CN107144561A - A kind of method of quick screening arsenic ion aptamer and application - Google Patents

A kind of method of quick screening arsenic ion aptamer and application Download PDF

Info

Publication number
CN107144561A
CN107144561A CN201710337645.8A CN201710337645A CN107144561A CN 107144561 A CN107144561 A CN 107144561A CN 201710337645 A CN201710337645 A CN 201710337645A CN 107144561 A CN107144561 A CN 107144561A
Authority
CN
China
Prior art keywords
arsenic ion
concentration
solution
aptamers
aptamer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710337645.8A
Other languages
Chinese (zh)
Inventor
袁敏
徐斐
曹慧
叶泰
于劲松
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Shanghai for Science and Technology
Original Assignee
University of Shanghai for Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Shanghai for Science and Technology filed Critical University of Shanghai for Science and Technology
Priority to CN201710337645.8A priority Critical patent/CN107144561A/en
Publication of CN107144561A publication Critical patent/CN107144561A/en
Pending legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
    • G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
    • G01N21/78—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator producing a change of colour
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/17—Systems in which incident light is modified in accordance with the properties of the material investigated
    • G01N21/25—Colour; Spectral properties, i.e. comparison of effect of material on the light at two or more different wavelengths or wavelength bands
    • G01N21/31—Investigating relative effect of material at wavelengths characteristic of specific elements or molecules, e.g. atomic absorption spectrometry

Landscapes

  • Physics & Mathematics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plasma & Fusion (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)

Abstract

A kind of colorimetric method screens the detection application of arsenic ion in the reaction system of arsenic ion aptamers, the aptamers sequence and water for optimizing arsenic ion, it is characterised in that including：Nucleotide sequence；Nano-Au solution；And sodium chloride solution, wherein, nucleotide sequence is TTA CAG AACAACCAACGTCGCTCCGGGTACTTCTTCATCG, TTA CAGAACAACCAACCCGGGTACTTCTTCATCG, TAG GGAGAT ACCAGC, TTACAGAACAACCGGTACTTCTTCATCG.A kind of application of use colorimetric determination arsenic ion concentration is also provided.Because screening process is simple and quick, auxiliary reagent is easier to obtain, and can be judged by bore hole or be measured using spectrophotometer, greatly reduced the screening difficulty of aptamers, be conducive to immobilization application and quick detection.

Description

A kind of method of quick screening arsenic ion aptamer and application
Technical field
The invention belongs to Environmental safety supervision field, and in particular to a kind of side for allowing rapid screening arsenic ion aptamer Method and the application in arsenic ion detection.
Background technology
Arsenic is a kind of toxic heavy metal, there is strong toxic action for animals and plants, can constantly be tired out in soil and water Product, causes severe contamination.For the detection of heavy metal, a variety of detection means are currently had been developed, such as atomic absorption spectrography (AAS), The methods such as fluorescence method, electrochemical process, hexavalent chrome bio-removal.The detection method of current arsenic has chemical method and instrumental method, chemical method bag Arsenic spot method, silver salt method are included, because chemical method method is cumbersome, sensitivity is not high, the need for being not suitable with modern development；Though instrumental method has Higher accuracy, but its required expensive equipment, and the operation of professional is needed, it is difficult to meet the need of field quick detection Will.
Aptamer is a kind of functional nucleic acid fragment to target molecules with high degree of specificity binding ability, wide The general detection applied to many kinds of substance such as heavy metal, lps molecules.Fas lignand system evolution technology (SELEX) technology of index concentration It is a kind of mainstream technology for screening aptamer.At present in the world based on the technology screening one there is high affinity As3+Aptamers, but the nucleic acid library needed for screening is huge, screening process is cumbersome, wastes time and energy, and has strict to operating personnel Technical requirements.And the As screened3+Aptamers sequence includes 100 nucleotides, and nucleotide chain is long, and synthesis cost is higher, The immobilization of carrier surface is influenceed, its application in arsenic detection is limited.Therefore, it is necessary to develop a kind of simple and quick adaptation Body screening technique, the aptamers to arsenic ion are further screened and optimized.
The content of the invention
The present invention is in order to solve the above problems, it is therefore intended that a kind of easy, quick aptamers screening technique is provided, to arsenic The aptamer of ion carries out rapid Optimum, and to overcome the shortcomings of existing aptamers triage techniques, time-consuming, technical requirements are high.
A kind of colormetric reaction system based on golden nanometer particle, the nucleic acid adaptation of detection arsenic ion is best suitable for for screening Body sequence, it is characterised in that including：Nucleotide sequence；Nano-Au solution；And sodium chloride solution, wherein, nucleotide sequence is
As-40：TTA CAG AAC AAC CAA CGT CGC TCC GGG TAC TTC TTC ATC G,
As-40-2：TTA CAG AAC AAC CAA CCC GGG TAC TTC TTC ATC G,
As-40-4：TAG GGA GAT ACC AGC,
As-40-6：TTA CAG AAC AAC CGG TAC TTC TTC ATC G.
The chrominance response system for the screening arsenic ion aptamers that the present invention is provided, can also have the feature that, it is special Levy and be：Wherein, the concentration of nucleotide sequence is 0.01~1.00 μm of ol/L.
The chrominance response system for the screening arsenic ion aptamers that the present invention is provided, can also have the feature that, it is special Levy and be：Wherein, the concentration of nano-Au solution is 10~20nmol/L.
The chrominance response system for the screening arsenic ion aptamers that the present invention is provided, can also have the feature that, it is special Levy and be：Wherein, the concentration of sodium chloride solution is 0.1~0.9mol/L.
The nucleotide sequence reaction system for the colorimetric determination arsenic ion that the present invention is provided, can also have the feature that, It is characterized in that：Wherein, nucleotide sequence is 5 '-TTA CAG AAC AAC CAA CGT CGC TCC GGG TAC TTC TTC ATC G-3’。
A kind of colorimetric method for screening arsenic ion aptamers with above-mentioned technical characteristic that the present invention is provided and utilize institute Screen the method that aptamers carry out arsenic ion Concentration Testing, it is characterised in that comprise the following steps：
Step one, mixed after aptamer solution to be screened is added into nano-Au solution；
Step 2, the mixed solution obtained by step one and the sodium arsenite solution of concentration known is mixed, and be incubated one Mixed solution is obtained after the section time；
Step 3, the mixed solution in step 2 and the sodium chloride solution of certain concentration are mixed, 5min is reacted at room temperature, seen The color change of sample is examined, is photographed to record, and determines absorbance ratio of the mixed solution to specific wavelength visible ray, is obtained Arsenic ion concentration-absorbance ratio standard curve；
Step 4, by the adaptation liquid solution in aptamer solution replacement step two to be screened in addition, repeat step First, two, three, obtain the color change photo and corresponding arsenic ion concentration-absorbance ratio in the aptamers reaction system Standard curve；
Step 5, compares the color change and arsenic ion concentration-absorbance ratio standard of four kinds of aptamers reaction systems Curve, can obtain the aptamers for being best suitable for detection arsenic ion.
Step 6, the sodium arsenite solution of concentration known in the arsenic ion soln replacement step two of unknown concentration is repeated Step 1: two, three, obtain its absorbance ratio in specific wavelength visible ray, according to the arsenic ion concentration of the aptamers system- Absorbance ratio standard curve, can obtain the arsenic ion concentration in solution to be measured.
The aptamers screening technique that the present invention is provided, can also have the feature that, it is characterised in that：Wherein, step Two and step 3 in time for mixing be 5min, temperature is 25 DEG C of room temperature.
The aptamers screening technique that the present invention is provided, can also have the feature that, it is characterised in that：Wherein, step The wavelength that absorbance ratio in three is determined is 650nm, 520nm, and absorbance ratio is A650/A520.
The nucleotide sequence reaction system that the present invention also provides the colorimetric determination arsenic ion with above-mentioned technical characteristic exists Detect the application in arsenic ion concentration, it is characterised in that：Wherein, arsenic ion is the positive trivalent arsenic ion in the aqueous solution, its concentration For 0.01-1.00mmol/L.
Invention effect and effect
According to the chrominance response system of screening arsenic ion aptamers provided by the present invention, simple to operate, auxiliary reagent：Receive Meter Jin, sodium chloride are easier to obtain, and can be judged by bore hole or the relatively low spectrophotometer of use cost is measured, greatly The big screening difficulty for reducing aptamers；The aptamers sequence length that present invention screening is obtained is flexible, it is to avoid pcr amplification primer thing Limitation, effectively shorten aptamers sequence length, reduce aptamers synthesis cost, be conducive to immobilization application.The present invention is carried The chrominance response system of confession can be also used for carrying out the quick detection of arsenic ion.
Brief description of the drawings
Fig. 1 is aptamers As-40 and various concentrations arsenic ion reaction result photo；
Fig. 2 is Fig. 1 arsenic ion concentration-absorbance ratio curve；
Fig. 3 is aptamers As-40-2 and various concentrations arsenic ion reaction result photo；
Fig. 4 is Fig. 3 arsenic ion concentration-absorbance ratio curve；
Fig. 5 is aptamers As-40-4 and various concentrations arsenic ion reaction result photo；
Fig. 6 is Fig. 5 arsenic ion concentration-absorbance ratio curve；
Fig. 7 is aptamers As-40-6 and various concentrations arsenic ion reaction result photo；And
Fig. 8 is Fig. 7 arsenic ion concentration-absorbance ratio curve.
Embodiment
In order that the technical means, the inventive features, the objects and the advantages of the present invention are easy to understand, it is real below Example combination accompanying drawing is applied to be specifically addressed the instantiation of the screening reaction system of the arsenic ion aptamer of the present invention.
Embodiment
Nucleotide sequence used in the present embodiment is to carry out chemical synthesis using known classical phosphoramidite triester method. Its sequence is as follows：
As-40：TTA CAG AAC AAC CAA CGT CGC TCC GGG TAC TTC TTC ATC G,
As-40-2：TTA CAG AAC AAC CAA CCC GGG TAC TTC TTC ATC G,
As-40-4：TAG GGA GAT ACC AGC,
As-40-6：TTA CAG AAC AAC CGG TAC TTC TTC ATC G.
1st, the preparation of standard substance solution
Weigh different quality sodium chloride be made into distilled water the sodium chloride solution of various concentrations (0,0.1,0.3,0.5, 0.7、0.9mol/L)；The DNA nucleotide sequences (As-40, As-40-2, As-40-4, As-40-6) of synthesis are diluted to distilled water Gradient concentration adaptation liquid solution (0,0.1,0.3,0.5,1 μm of ol/L)；The sodium arsenite for weighing different quality is matched somebody with somebody with distilled water Into required concentration sodium arsenite solution (0,0.01,0.05,0.1,0.5,1mmol/L).
2nd, detecting steps of the aptamers As-40 to various concentrations arsenic ion
50 μ LAuNPs add the aptamers As-40 solution that 50 μ L concentration are 0.1-1 μM, mix, and react at room temperature 5min； Wherein add the sodium arsenite solution (0-1mmol/L) of 50 μ L various concentrations, placing response 5min；It is eventually adding 10 μ L 0.7mol/L sodium chloride solution so that overall solution volume is 160 μ L, is mixed, and room temperature places 5min.Observation experiment result color Change, photographs to record result (Fig. 1), and measures the absorbance of specific wavelength using ultra-violet and visible spectrophotometer, calculates ripple A length of 650nm and 520nm absorbance ratio A650/A520, obtain arsenic ion concentration-absorbance ratio standard curve (Fig. 2).
3rd, the screening of aptamers
By the aptamers in other aptamers As-40-2, As-40-4 and As-40-6 difference alternative embodiments 2 to be screened As-40, experimental results are successively as shown in figures 3-8.By contrast, learn that aptamers As-40 Detection results are optimal.
4th, the detection of arsenic ion
The arsenic ion soln (in the range of 0.1-0.5mmol/L) of 50 μ L unknown concentrations replaces concentration known in embodiment 2 Sodium arsenite solution, experimental results are compared with the standard curve of corresponding aptamers, learn detected arsenic ion Concentration.
The effect of embodiment and beneficial effect
The colorimetric method provided according to the present embodiment screens the reaction system of arsenic ion aptamers, screening process operation letter Single, breakneck acceleration is fast, it is to avoid PCR amplifications, can screen shorter nucleotide sequence, reduce the synthesis cost of aptamers, expands The immobilization application of arsenic aptamers is opened up；And auxiliary reagent：Nanogold, sodium chloride are also easier to obtain；This other implementation The chrominance response system that example is provided can be also used for detecting arsenic ion, can just be measured by lower-cost spectrophotometer, Testing cost is relatively low, is adapted to quick detection.
In the present embodiment, arsenic ion is the positive trivalent arsenic ion (sodium arsenite) in the aqueous solution, and its concentration is 0.01- 1.00mmol/L。

Claims (9)

1. a kind of colorimetric method screens the reaction system of arsenic ion aptamer, for optimize arsenic ion aptamers sequence and arsenic from The detection application of son, it is characterised in that including：
Nucleotide sequence；
Nano-Au solution；And
Sodium chloride solution,
Wherein, the nucleotide sequence is
As-40：TTA CAG AAC AAC CAA CGT CGC TCC GGG TAC TTC TTC ATC G,
As-40-2：TTA CAG AAC AAC CAA CCC GGG TAC TTC TTC ATC G,
As-40-4：TAG GGA GAT ACC AGC,
As-40-6：Any one in TTA CAG AAC AAC CGG TAC TTC TTC ATC G.
2. reaction system and the detection application of colorimetric method screening arsenic ion aptamer according to claim 1, it is special Levy and be：
Wherein, the concentration of the nucleic acid aptamer sequence is 0.01~1.00 μm of ol/L.
3. reaction system and the detection application of colorimetric method screening arsenic ion aptamer according to claim 1, it is special Levy and be：
Wherein, the concentration of the nano-Au solution is 10~20nmol/L.
4. reaction system and the detection application of colorimetric method screening arsenic ion aptamer according to claim 1, it is special Levy and be：
Wherein, the concentration of the sodium chloride solution is 0.1~0.9mol/L.
5. reactant and the detection application of colorimetric method screening arsenic ion aptamer according to claim 1, its feature It is：
Wherein, the nucleotide sequence is 5 '-TTA CAG AAC AAC CAA CGT CGC TCC GGG TAC TTC TTC ATC G-3’。
6. a kind of usage right requires that the colorimetric method in 1-5 described in any one screens the reaction system of arsenic ion aptamer And detection application, it is characterised in that comprise the following steps：
Step one, 50 μ L, 0.01~1.00 μm of ol/L aptamer solution is being added into nano-Au solution described in 50 μ L After mix；
Step 2, the sodium arsenite of the mixed solution obtained by step one and 50 μ L concentration knowns (0.01~1mmol/L) is molten Liquid is mixed, and reacts at room temperature 5min；
Step 3, the mixed solution obtained by step 2 and 10 μ L 0.1-0.9mol/L sodium chloride solution are mixed, and room temperature is anti- 5min is answered, and determines absorbance ratio of the mixed solution in specific wavelength visible ray, it is dense with sodium arsenite described in step 2 Degree is corresponding, obtains arsenic ion concentration-absorbance ratio standard curve；
Step 4, by the adaptation liquid solution in aptamer solution replacement step two to be screened in addition, repeat step one, 2nd, three, obtain the color change photo and corresponding arsenic ion concentration-absorbance ratio standard in the aptamers reaction system Curve；
Step 5, compares the color change and arsenic ion concentration-absorbance ratio standard curve of four kinds of aptamers reaction systems, The aptamers for being best suitable for detection arsenic ion can be obtained.
Step 6, by the sodium arsenite solution of concentration known in the arsenic ion soln replacement step two of unknown concentration, repeat step First, two, three, its absorbance ratio in specific wavelength visible ray is obtained, according to the arsenic ion of aptamers system concentration-extinction Ratio standard curve is spent, the arsenic ion concentration in solution to be measured can be obtained.
7. the method for arsenic ion Concentration Testing according to claim 6, it is characterised in that：
Wherein, the time mixed in step 2 and step 3 is 5min, and temperature is 25 DEG C of room temperature.
8. the method for arsenic ion Concentration Testing according to claim 6, it is characterised in that：
Wherein, the wavelength that the absorbance ratio in step 3 is determined is 650nm, 520nm, and absorbance ratio is A650/A520.
9. the nucleotide sequence reaction system of the colorimetric determination arsenic ion in claim 1-5 described in any one detection arsenic from Application in sub- concentration, it is characterised in that：
Wherein, the arsenic ion is the positive trivalent arsenic ion in the aqueous solution, and its concentration is 0.01-1.00mmol/L.
CN201710337645.8A 2017-05-15 2017-05-15 A kind of method of quick screening arsenic ion aptamer and application Pending CN107144561A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710337645.8A CN107144561A (en) 2017-05-15 2017-05-15 A kind of method of quick screening arsenic ion aptamer and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710337645.8A CN107144561A (en) 2017-05-15 2017-05-15 A kind of method of quick screening arsenic ion aptamer and application

Publications (1)

Publication Number Publication Date
CN107144561A true CN107144561A (en) 2017-09-08

Family

ID=59778245

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710337645.8A Pending CN107144561A (en) 2017-05-15 2017-05-15 A kind of method of quick screening arsenic ion aptamer and application

Country Status (1)

Country Link
CN (1) CN107144561A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108776076A (en) * 2018-07-19 2018-11-09 上海理工大学 A kind of biosensor
CN109142457A (en) * 2018-07-27 2019-01-04 上海理工大学 The measuring method of one metal ion species and ligand interaction
CN109142483A (en) * 2018-07-17 2019-01-04 上海理工大学 It is a kind of for detecting the electrochemica biological sensor and detection method of inorganic trivalent arsenic

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105018626A (en) * 2015-08-06 2015-11-04 常熟理工学院 Method for determining arsenic concentration in sample

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105018626A (en) * 2015-08-06 2015-11-04 常熟理工学院 Method for determining arsenic concentration in sample

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
MINA KIM ET AL.: "Arsenic Removal from Vietnamese Groundwater Using the Arsenic-Binding DNA Aptamer", 《ENVIRON. SCI. TECHNOL.》 *
SHENSHAN ZHAN ET AL.: "Colorimetric Detection of Trace Arsenic(III) in Aqueous Solution Using Arsenic Aptamer and Gold Nanoparticles", 《AUST. J. CHEM.》 *
YUANGEN WU ET AL.: "Ultrasensitive aptamer biosensor for arsenic(III) detection in aqueous solution based on surfactant-induced aggregation of gold nanoparticles", 《ANALYST》 *
柴培 等: "As3+与DNA 4 种碱基相互作用的理论研究", 《计算机与应用化学》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109142483A (en) * 2018-07-17 2019-01-04 上海理工大学 It is a kind of for detecting the electrochemica biological sensor and detection method of inorganic trivalent arsenic
CN108776076A (en) * 2018-07-19 2018-11-09 上海理工大学 A kind of biosensor
CN108776076B (en) * 2018-07-19 2021-05-11 上海理工大学 Biological sensor
CN109142457A (en) * 2018-07-27 2019-01-04 上海理工大学 The measuring method of one metal ion species and ligand interaction

Similar Documents

Publication Publication Date Title
Cheong et al. Fast detection of SARS-CoV-2 RNA via the integration of plasmonic thermocycling and fluorescence detection in a portable device
Ma et al. Copper-mediated DNA-scaffolded silver nanocluster on–off switch for detection of pyrophosphate and alkaline phosphatase
Song et al. Colorimetric/SERS dual-mode detection of mercury ion via SERS-Active peroxidase-like Au@ AgPt NPs
Liu et al. Visually multiplexed quantitation of heavy metal ions in water using volumetric bar-chart chip
CN107144561A (en) A kind of method of quick screening arsenic ion aptamer and application
JP2015070853A (en) Gene expression assays conducted by elemental analysis
Zheng et al. Strategies for the detection of target analytes using microfluidic paper-based analytical devices
Juang et al. Oil immersed lossless total analysis system for integrated RNA extraction and detection of SARS-CoV-2
Zhou et al. Chemical-tongue sensor array for determination of multiple metal ions based on trichromatic lanthanide-based nanomaterials
CN106980022B (en) Homogeneous immunoassay method based on target protein induced DNase circulation generation
WO2017096737A1 (en) Capillary microarray-based high-throughput quick nucleic acid testing method
Yuan et al. A fast and colorimetric sensor array for the discrimination of ribonucleotides in human urine samples by gold nanorods
Li et al. Fast functionalization of silver decahedral nanoparticles with aptamers for colorimetric detection of human platelet-derived growth factor-BB
CN105861669A (en) Amplificatory detection method for quickly capturing branched-chain DNA (Deoxyribonucleic Acid) signal of hybrid target substance
CN106198473B (en) Ratio-type 3-dimensional metal enhances fluorescence Pb2+The structure of biosensor
CN101672848A (en) Microsphere surface fluorescence color coding liquid biochip diagnostic kit, method and device for detecting material to be detected by using diagnostic kit and application of diagnostic kit
CN107044963A (en) A kind of new arsenic aptamers nucleotide sequence and the application for detecting arsenic ion
CN104089936B (en) Based on method of the biology sensor to the MCF tumor-marker analyte detections of fluorescence labeling
Doménech-Carbó et al. Spot tests: past and present
Zhang et al. Ultrasensitive detection of Pb2+ based on a DNAzyme and digital PCR
CN106841130A (en) A kind of method of uranyl ion content in unmarked fluoroscopic examination water sample
CN109239759A (en) A kind of method of rapid-digestion sample measurement radionuclide
WO2015170190A2 (en) Devices and kits for measuring biological results
CN108949917B (en) Mercury ion mismatch type general partition ultrafast amplification colorimetric sensor
CN107201307B (en) A kind of heparin tube and its application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20170908

RJ01 Rejection of invention patent application after publication