting RNA sample and Beijing source Nuo Hezhi biological information Science and Technology Ltd. is entrusted to be sequenced.
It is as follows that process is sequenced: after sample detection is qualified, rRNA being removed by Ribo-zero kit to be enriched with mRNA.Then it is added
MRNA is broken into short-movie section by fragmentation buffer, using mRNA as template, with hexabasic base random primer (random
Hexamers a chain cDNA) is synthesized, buffer, dNTPs (dTTP in dNTP is replaced with dUTP) and DNA is then added
Polymerase I and RNase H synthesize two chain cDNA, then purify double-strand cDNA with AMPure XP beads, use USER later
CDNA second chain of the enzyme degradation containing U.The double-strand cDNA of purifying first carries out end reparation plus A tail and connects sequence measuring joints, then uses
AMPure XP beads carries out clip size selection.It finally carries out PCR amplification, and purifies PCR with AMPure XP beads and produce
Object obtains final library.After the completion of library construction, tentatively quantitative, dilution library to 1ng/ul is first carried out using Qubit2.0,
Then the Insert Fragment length (insert size) in library is detected using Agilent 2100, insert size meets
After it is expected that, accurate quantitative analysis (library effective concentration > 2nM) is carried out using effective concentration of the Q-PCR method to library, to guarantee text
Library quality.After library inspection is qualified, being carried out after demand pooling of the different libraries according to machine data volume under effective concentration and target
HiSeq/MiSeq sequencing.
3, analysis of biological information process: sequencing result entrusts Beijing source Nuo Hezhi biological information Science and Technology Ltd. to carry out letter
Breath analysis.After obtaining primitive sequencer sequence (Sequenced Reads), there are relative species reference sequences or referring to genome
In the case of, carry out analysis of biological information.Analysis of biological information main flow is as follows:
Original sequence data → sequencing data quality evaluation → reference sequences comparison analysis → gene expression dose analysis →
RNA-seq total quality assessment → analysis of gene differential expression → differential gene GO enrichment analysis, differential gene KEGG enrichment point
Analysis.
The analysis of biological information of sample of the present invention is Corynebacterium glutamicum ATCC 13032 (multiple auspicious purchased from Shanghai with reference to species
Biotechnology Co., Ltd), https is linked as on ncbi with reference to genome: //www.ncbi.nlm.nih.gov/
nuccore/NC_006958.1.According to the information analysis tables of data finally provided, to each gene in logarithmic phase and stationary phase
Gene expression abundance analysis, screening obtain 10 genes and transcription analysis information of table one, the consistent feature of this 10 genes are as follows: logarithm
Delayed early transcription level is low, and stationary phase transcriptional level is high, by predicting operon, gene C GTRNA_RS10085, CGTRNA_
RS10080 belongs to the same operon, and CGTRNA_RS07920, CGTRNA_RS07925, CGTRNA_RS07930 belong to same
A operon, CGTRNA_RS00965, CGTRNA_RS00970 belong to the same operon, and the same operon shares one and opens
Mover.
Table one: the low gene of the high L phase abundance of Corynebacterium glutamicum transcriptome analysis S delayed early transcription abundance
| Gene Name | Strand | start | end | length | S1_fpkm | L1_fpkm |
| CGTRNA_RS10085 | - | 2142201 | 2143517 | 1317 | 27347.52 | 148.9929 |
| CGTRNA_RS10080 | - | 2141798 | 2142136 | 339 | 24497.2 | 543.2887 |
| CGTRNA_RS10840 | + | 2320501 | 2321934 | 1434 | 13058.69 | 838.0642 |
| CGTRNA_RS07910 | - | 1672737 | 1673144 | 408 | 7453.836 | 37.12523 |
| CGTRNA_RS07920 | - | 1674757 | 1675572 | 816 | 3383.739 | 15.18759 |
| CGTRNA_RS07925 | - | 1675587 | 1676735 | 1149 | 2442.069 | 7.789865 |
| CGTRNA_RS07930 | - | 1676732 | 1678090 | 1359 | 5493.98 | 22.03821 |
| CGTRNA_RS00965 | + | 195241 | 199773 | 4533 | 6137.992 | 54.29964 |
| CGTRNA_RS00970 | + | 199773 | 201293 | 1521 | 4023.859 | 33.94991 |
| CGTRNA_RS04670 | + | 988209 | 989480 | 1272 | 2037.631 | 8.931068 |
4, promoter region screens: by NCBI blast function, will predict the genetic fragment come and laboratory is sequenced
C. glutamicum gene group out is compared, and finds corresponding gene order.Pass through consulting literatures or application starting
Sub- forecasting software predicts that the promoter region of each gene, the promoter region of each gene select 2-3 according to the functional areas of prediction
A segment carries out promoter function analysis.
(1) the promoter region segment of gene C GTRNA_RS10085:
RS10085seq1:
CTATTGAAATTAGTTTCTGTAGGTCTATAGTTAGAGCTGGTTCAAGGGGTGTCAATCCCAAAAGGCACT
CCTTGAACTCATGAAAAAGCTTGACAAAACTTCAACGTCAAAGGAGGTCATCCACGCT
RS10085seq2:
CTATTCTATAGATCTATTGAAATTAGTTTCTGTAGGTCTATAGTTAGAGCTGGTTCAAGGGGTGTCAAT
CCCAAAAGGCACTCCTTGAACTCATGAAAAAGCTTGACAAAACTTCAACGTCAAAGGAGGTCATCCACGCT
RS10085seq3:
ACTTAACAATTCATTAAATTACCTGTTAAACTATAGAAAATATCCAAAACCCTCCAAAACCTATTCTAT
AGATCTATTGAAATTAGTTTCTGTAGGTCTATAGTTAGAGCTGGTTCAAGGGGTGTCAATCCCAAAAGGCACTCCTT
GAACTCATGAAAAAGCTTGACAAAACTTCAACGTCAAAGGAGGTCATCCACGCT
(2) the promoter region segment of gene C GTRNA_RS10840
RS10840seq1:
TCAAAGGTCAGCAATTGTGAACAAAGCTACAAATAAACCGTTCCACCCATGTCAATGAGGAGTCACC
RS10840seq2:
GCAGTCAAAAGGCGTTGCTTTTCGACGTCGCAAAGCGCAATTTCCTACCTTTAAGATCCTAATCTGTTG
AGGTCAGCCACAATTTTTCAGAAAAGTTTTGATAGATCGACAGGTAATGCTTTATACTGACAACGTCGCAAGGACTA
CATTTGCAGCCAAGTCTACTACTTGATCTTCAAAGGTCAGCAATTGTGAACAAAGCTACAAATAAACCGTTCCACCC
ATGTCAATGAGGAGTCACC
(3) the promoter region segment of gene C GTRNA_RS07910
RS07910seq1:
ACTTGGTTCCTGCCCAACAACCCAGTGGACTTCCAGCCGGAAAATCTGCCATGCTTCATCCGTGACCGT
G
RS07910seq2:
GCGATCACGTAGTCATCCAAGCAGGCGAAGAAACCACAATCGTGGACCGCGTTATCGTCACCACCGGCA
GCTGGACAAGCGAGCTCGTGCCCTCCATCGCGCCACTGCTTGAAGTGCGACGCCTAGTGCTCACTTGGTTCCTGCCC
AACAACCCAGTGGACTTCCAGCCGGAAAATCTGCCATGCTTCATCCGTGACCGTG
(4) the promoter region segment of gene C GTRNA_RS07930
RS07930seq1:
CGGAATAGAAAATACTCCGCTCGACAGCATCACTTAGCTGAAAGGCCTTTAAC
RS07930seq2:
GAAACTGGACTAGGTTTATCTATAGCGGAATAGAAAATACTCCGCTCGACAGCATCACTTAGCTGAAAG
GCCTTTAAC
RS07930seq3:
GCAGGTTAAAACGCTGCCATAGGGGATTTTTCGGCTGGGGAGACGTGGTGTAAGTGCGGGTTAAAAACG
TGACCTTCGTTATAAAAACAGAAATCTATAGAACGATAGGTAGAAACTGGACTAGGTTTATCTATAGCGGAATAGAA
AATACTCCGCTCGACAGCATCACTTAGCTGAAAGGCCTTTAAC
(5) the promoter region segment of gene C GTRNA_RS00965
RS00965seq1:
CTTGCGTTGCAGGTAGTGCGCCTGATTTTCTTATTATCGAACGATTGATAGAAACAG
GATTAAAGTGAGGTATCCCGC
RS00965seq2:
TTTTATCTTCTTTCACGGGGTGGATAGGCGAACATCTTCTACCATATCCTGTGATGTGTAACACAGGAG
CGTAATCTGACCTCCCGTTTTCCTATAGATTGATCGAAAGTAACCCTTTTGTTACTTGCGTTGCAGGTAGTGCGCCT
GATTTTCTTATTATCGAACGATTGATAGAAACAGGATTAAAGTGAGGTATCCCGC
(6) the promoter region segment of gene C GTRNA_RS04670
RS04670seq1:
AGGCTGACAGAAACTCTAAAAACTATAGAGCTATAGAAACCTTAACTTCGGAGGTATCC
RS04670seq2:
GTGGGCGCTGGGCCATAGTCGCCCCAGCTCAGCGAAGTTGTACGCCGGCGTTGCCTGCTTGTCGACGTT
TTTTGCCACTTCCCTTAATTCGGGGGTGGCTGAAATGTAAGACACGTCACTACATTTAAGCTCAAAAACAACTACCT
ATAGGCTGACAGAAACTCTAAAAACTATAGAGCTATAGAAACCTTAACTTCGGAGGTATCC
5, promoter style building and fluorescence detection:
(1) primer synthesizes: being designed by snapgene software to primer, commission one brightness of Wuhan Tian far carries out primer conjunction
At.Each synthetic primer sequence see the table below two.
Table two: each primer sequence of carrier detection is constructed
(2) genome extracts: one ring Corynebacterium glutamicum H5 of picking is inoculated in LB culture medium, 31 DEG C of overnight incubations, from
The heart removes supernatant, and the extraction of phage gene group is extracted using the step of Tiangeng genome extraction kit, the genome after extraction
Nucleic acid concentration detection is carried out using NanoDrop Spectrophotometer, the nucleic acid concentration that control carries out PCR amplification exists
Between 100-200ng/ul.
(3) PCR amplification: being diluted with water final concentration 10uM for each synthetic primer, use TransStart FastPfu
Fly DNA Polymerase is expanded, PCR system are as follows: genomic templates 1ul, forward primer (10uM) 1ul, reverse primer
(10uM) 1ul, 5*TransStart FastPfu FlyBuffer 10ul, 2.5mM Dntps 4ul, TransStart
FastPfu Fly DNA Polymerase 1ul, ddH2O 32ul.PCR amplification process be 95 DEG C of 2min, 95 DEG C of 20s, 55 DEG C
20s, 72 DEG C of 10s-1min, 72 DEG C of 5min, recurring number are 32, and obtaining amplification of DNA fragments is respectively with recombination connector
RS10085seq1、RS10085seq2、RS10085seq3、RS10840seq1、RS10840seq2、RS07910seq1、
RS07910seq2、RS07930seq1、RS07930seq2、RS07930seq3、RS00965seq1、RS00965seq2、
RS04670seq1、RS04670seq2、EGFP。
(4) plasmid enzyme restriction is synthesized with DNA: the use of original plasmid is PXMJ19, with NEB restriction enzyme NarI with
HindIII carries out double digestion, removes original lacIq and promoter Ptac, and digestion system is 50ul system: plasmid 5-10ul,
NarI1ul, HindIII 1ul, cutsmart 5ul, ddH2O 33-38ul.
Entrust the remote synthetic DNA sequence of one brightness of Wuhan Tian: hy-dna1
gcatccggggctgatccccggcgcctaactaactaactcgagcttaagaggcctaagcttgcatgcct
gcaggtcgact
(5) DNA agarose electrophoresis recycles: 10*loading buffer, point sample is added in PCR product and digestion products
50ul is control, the electrophoresis 40min under 70V voltage with takara 2000DL DNA marker in 1.5% Ago-Gel.
PCR amplification band is recycled according to marker band.Recycling is recycled using takara DNA QIAquick Gel Extraction Kit, DNA fragmentation point
Not Wei with the recombination RS10085seq1 (167bp) of connector, RS10085seq2 (180bp), RS10085seq3 (240bp),
RS10840seq1(107bp)、RS10840seq2(282bp)、RS07910seq1(110bp)、RS07910seq2(241bp)、
RS07930seq1(93bp)、RS07930seq2(118bp)、RS07930seq3(229bp)、RS00965seq1(118bp)、
RS00965seq2(241bp)、RS04670seq1(99bp)、RS04670seq2(247bp)、EGFP(760bp)。
(6) vitro recombination: using Vazyme one Step Cloning Kit kit by digestion products and synthesis
DNA fragmentation hydna1 carries out vitro recombination, and recombinant products directly convert Escherichia coli.
(7) prepared by E. coli competent: E. coli competent DH5 α preparation uses green skies bacterial super competence
Kit carries out competence preparation, and it is spare to be stored in -80 DEG C of refrigerators for competence after preparation.
(8) it converts: slowly melting competent cell DH5 α on ice, vitro recombination product is added in competent cell,
Finger springing centrifuge tube is gently used, to mix bacterium and recombinant products, ice bath or ice-water bath are placed 30 minutes, 42 DEG C of water-baths, heat
Shock 2 minutes.It is immediately placed in ice-water bath after heat shock, 2 minutes.900 microlitres of LB are added, 37 DEG C of 200rpm are cultivated 1 hour.From
The heart removes supernatant, and thallus is coated in the LB solid plate of the 25ug/ml containing chloramphenicol, 37 DEG C of overnight incubations.
(9) transformant verifying is extracted with plasmid: the transformant that will be grown in resistant panel after conversion send Wuhan Tian one
Brightness far carries out sequencing analysis, the chloramphenicol of addition final concentration 25ug/ml in the correct transformant switching 5ml LB test tube of sequence, and 37
DEG C shaking table, 200rpm overnight incubation carry out plasmid extraction using takara plasmid kit kit, keep the plasmid extracted dense
For degree between 200-400ng/ul, the plasmid of building is named as HY-P19, and sequence is SEQ ID NO:2.
HY-P19 is used into NEB restriction enzyme XbaI and EcoRI, double digestion 1h, enzyme are carried out in 37 DEG C of water-baths
Cutting plasmid amount is 1ug, and digestion system is 50ul system: plasmid 5-10ul, XbaI 1ul, EcoRI1ul, cutsmart 5ul,
ddH2O 33-38ul.The digestion products for recycling HY-P19, using Vazyme one Step Cloning Kit kit by enzyme
It cuts product and each promoter fragment and EGFP segment carries out vitro recombination, other experimental procedures are same as above (7)-(9).
The piece segment DNA seq:720bp of green fluorescent protein EGFP
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGT
AAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATC
TGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCC
GCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCAT
CTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATC
GAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACA
ACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGC
AGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTA
CCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCG
CCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA
Construct a series of plasmid HY-P19-promoter-EGFP (flow chart of carrier detections containing different promoters
See attached drawing 1), the carrier detection containing each promoter fragment be respectively designated as PRS10085seq1, PRS10085seq2,
PRS10085seq3、PRS10840seq1、PRS10840seq2、PRS07910seq1、PRS07910seq2、
PRS07930seq1、PRS07930seq2、PRS07930seq3、PRS00965seq1、PRS00965seq2、
PRS04670seq1、PRS04670seq2。
(10) corynebacterium glutamicum electricity turns the preparation of competent cell:
1. being linked into from fresh LB (about culture 12h) one single colonie of washer picking equipped with 5mL LBG liquid
Test tube in, 30 DEG C, 220rpm overnight shaking culture.
2. 2mL bacterial culture fluid is taken to be linked into equipped with 100mL EPO (yeast powder 5g/L, peptone 10g/L, Nacl10g/
L, glycine 25g/L, tween 1g/L) culture medium 1L triangular flask in, 30 DEG C of shaken cultivations to OD between 1.0-1.5 (about
4-5h)。
3. culture solution is transferred completely into the 50mL centrifuge tube of 4 DEG C of pre-coolings under aseptic condition, place 2 minutes on ice.
4. 4 DEG C, 7000rpm refrigerated centrifuge 20 minutes.After removing supernatant, centrifuge tube is inverted above sterile filter paper
Absorb remaining Epo culture medium.
5. 10% glycerite being pre-chilled with 4 DEG C of 40mL is resuspended thallus and gently shakes up, 7000rpm refrigerated centrifuge 10 divides
Clock.Remove supernatant.
6. repeating step 52 times.
7. pipettor draws 10% glycerite of 1mL pre-cooling, it is added in centrifuge tube and gently thallus is resuspended in piping and druming.
8. finally the competent cell sterile EP tube of 1.5mL is dispensed, every pipe 0.1mL.It is put into -80 in ultra low temperature freezer
DEG C save.
(11) electrotransformation of Corynebacterium glutamicum:
1. taking out the Corynebacterium glutamicum competent cell of -80 DEG C of preservations, it is inserted on ice until melting.
2. sample Plasmid DNA is added into the competent cell of thawing, EP pipe is flicked with finger, it is ensured that DNA and competence
Mixing with cells is uniform.
3. the competent cell containing DNA plasmid is drawn into the electric shock cup (aperture 2mm) of pre-cooling with pipettor, with defending
Raw paper is dried rapidly.
4. electric shock cup is placed into electroporation, 5 milliseconds of 1800V electroporation.
5. being rapidly drawn into cell liquid in the EP pipe equipped with 5mL LBHIS of 46 DEG C of preheatings, exact timing thermal shock 6 divides
Clock.
6. EP pipe is in 30 DEG C, 200rpm shaken cultivation, and cell recovery 60 minutes.
7. 7000rpm room temperature is centrifuged 2 minutes, most of supernatant is discarded, thallus is resuspended with remaining culture medium, uses glass bar
It is coated on the LBHIS solid medium of addition 10ug/mL chloramphenicol.
8. being placed at room temperature for 1 hour or so after surface liquid is fully absorbed, it is inverted plate and is trained in 30 DEG C of constant incubators
36h is supported, longer transformant is the bacterial strain containing each carrier detection.
(12) paddy stick transformant fluorescence detection
By the paddy stick transformant containing different promoters segment, in 5ml LBG Tube propagation base of transferring, 30 DEG C of cultures are extremely
OD600 is respectively 2.0 (logarithmic phases), 3.2 (stationary phases).It takes out thallus to be washed twice after supernatant is removed in centrifugation with PBS solution, use
The PBS of same volume is resuspended, the thallus after resuspension, is drawn 200ul and is added in 96 orifice plate of black matrix, uses multi-function microplate reader
TECANM1000 carries out fluorescent value detection.Each detection plasmid logarithmic phase and stationary phase detection fluorescent value in host strain are shown in Table three.
From table we it can be concluded that；The same gene promoter chooses different promoter fragments and carries out fluorescent value detection, obtains not
Same promoter vigor data, this is related with the regulation of gene promoter region, it would be desirable to which screening is logarithmic phase fluorescence
It is worth promoter fragment low, that stationary phase fluorescent value is high.Promoter fragment RS10085seq2, RS10085seq3,
The expression of RS10840seq2, RS07910seq2, RS07930seq3, RS00965seq2, RS04670seq2 in carrier detection
In, show the screening feature needed for us.
Table three: each detection plasmid two period fluorescence detection situations and plasmid in host strain pass on statistical form
Note: mitotic stability refers to that plasmid has 90% or more thallus to contain plasmid, passes on 50 times, refers to biography 50 times, and plasmid is also steady
Fixed 90% or more.
6, the plasmid mitotic stability of each promoter style
The recombinant bacterium of each promoter style will be contained, accessed in LBG culture medium, under conditions of non-resistant pressure,
30 DEG C of rotary shakers, 190rpm culture are a generation for 24 hours；The inoculum concentration of passage is 5%, is carried out continuously secondary culture, is often commissioned to train feeding
Bacterium be diluted painting plate, dilute identical concentration and be respectively coated in the plate containing chloramphenicol and without chloramphenicol, matter
Grain Loss Rate=(plate thallus number of the plate thallus number-without chloramphenicol containing the chloramphenicol)/plate without chloramphenicol
Thallus number × 100%, plasmid loss rate≤10%, we define and pass on plasmid stabilisation thus, when plasmid loss rate > 10% item
Think that this generation plasmid is unstable.The passage algebra of stablizing of thallus containing each detection plasmid is shown in Table three.
From table three we it can be concluded that plasmid PRS10085seq2, PRS10085seq3, PRS10840seq2,
PRS07910seq2, PRS07930seq3, PRS00965seq2, PRS04670seq2 were passed to for 50 generations, plasmid loss rate≤10%,
Show good stability.
The expression vector of the application promoter fragment RS07910seq2 building of embodiment 2 and its application
During bacterial metabolism, the superpower expression of not all gene can increase metabolism and flow to purpose product, have
The biological enzyme generated after many gene expressions, when needing to reach an equalization point moderately expressed in metabolism, can send out instead
The effect of waving.Studies have shown that extensive regulatory protein Lrp (its coding nucleotide sequence such as SEQ ID NO:3 in Corynebacterium glutamicum
It is shown) synthesis of corynebacterium glutamicum l-Isoleucine can be improved and transport the transcriptional level of related gene, moreover it is possible to it improves certainly
Body encoding gene lrp transcriptional level, but the overexpression of Lrp generates inhibiting effect to the growth of corynebacterium glutamicum, we
Use promoter fragment PRS07910seq2 as promoter, using lrp as purpose gene, constructs heterogenous expression plasmid HY-P19-
RS07910seq2-lrp, and by expression plasmid electrotransformation to isoleucine production bacterium H5 body, new bacterial strain is constructed, and carry out
The acid producing ability of 5L fermentation examination bacterial strain.
1, the building of expression vector HY-P19-RS07910seq2-lrp
Use the promoter fragment RS07910seq2 screened as promoter, lrp is purpose gene, building expression
Carrier HY-P19-RS07910seq2-lrp.
DNA fragmentation amplification: being template, upstream and downstream primer using plasmid PRS07910seq2 are as follows:
RS07910seq2Fp:tgcctgcaggtcgactctaga GCGATCACGTAGTCATCCAAG
RS07910seq2Rp:CACGGTCACGGATGAAGCAT
Amplification of DNA fragments RS07910seq2 is carried out using TransStart FastPfu Fly DNA Polymerase
Amplification, PCR system are as follows: P RS07910seq2 template 1ul, forward primer (10uM) 1ul, reverse primer (10uM) 1ul, 5*
TransStart FastPfu FlyBuffer 10ul, 2.5mM Dntps 4ul, TransStart FastPfu Fly DNA
Polymerase 1ul, ddH2O 32ul.PCR amplification process is 95 DEG C of 2min, 95 DEG C of 20s, 55 DEG C of 20s, 72 DEG C of 10smin, 72
DEG C 5min, recurring number are 32.Using H5 genome as template, upstream and downstream primer are as follows:
LrpFP:GCTTCATCCGTGACCGTGAtgaagctagattccattgatt
LrpRP:caaaacagccaagctgaattctcacacctgggggcgagc
Amplification of DNA fragments lrp is expanded, PCR using TransStart FastPfu Fly DNA Polymerase
System are as follows: genomic templates 1ul, forward primer (10uM) 1ul, reverse primer (10uM) 1ul, 5*TransStart FastPfu
FlyBuffer 10ul, 2.5mM Dntps 4ul, TransStart FastPfu Fly DNA Polymerase 1ul,
ddH2O 32ul.PCR amplification process is 95 DEG C of 2min, 95 DEG C of 20s, 56 DEG C of 20s, 72 DEG C of 20s, 72 DEG C of 5min, recurring number 32
It is a.
Plasmid enzyme restriction: the plasmid used is that PXMJ19 removes the original improved HY-P19 of lacIq and promoter.It will
HY-P19 uses NEB restriction enzyme XbaI and EcoRI, and double digestion 1h is carried out in 37 DEG C of water-baths, and digested plasmid amount is
1ug, digestion system are 50ul system: plasmid 5ul, XbaI 1ul, EcoRI1ul, cutsmart 5ul, ddH2O 38ul。
The recycling of DNA agarose electrophoresis: being added 10*loading buffer for PCR product and digestion products, point sample 50ul in
1.5% Ago-Gel is control, the electrophoresis 40min under 70V voltage with takara 2000DL DNA marker.According to
Marker band recycles PCR amplification 246bp, 492bp band.Recycling is recycled using takara DNA QIAquick Gel Extraction Kit.
Vitro recombination: vitro recombination is carried out using Vazyme one Step Cloning Kit kit, recombinant products are straight
Switching through Escherichia coli.
E. coli competent preparation: it is constructed with promoter style.
Conversion: slowly melting competent bacteria on ice, and 100ul competent cell is added in 10ul vitro recombination product
It is interior, finger springing centrifuge tube is used, gently to mix bacterium and recombinant products.Ice bath or ice-water bath are placed 30 minutes.42 DEG C of water-baths,
Heat shock 2 minutes.It is immediately placed in ice-water bath after heat shock, 2 minutes.900 microlitres of LB are added, 37 DEG C of 200rpm are cultivated 1 hour.
Supernatant is removed in centrifugation, thallus is coated in the LB solid plate of the 25ug/ml containing chloramphenicol, 37 DEG C of overnight incubations.
Transformant verifying is extracted with plasmid: the transformant that will be grown in resistant panel after conversion send Wuhan Tian one brightness
It is remote to carry out sequencing analysis, the chloramphenicol of final concentration 25ug/ml is added in the correct transformant switching 5ml LB test tube of picking sequence,
37 DEG C of shaking tables, 200rpm overnight incubation carry out plasmid extraction, expression plasmid HY- using takara plasmid kit kit
P19-RS07910seq2-lrp concentration is 321ng/ul.
2, the building of the bacterial strain of the HY-P19-RS07910seq2-lrp containing expression vector
Corynebacterium glutamicum electricity turns the preparation of competent cell: constructing with promoter style.
Expression plasmid HY-P19-RS07910seq2-lrp electrotransformation host cell Corynebacterium glutamicum: it is detected with promoter
Vector construction.
Bacterium solution centrifugal concentrating after electricity is turned is coated on the LBHIS solid culture of addition 10ug/mL chloramphenicol with glass bar
On base, 36h is cultivated in 30 DEG C of incubators, longer transformant is the bacterium with plasmid HY-P19-RS07910seq2-lrp
Strain, Strain Designation H5-RS07910seq2-lrp.
3, bacterial strain H5-RS07910seq2-lrp and H5 produces acid in 5L ferment tank
5L ferment tank culture medium: corn pulp 15ml/L, glucose 140g/L (divide and disappears, 0.075MPa moist heat sterilization
15min), ammonium sulfate 5g/L, potassium dihydrogen phosphate 0.4g/L, epsom salt 0.6g/L, biotin 0.1mg/L, VB1 0.1mg/
L, corn oil 1ml/L, Angel Yeast powder 1g/L, defoaming agent 1ml/L, 121 DEG C of 0.01MPa moist heat sterilization 25min；It is added after sterilizing
Just sugar is 7.0 with ammonium hydroxide tune pH.
Cultural method: strain is accessed into seed culture medium (seed culture based formulas: glucose 17g/L, corn pulp 10ml/
L, urea 1g/L, magnesium sulfate 0.5g/L, dipotassium hydrogen phosphate 1g/L, yeast extract 0.1g/L, biotin 0.1mg/L, vitamin
B10.1mg/L, corn oil 0.1g/100ml, calcium carbonate 1g/100ml；With NaOH tune pH7.0), 31 DEG C of rotary shakers, 200rpm,
After cultivating 16h, the 5L containing fermentation medium is accessed with 10% inoculum concentration and is automatically controlled in fermentor, appropriate air is passed through, is adjusted
Appropriate speed of agitator is saved, different oxygen supply scheme control dissolved oxygen: 0-8h 30-, 8-24h 25%, 24-56h 12% is used,
PH is controlled 7.0 by the ammonium hydroxide of auto-feeding 15%, is defoamed by stream plus appropriate GPE, and is 800g/L by stream plus concentration
Glucose solution residual sugar is controlled 3% or so, fermentation 56h terminates.
When putting tank, fermentation liquid detects that (Yi Lite C18 chromatographic column, 5 μm, 4.6*250mm, mobile phase is by HPLC
The diammonium hydrogen phosphate of 0.015mol/L and the mixed aqueous solution of 0.005mol/L pH7.20.Flow velocity is 0.5ml/min.Column temperature is
23℃.Detector is UV detector, wavelength 199nm) compare bacterium H5 fermentation and acid 22.0g/L, heteroacid content 6.3g/L, saccharic acid
Conversion ratio 12.83%, engineering bacteria H5-RS07910seq2-lrp, fermentation and acid 39.1g/L, heteroacid content 6.9g/L, saccharic acid turn
Rate is up to 17.88%.
4, bacterial strain H5-RS07910seq2-lrp 5L ferment tank plasmid stability
56h is put into tank bacterium and is diluted painting plate, dilution 10-6、10-7、10-8、10-9Gradient concentration, each concentration gradient
50ul bacterium solution is drawn respectively, is coated in the plate containing chloramphenicol and without chloramphenicol, is placed in 31 DEG C of incubators and cultivates
36h calculates plasmid loss rate, plasmid loss rate=(be free of chlorine according to the clump count grown in non-resistant plate and resistant panel
Plate thallus number of the plate thallus number-of mycin containing chloramphenicol)/plate thallus number × 100% without chloramphenicol.?
10-8On the plate of dilution gradient, plate containing chloramphenicol grows 127 bacterium colonies, and no chloramphenicol plate grows 135 bacterium colonies, plasmid
Loss Rate is only 5.93%, and plasmid is stablized in fermentation.
Sequence table
<110>Wuhan Grand Hoyo Co., Ltd.
<120>a kind of corynebacteria constitutive expression carrier promoter, the expression vector containing the promoter and lrp gene
<160> 3
<210> 1
<211> 201
<212> DNA
<213>RS07910seq2 promoter
<400> 1
GCGATCACGTAGTCATCCAAGCAGGCGAAGAAACCACAATCGTGGACCGCGTTATCGTCACCACCGGCA
GCTGGACAAGCGAGCTCGTGCCCTCCATCGCGCCACTGCTTGAAGTGCGACGCCTAGTGCTCACTTGGTTCCTGCCC
AACAACCCAGTGGACTTCCAGCCGGAAAATCTGCCATGCTTCATCCGTGACCGTG
<210> 2
<211> 5257
<212> DNA
<213>plasmid HY-P19
<400> 2
ggcgcctaactaactaactcgagcttaagaggcctaagcttgcatgcctgcaggtcgactctagagga
tccccgggtaccgagctcgaattcagcttggctgttttggcggatgagagaagattttcagcctgatacagattaa
atcagaacgcagaagcggtctgataaaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatg
ccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccagg
catcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcc
tgagtaggacaaatccgccgggagcggatttgaacgttgcgaagcaacggcccggagggtggcgggcaggacgccc
gccataaactgccaggcatcaaattaagcagaaggccatcctgacggatggcctttttgcgtttctacaaactctt
ttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatat
tgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctg
tttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcga
actggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttgct
tcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatac
ggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaa
aaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcag
aggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttc
cgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctg
taggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgc
tgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactg
gtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacac
tagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatcc
ggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctc
aagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcat
gagattatcaaaaaggatcttcacctagatccttttggggtgggcgaagaactccagcatgagatccccgcgctgg
aggatcatccagccattcggggtcgttcactggttcccctttctgatttctggcatagaagaacccccgtgaactg
tgtggttccgggggttgctgatttttgcgagacttctcgcgcaattccctagcttaggtgaaaacaccatgaaaca
ctagggaaacacccatgaaacacccattagggcagtagggcggcttcttcgtctagggcttgcatttgggcggtga
tctggtctttagcgtgtgaaagtgtgtcgtaggtggcgtgctcaatgcactcgaacgtcacgtcatttaccgggtc
acggtgggcaaagagaactagtgggttagacattgttttcctcgttgtcggtggtggtgagcttttctagccgctc
ggtaaacgcggcgatcatgaactcttggaggttttcaccgttctgcatgcctgcgcgcttcatgtcctcacgtagt
gccaaaggaacgcgtgcggtgaccacgacgggcttagcctttgcctgcgcttctagtgcttcgatggtggcttgtg
cctgcgcttgctgcgcctgtagtgcctgttgagcttcttgtagttgctgttctagctgtgccttggttgccatgct
ttaagactctagtagctttcctgcgatatgtcatgcgcatgcgtagcaaacattgtcctgcaactcattcattatg
tgcagtgctcctgttactagtcgtacatactcatatttacctagtctgcatgcagtgcatgcacatgcagtcatgt
cgtgctaatgtgtaaaacatgtacatgcagattgctgggggtgcagggggcggagccaccctgtccatgcggggtg
tggggcttgccccgccggtacagacagtgagcaccggggcacctagtcgcggataccccccctaggtatcggacac
gtaaccctcccatgtcgatgcaaatctttaacattgagtacgggtaagctggcacgcatagccaagctaggcggcc
accaaacaccactaaaaattaatagtccctagacaagacaaacccccgtgcgagctaccaactcatatgcacgggg
gccacataacccgaaggggtttcaattgacaaccatagcactagctaagacaacgggcacaacacccgcacaaact
cgcactgcgcaaccccgcacaacatcgggtctaggtaacactgagtaacactgaaatagaagtgaacacctctaag
gaaccgcaggtcaatgagggttctaaggtcactcgcgctagggcgtggcgtaggcaaaacgtcatgtacaagatca
ccaatagtaaggctctggcggggtgccataggtggcgcagggacgaagctgttgcggtgtcctggtcgtctaacgg
tgcttcgcagtttgagggtctgcaaaactctcactctcgctgggggtcacctctggctgaattggaagtcatgggc
gaacgccgcattgagctggctattgctactaagaatcacttggcggcgggtggcgcgctcatgatgtttgtgggca
ctgttcgacacaaccgctcacagtcatttgcgcaggttgaagcgggtattaagactgcgtactcttcgatggtgaa
aacatctcagtggaagaaagaacgtgcacggtacggggtggagcacacctatagtgactatgaggtcacagactct
tgggcgaacggttggcacttgcaccgcaacatgctgttgttcttggatcgtccactgtctgacgatgaactcaagg
cgtttgaggattccatgttttcccgctggtctgctggtgtggttaaggccggtatggacgcgccactgcgtgagca
cggggtcaaacttgatcaggtgtctacctggggtggagacgctgcgaaaatggcaacctacctcgctaagggcatg
tctcaggaactgactggctccgctactaaaaccgcgtctaaggggtcgtacacgccgtttcagatgttggatatgt
tggccgatcaaagcgacgccggcgaggatatggacgctgttttggtggctcggtggcgtgagtatgaggttggttc
taaaaacctgcgttcgtcctggtcacgtggggctaagcgtgctttgggcattgattacatagacgctgatgtacgt
cgtgaaatggaagaagaactgtacaagctcgccggtctggaagcaccggaacgggtcgaatcaacccgcgttgctg
ttgctttggtgaagcccgatgattggaaactgattcagtctgatttcgcggttaggcagtacgttctcgattgcgt
ggataaggctaaggacgtggccgctgcgcaacgtgtcgctaatgaggtgctggcaagtctgggtgtggattccacc
ccgtgcatgatcgttatggatgatgtggacttggacgcggttctgcctactcatggggacgctactaagcgtgatc
tgaatgcggcggtgttcgcgggtaatgagcagactattcttcgcacccactaaaagcggcataaaccccgttcgat
attttgtgcgatgaatttatggtcaatgtcgcgggggcaaactatgatgggtcttgttgttggcgtcccggaaaac
gattccgaagcccaacctttcatagaaggcggcggtggaatcgaaatctcgtgatggcaggttgggcgtcgcttgg
tcggtcatttcgaagggcaccaataactgccttaaaaaaattacgccccgccctgccactcatcgcagtactgttg
taattcattaagcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcggcatcagc
accttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgttta
aatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaata
ggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattca
ctccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcacca
gctcaccgtctttcattgccatacggaactccggatgagcattcatcaggcgggcaagaatgtgaataaaggccgg
ataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggta
cattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccag
tgatttttttctccattttagcttccttagctcctgaaaatctcgtcgaagctcggcggatttgtcctactcaagc
tgatccgacaaaatccacacattatcccaggtgtccggatcggtcaaatacgctgccagctcatagaccgtatcca
aagcatccggggctgatcccc
<210> 3
<211> 456
<212> DNA
<213>target gene Lrp
<400> 3
ATGAAGCTAGATTCCATTGATTGCGCAATTATTGCGGAGCTTAGCGCGAATGCGCGCATCTCAAATCTC
GCACTGGCTGACAAGGTGCATCTCACTCCGGGACCTTGCTTGAGGAGGGTGCAGCGTTTGGAAGCCGAAGGAATCAT
TTTGGGCTACAGCGCGGACATTCACCCTGCGGTGATGAATCGTGGATTTGAGGTGACCGTGGATGTCACTCTCAGCA
ACTTCGACCGCTCCACTGTAGACAATTTTGAAAGCTCCGTTGCGCAGCATGATGAAGTACTGGAGTTGCACAGGCTT
TTTGGTTCGCCAGATTATTTTGTTCGCATCGGCGTTGCTGATTTGGAGGCGTATGAGCAATTTTTATCCAGTCACAT
TCAAACCGTGCCAGGAATTGCAAAGATCTCATCACGTTTTGCTATGAAAGTGGTGAAACCAGCTCGCCCCCAGGTGT
GA
Claims (5)
1. a kind of corynebacteria constitutive expression carrier promoter based on transcript profile sequencing building, nucleotide sequence such as SEQ
Shown in ID NO:1.
2. a kind of corynebacteria constitutive expression carrier, it is characterised in that: contain promoter described in claim 1.
3. corynebacteria constitutive expression carrier as claimed in claim 2, it is characterised in that: it is the enzyme in plasmid HY-P19
Enzyme site is inserted into target gene and promoter described in claim 1 is built-up, the nucleotide sequence of the plasmid HY-P19
As shown in SEQ ID NO:2, the nucleotide sequence of the target gene is as shown in SEQ ID NO:3.
4. the recombinant bacterial strain that expression vector electrotransformation host cell corynebacterium glutamicum as claimed in claim 3 obtains.
5. application of the recombinant bacterial strain as claimed in claim 4 in production isoleucine.
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710169454.5A CN107164369B (en) | 2017-03-21 | 2017-03-21 | A kind of corynebacteria constitutive expression carrier promoter, the expression vector containing the promoter and lrp gene |
| PCT/CN2018/079034 WO2018171488A1 (en) | 2017-03-21 | 2018-03-14 | Corynebactetium constitutive expression vector promoter screened on the basis of transcriptome sequencing, screening method therefor, and applications thereof |
| EP18772338.2A EP3604530A4 (en) | 2017-03-21 | 2018-03-14 | Corynebactetium constitutive expression vector promoter screened on the basis of transcriptome sequencing, screening method therefor, and applications thereof |
| US16/496,496 US11639512B2 (en) | 2017-03-21 | 2018-03-14 | Corynebacterium constitutive expression vector promoter screened on the basis of transcriptome sequencing, screening method thereof, and applications thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710169454.5A CN107164369B (en) | 2017-03-21 | 2017-03-21 | A kind of corynebacteria constitutive expression carrier promoter, the expression vector containing the promoter and lrp gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107164369A CN107164369A (en) | 2017-09-15 |
| CN107164369B true CN107164369B (en) | 2019-09-20 |
Family
ID=59848804
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710169454.5A Active CN107164369B (en) | 2017-03-21 | 2017-03-21 | A kind of corynebacteria constitutive expression carrier promoter, the expression vector containing the promoter and lrp gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107164369B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3604530A4 (en) | 2017-03-21 | 2020-11-25 | Wuhan Grand Hoyo Co., Ltd. | Corynebactetium constitutive expression vector promoter screened on the basis of transcriptome sequencing, screening method therefor, and applications thereof |
| CN107805640B (en) * | 2017-10-13 | 2020-11-03 | 中国农业科学院植物保护研究所 | Method for improving yield of secondary metabolite of streptomycete |
| CN107828857A (en) * | 2017-11-23 | 2018-03-23 | 南宁科城汇信息科技有限公司 | A kind of transcript profile sequencing and RNAseq data analysing methods |
| CN109097361B (en) * | 2018-08-28 | 2020-02-14 | 江南大学 | Promoter, vector thereof and application thereof |
| CN109097362B (en) * | 2018-08-28 | 2022-05-20 | 江南大学 | Operon, vector thereof and application thereof |
| CN111378678B (en) * | 2018-12-29 | 2023-08-18 | 诚志生命科技有限公司 | Plasmid for strengthening hydroxyproline synthesis and construction and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101985631A (en) * | 2010-02-10 | 2011-03-16 | 江南大学 | Corynebacterium promoter detection vector and construction method and application thereof |
| CN103820486A (en) * | 2013-11-05 | 2014-05-28 | 南京工业大学 | Corynebacterium glutamicum promoter probe vector as well as construction method and application thereof |
| CN103834679A (en) * | 2014-02-20 | 2014-06-04 | 江南大学 | Corynebacteria expression system without depending on antibiotic being selection pressure |
| CN106434732A (en) * | 2016-07-29 | 2017-02-22 | 江南大学 | Expression vector applicable to corynebacterium glutamicum and application thereof |
-
2017
- 2017-03-21 CN CN201710169454.5A patent/CN107164369B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101985631A (en) * | 2010-02-10 | 2011-03-16 | 江南大学 | Corynebacterium promoter detection vector and construction method and application thereof |
| CN103820486A (en) * | 2013-11-05 | 2014-05-28 | 南京工业大学 | Corynebacterium glutamicum promoter probe vector as well as construction method and application thereof |
| CN103834679A (en) * | 2014-02-20 | 2014-06-04 | 江南大学 | Corynebacteria expression system without depending on antibiotic being selection pressure |
| CN106434732A (en) * | 2016-07-29 | 2017-02-22 | 江南大学 | Expression vector applicable to corynebacterium glutamicum and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 谷氨酸棒杆菌内源表达元件的筛选;刘秀霞等;《微生物学通报》;20161231;第43卷(第8期);1671−1678 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107164369A (en) | 2017-09-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107164369B (en) | A kind of corynebacteria constitutive expression carrier promoter, the expression vector containing the promoter and lrp gene | |
| JP2011062217A (en) | Increased lysine production by gene amplification | |
| WO2018171488A1 (en) | Corynebactetium constitutive expression vector promoter screened on the basis of transcriptome sequencing, screening method therefor, and applications thereof | |
| CN107338266A (en) | A kind of VIGS silencing systems for identifying mulberry tree MmPDS genes and its construction method and application | |
| CN108070594A (en) | Tobacco glandular hairs TTR1 promoters, its expression vector and its application | |
| Balasubramanian et al. | Droplet-based microfluidic high throughput screening of Corynebacterium glutamicum for efficient heterologous protein production and secretion | |
| CN103131716A (en) | Biosynthetic gene cluster of salinomycin and application thereof | |
| CN116478878A (en) | Bacillus subtilis for high-yield riboflavin and application thereof | |
| CN109678939A (en) | A kind of FnCpf1 mutant | |
| CN109486734A (en) | A kind of genetic engineering bacterium producing chondroitin and its construction method and application | |
| CN107164371B (en) | A kind of corynebacteria constitutive expression carrier promoter based on transcript profile sequencing building | |
| CN107164370B (en) | A kind of corynebacteria constitutive expression carrier promoter, the expression vector containing the promoter and gnd gene | |
| CN106480081A (en) | A kind of CRISPRi carrier of single pUC pUC and preparation method thereof | |
| CN109837301B (en) | Construction method of humanized helicobacter pylori cagA eukaryotic expression vector | |
| CN110511879A (en) | The building of saccharomyces cerevisiae engineered yeast and the preparation method of betulinic acid | |
| Su | Bioreactor engineering for recombinant protein production using plant cell suspension culture | |
| US6740526B1 (en) | Quantitative transient protein expression in plant tissue culture | |
| CN115976021A (en) | lncRNA MSTRG.5970.28, application thereof, product for regulating and controlling ovarian development and method | |
| CN114685629B (en) | Method for improving microbial conversion concentration of 5-hydroxytryptophan | |
| CN114672525A (en) | Biosynthesis method and application of N-acetyl-5-methoxytryptamine | |
| CN106520766A (en) | Seaweed endogenesis constructive promoter and application thereof | |
| CN109929871A (en) | A kind of mediation double-stranded RNA enters the intracorporal method of Chinese lac insect | |
| CN105087588B (en) | Plant embryos and aleurone specific promoter OsEmb3 and corresponding acquisition methods | |
| CN104726471A (en) | L-glutamate oxidase gene from streptomyces diastatochromogenes as well as preparation method and application thereof | |
| CN108085321A (en) | Gibberellin acceptor gene LsGID1 and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |