CN107130030A - DNA Marker and preparation method and application for detecting the ancient fungus kind of coal geomicrobiology - Google Patents

DNA Marker and preparation method and application for detecting the ancient fungus kind of coal geomicrobiology Download PDF

Info

Publication number
CN107130030A
CN107130030A CN201710349248.2A CN201710349248A CN107130030A CN 107130030 A CN107130030 A CN 107130030A CN 201710349248 A CN201710349248 A CN 201710349248A CN 107130030 A CN107130030 A CN 107130030A
Authority
CN
China
Prior art keywords
dna
coal
geomicrobiology
ancient
dna fragmentation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710349248.2A
Other languages
Chinese (zh)
Other versions
CN107130030B (en
Inventor
杨秀清
陈彦梅
王保玉
袁宗本
吴瑞薇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanxi Hengrui Resource Recycling Technology Co.,Ltd.
Original Assignee
Shanxi University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanxi University filed Critical Shanxi University
Priority to CN201710349248.2A priority Critical patent/CN107130030B/en
Publication of CN107130030A publication Critical patent/CN107130030A/en
Application granted granted Critical
Publication of CN107130030B publication Critical patent/CN107130030B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Abstract

The present invention relates to the special species DNA Marker of coal geological environment Gu bacterium in a kind of denaturing gradient gel electrophoresis (DGGE) Molecular Detection of coal geological environment microorganism species, belong to Molecular Ecology of Microbiology field.The present invention is realized by the following method：DNA Marker for detecting the ancient fungus kind of coal geomicrobiology, the DNA Marker are made up of 8 DNA fragmentation a h, DNA fragmentation a nucleotide sequence is as shown in SEQ.ID.NO.1, DNA fragmentation b nucleotide sequence is as shown in SEQ.ID.NO.2, DNA fragmentation c nucleotide sequence is as shown in SEQ.ID.NO.3, DNA fragmentation d nucleotide sequence is as shown in SEQ.ID.NO.4, DNA fragmentation e nucleotide sequence is as shown in SEQ.ID.NO.5, DNA fragmentation f nucleotide sequence is as shown in SEQ.ID.NO.6, DNA fragmentation g nucleotide sequence is as shown in SEQ.ID.NO.7, DNA fragmentation h nucleotide sequence is as shown in SEQ.ID.NO.8.

Description

For detect the ancient fungus kind of coal geomicrobiology DNA Marker and preparation method and Using
Technical field
The present invention relates in a kind of denaturing gradient gel electrophoresis (DGGE) Molecular Detection of coal geological environment microorganism species The special species DNA Marker of coal geological environment Gu bacterium, belong to Molecular Ecology of Microbiology field.
Background technology
Coal geological environment microorganism refers to the microorganism detected in coal seam output water sample or coal sample or above-mentioned difference through richness The microorganism detected after collection culture, is broadly divided into bacterium and the ancient major class of bacterium two.Ancient bacterium in coal geological environment refers mainly to produce first Alkane Gu bacterium.Methane phase Gu bacterium is widely distributed, from soil to lake sediment, from land to ocean, from sub-zero temperature environment Hot environment to more than 100 DEG C, spreads all over the most anaerobic environment of the earth, and they play important in earth Carbon cycle Role, according to statistics, in all CH4In emission source, about 69% CH4From the metabolic activity of the ancient bacterium of methane phase.In coal seam And the ancient bacterium of methane phase detected in the output water of coal seam, during they are primarily involved in degraded coal methane phase, the CH of generation4 Referred to as biogenesis coal bed gas.At present, the specific generating process of biogenesis coal bed gas and mechanism are not also fully aware of, but only One it is confirmed that the final step of methane phase, i.e., by the ancient bacterium of methane phase by CO2+H2, acetic acid and some materials that methylate are converted into CH4, and CH4It is their unique metabolites.The difference of substrate classification is utilized according to the ancient bacterium of methane phase, can be ancient by methane phase Bacterium is divided into 3 nutrient types：Methylotrophic, hydrogen auxotype and acetic acid auxotype.The feature of Methylotrophic methane phase Gu bacterium Pseudomonas mainly has Methanomethylovorans, Methanolobus etc.；The feature Pseudomonas master of hydrogen auxotype methane phase Gu bacterium There are Methanothermobacter, Methanolinea and Methanoculleus etc.；Acetic acid auxotype methane phase Gu bacterium Feature Pseudomonas is mainly Methanosaeta.And common Methanosarcina can utilize CO2+H2, acetic acid and part first Glycolylate matter produces CH4.Study the ancient bacterium of the related methane phase of coal seam gas diversity and its activity coal bed gas is regenerated with function and Disclose biodegradable coal significant.
In conventional decades, domestic and foreign scholars are based primarily upon 16S rRNA and do not train microbe research technology to analyze coal The diversity of layer gas related microorganisms, is common in clone library, terminal restriction fragment length diversity (Terminal- Restriction fragment length polymorphism, T-RFLP), high-flux sequence, denaturing gradient gel electrophoresis (Denatured Gradient Gel Electrophoresis, DGGE) etc. is analyzed.Every analytical technology has its distinctive Limitation.Wherein, clone library builds Kuku finite capacity, tends not to react the various of microorganism in primary sample exactly Property.T-RFLP may cause excessive estimation to the diversity of microorganism, and accuracy is poor.Although high-flux sequence accuracy Height, but it is longer for the cycle of Analysis of Microbial Diversity, consumption money again is taken, cost is higher.
It is excellent that DGGE technologies show its reliability, accuracy, high efficiency etc. in the research application of microbial diversity Point, still, to still needing to clone and sequencing analysis dependent on DGGE bands during the analysis of microbial diversity, it is necessary to certain Experimental period, thus quicklook the kind status belonging to DGGE bands can not be characterized.Ground in life science Study carefully field, DNA Marker are used in the various electrophoresis processes of molecular biology frequently as a kind of molecular labeling, so as to directly perceived Ground is analyzed by sample.General DNA Marker are made up of the different DNA fragmentation mixing of molecular weight, are often applied in molecule In biological experiment.This DNA Marker use is mainly the size for estimating sample DNA molecular weight roughly by its size, Such as DL2000,100bp, Lambda DNA/HindIII.In terms of Analysis of Microbial Diversity, DNA Marker can conduct The genetic marker of individual specificity.Accordingly, it would be desirable to which a kind of DNA Marker can be applied in the fast of microorganism species PCR-DGGE In speed detection.But up to now, also without DNA in relevant coal geological environment microorganism species PCR-DGGE detections Marker research report.In summary, the DNA Marker of coal geological environment microorganism species Molecular Detection are obtained to application PCR-DGGE detects that coal geological environment microorganism species diversity and its microorganisms degraded coal produce the mechanism tool of coal bed gas It is significant.
The content of the invention
To realize efficiently quickly and again cost-effectively using PCR-DGGE technology for detection coal geological environment microorganism species Diversity, the invention discloses a kind of coal geomicrobiology PCR-DGGE detections middle ancient times fungus kind DNA Marker and preparation side Method and application.
The present invention is realized by the following method：
DNA Marker for detecting the ancient fungus kind of coal geomicrobiology, the DNA Marker are by 8 DNA fragmentation a-h Composition, DNA fragmentation a nucleotide sequence is as shown in SEQ.ID.NO.1, DNA fragmentation b nucleotide sequence such as SEQ.ID.NO.2 Shown, DNA fragmentation c nucleotide sequence is as shown in SEQ.ID.NO.3, DNA fragmentation d nucleotide sequence such as SEQ.ID.NO.4 Shown, DNA fragmentation e nucleotide sequence is as shown in SEQ.ID.NO.5, DNA fragmentation f nucleotide sequence such as SEQ.ID.NO.6 Shown, DNA fragmentation g nucleotide sequence is as shown in SEQ.ID.NO.7, DNA fragmentation h nucleotide sequence such as SEQ.ID.NO.8 It is shown.
The present invention is used for the DNA Marker preparation methods for detecting the ancient fungus kind of coal geomicrobiology, comprises the following steps：
(1) microbe genome DNA in coal geological environment sample is extracted, using the microbe genome DNA of extraction as template, The ancient bacterium 16S rDNA V3-V4 region sequences of first time PCR amplifications, row agarose gel electrophoresis point are entered by first time pcr amplification product Analysis, and reclaim target DNA fragments；
(2) second of PCR amplification is carried out by template of the target DNA fragments of recovery, second of pcr amplification product is carried out DGGE is analyzed, and the DNA fragmentation cut from DGGE glue is Gu bacterium 16S rDNA V3-V4 areas DNA fragmentation；
(3) the ancient bacterium 16S rDNA V3-V4 area's DNA fragmentations cut using on step (2) DGGE glue are template through third time PCR is expanded, and reclaims third time pcr amplification product；
(4) the third time pcr amplification product of step (3) is cloned into carrier T and obtains connection product；
(5) connection product obtained through step (4) is transferred to Host Strains, screens positive recombinant；
(6) the 4th PCR amplification is carried out using positive recombinant as template；
(7) the 4th pcr amplification product of step (6) is subjected to DGGE analyses again, verifies pillar location, pillar location is just True DNA fragmentation is used as the DNA fragmentation a in coal geomicrobiology Gu fungus kind DNA Marker compositions；
(8) repeat step (1) to (7), prepares the DNA fragmentation in coal geomicrobiology Gu fungus kind DNA Marker compositions b-h；
(9) combination of step (7) and (8) constitutes the DNA Marker of the ancient fungus kind of coal geomicrobiology.
Preferably, the template concentrations in step (6) of the present invention used in 4th PCR amplification are 16~21ng/ μ L.
Preferably, the DNA fragmentation cut from DGGE glue in step (2) of the present invention with 30 μ L deionized waters 4 Soaked overnight under the conditions of DEG C, takes soak as the template of step (3).
Preferably, carrier T is Beijing Quanshijin Biotechnology Co., Ltd in step (4) of the present inventionCarrier.
Preferably, Host Strains are bacillus coli DH 5 alpha in step (5) of the present invention.
Preferably, used when first time PCR amplifications are expanded with third time PCR in step (3) in step (1) of the present invention Primer be 0357f/0691r；The primer used in the step (2) during second of PCR amplification is 0357f-GC/0691r；Institute It is 0357f-GC/0691r-A and 0357f-GC/0691r-G to state the primer used during the 4th PCR amplification in step (4).
Preferably, primer 0357f/0691r, 0357f-GC/0691r, 0357f-GC/0691r-A of the present invention and 0357f-GC/0691r-G sequence is：
0357f：CCCTACGGGGCGCAGCAG；
0357f-GC：CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCCTACGGGGCGCAGCAG；
0691r：GGATTACARGATTTCAC；
0691r-A：GGATTACAAGATTTCAC；
0691r-G：GGATTACAGGATTTCAC.
The present invention is used for the application for detecting the DNA Marker of the ancient fungus kind of coal geomicrobiology, by species DNA Marker Mixed with 6 × DNA sample-loading buffers with volume ratio 5: 1, the detection for the ancient fungus kinds of coal geomicrobiology PCR-DGGE.
The yardstick of DNA Marker in PCR-DGGE that the present invention is mentioned detection not DNA fragmentation size, but pass through Its species specificity sequence (16S rDNA variable region V3-V4 areas) precisely to characterize the Pseudomonas status belonging to sample DNA, Marker every composition band is all unique sequence, represents specific strain, is only limitted to make in denaturing gradient gel electrophoresis With.The present invention detected applied to PCR-DGGE in DNA Marker have that band is sharp keen, band brightness is homogeneous, Marker compositions Band number is unrestricted, species specificity the advantages of.In addition, DNA Marker disclosed by the invention have been cloned on carrier, can To obtain a large amount of plasmids by cultivating Escherichia coli, then obtained by PCR methods, production repeatability is high, stability is good.It is such a Marker use can be shortened experiment and taken with Acceleration study process, the especially larger experiment of sample size.
Brief description of the drawings
Fig. 1 is the different enrichment culture sides using Qinshui Basin In Shanxi Province high-order coal seam output water sample as bacterium source that the present invention is used The agarose gel electrophoresis figure of culture sample extracting genome DNA result 0.7% that formula is obtained,
It is the early stage sampling sample of different training methods in figure, M is Lambda DNA/HindIII；
Fig. 2 enters the ancient bacterium of performing PCR amplification for the present invention using the enrichment culture liquid genomic DNA of high-order coal seam output water sample The agarose gel electrophoresis figure of result 1.5% in 16S rDNA V3-V4 areas,
M is 100bp in figure；
Fig. 3 enters the ancient bacterium 16S of performing PCR amplification for the present invention using high-order coal seam output water sample enrichment culture liquid genomic DNA The DGGE collection of illustrative plates of rDNA V3-V4 areas amplified production,
DGGE deposition condition is prerunning 200V, 5min, then 85V, and 12h, gum concentration is 8%, and denaturation scope is 40%-60%, electrophoresis liquid temperature is 60 DEG C, the D-Code Universal that the equipment used produces for BIO-RAD companies of the U.S. Mutation Detection System(Bio-Rad,USA)；
Fig. 4 is the agarose gel electrophoresis figure of screening positive clone daughter colony PCR results 1.5% of the present invention,
K in figure1For blank control, K2For cloned sequence, KLFor the positive control using locus coeruleus as template；
The agarose gel electrophoresis figure of positive clone molecule plasmid extraction result 0.7% that Fig. 5 is sieved to for the present invention；
Fig. 6 is the DGGE collection of illustrative plates that screen fraction DNA Marker of the present invention constitute band,
C, e, f, i, k are respectively DNA Marker composition band in figure, and DGGE deposition condition is prerunning 200V, 5min, then 85V, 12h, gum concentration is 8%, and denaturation scope is 40%-60%, and electrophoresis liquid temperature is 60 DEG C, the equipment of use For BIO-RAD companies of the U.S. produce D-Code Universal Mutation Detection System (Bio-Rad, USA)；
Fig. 7 (is named as coal geomicrobiology PCR-DGGE detections middle ancient times fungus kind DNA Marker prepared by the present invention CBMarc1 DGGE electrophoresis patterns), and each sequence Pseudomonas similitude comparison result,
8 bands are respectively labeled as a, b, c, d, e, f, g, h in figure.DGGE deposition condition be prerunning 200V, 5min, Then 85V, 12h, gum concentration is 8%, and denaturation scope is 40%-60%, and electrophoresis liquid temperature is 60 DEG C, and the equipment used is the U.S. The D-Code Universal Mutation Detection System (Bio-Rad, USA) of BIO-RAD companies production；
Fig. 8 be using the ancient fungus kind DNA Marker (CBMarc1) that prepare of the present invention to high-order coal seam output water with it is brown The DGGE electrophoresis patterns that the enrichment culture sample of coal is detected,
The DNA Marker for being used to detect the ancient fungus kind of coal geology that CBMarc1 is prepared for the present invention in figure, other swimming lanes Sample is the sampling sample of high-order coal seam output water and lignite enrichment culture different time sections,
DGGE deposition condition is prerunning 200V, 5min, then 85V, 12h.Gum concentration is 8%, and denaturation scope is 40%-60%, electrophoresis liquid temperature is 60 DEG C, the D-Code Universal that the equipment used produces for BIO-RAD companies of the U.S. Mutation Detection System(Bio-Rad,USA)。
Embodiment
Embodiment 1
1. extracting the genomic DNA in the early stage enrichment culture liquid of different enrichment culture modes, carried out from 2 sets of primers PCR is expanded；
1.1 extracting genome DNA steps are shown in patent document CN2016103727233, and the agarose of genomic DNA 0.7% coagulates Glue checking collection of illustrative plates is as shown in Figure 1；
1.2 first time PCR are expanded, Ke Ruitai (Beijing) bio tech ltd during obtained pcr amplification product is used The purifying of Ago-Gel DNA QIAquick Gel Extraction Kits is reclaimed, and -20 DEG C save backup, and PCR is reacted in PTC-200, Bio-Rad, USA Run in PCR instrument；
1.2.1 PCR reaction systems：
1.2.2 PCR response procedures are：95 DEG C of pre-degenerations 5min, 95 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 60s, 34 circulations, 72 DEG C of 10min, 10 DEG C of for ever,
1.2.3 primer sequence is as follows：
0357f：CCCTACGGGGCGCAGCAG；
0691r：GGATTACARGATTTCAC；
The DNA fragmentation that 1.3 above-mentioned purifying are reclaimed enters performing PCR amplification, i.e., second PCR amplification again.Pcr amplification product 1.5% Ago-Gel checking collection of illustrative plates is as shown in Figure 2.Obtained pcr amplification product is saved backup under the conditions of -20 DEG C, PCR React in PTC-200, Bio-Rad, run in USA PCR instruments；
1.3.1 PCR reaction systems：
1.3.2 PCR response procedures are：95 DEG C of pre-degenerations 5min, 95 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 60s, 34 circulations, 72 DEG C of 10min, 10 DEG C of for ever,
1.3.3 primer sequence is as follows：
0357f-GC：CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCCTACGGGGCGCAGCAG；
0691r：GGATTACARGATTTCAC；
2.DGGE is analyzed：
2.1 selection polyacrylamide gel gum concentrations are 8%, and glue denaturation scope is 40%~60%, takes 40%, 60% glue Each 18ml, is separately added into 50 μ L TEMED and 40 μ L 10% ammonium persulfate, gradient mixing glue, the solidification of summer room temperature, winter It can be placed in 37 DEG C of incubators and solidify, if room temperature solidifies, gel time at least 3h；
After 2.2 treat gelling admittedly completely, comb is pulled out, whole plank is arranged on DGGE supports, plank will be installed DGGE supports be put into electrophoresis tank, cleaning glue hole switches on power, when electrophoresis liquid temperature rises to 60 DEG C, 200V prerunnings 5min, with 50 microlitres of quick loadings of microsyringe, pcr amplification product applied sample amount is 45-50 μ L, electric under the conditions of 60 DEG C, 85V Swim 12h；
After 2.3 electrophoresis are finished, glue is put into 3 × GelRed dye liquors and dyes 30min or so, is taken pictures, DGGE collection of illustrative plates is for example attached Shown in Fig. 3；
2.4 cut 8 specific purpose bands, are put into sterile EP pipes, number；
2.5 are washed with deionized adhesive tape, and break into adhesive tape into pieces segment, add the immersion of 30 μ L deionized waters, 4 DEG C of mistakes Night；
2.6 enter performing PCR amplification, i.e. third time PCR amplifications again using without the GC primers pressed from both sides.Obtained PCR primer is used The Ago-Gel DNA QIAquick Gel Extraction Kits purifying of middle Ke Ruitai (Beijing) bio tech ltd is reclaimed, and -20 DEG C of preservations are standby With；
2.6.1 PCR reaction systems：
2.6.2 PCR response procedures are：95 DEG C of pre-degenerations 5min, 95 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 60s, 34 circulations, 72 DEG C of 10min, 10 DEG C of for ever,
2.6.3 primer sequence is as follows：
0357f：CCCTACGGGGCGCAGCAG；
0691r：GGATTACARGATTTCAC；
3.TA Cloning Transformations, the TA connection methods for the DNA fragmentation that above-mentioned purifying is reclaimed are had by the golden biotechnology of the full formula in Beijing Limit companyCloning Kit are carried out；
3.1 cloning reaction system：PCR primer：0.5~4 μ L；Cloning Vector：1μL.Gently mix Close, after reaction terminates, PCR pipe is placed on ice by 25 DEG C of reaction 10min, what the DH5 α that connection product is added into 50 μ L had just thawed In competent cell, mixing is flicked, ice bath 30min, 42 DEG C of heat shock 30s are immediately placed on 2min on ice, add 250 μ L LB trainings Support base, 200rpm, 37 DEG C of culture 1h.During this period, 8 μ L 500mM IPTG and 40 μ L 20mg/ml X-gal mixing are taken, Amp is coated on evenly+On the LB solid plates of resistance, fully absorb IPTG and X-gal.4000rpm centrifuges bacterium solution 1min, abandons Fall part supernatant, suspension thalline is coated on ready flat board, 37 DEG C of incubated 12h or so；
3.1.1 the LB culture medium prescriptions (1L) used:Tryptone 10g, sodium chloride 5g, yeast extract 5g, agar powder 15g.The competent cell used is DH5 α；
3.2 identify positive colony using bacterium colony PCR method；
3.2.1 the white monoclonal bacterium colony of picking is in Amp+On the LB solid plates of resistance after backup strain, it is put into and fills 10 μ In the EP pipes of L deionized waters, boiling water bath boils sample 5min；
3.2.2 the sample liquid that 2 μ L boiling water baths were boiled is taken to enter performing PCR amplification as template, if positive control is (with blue monoclonal bacterium Fall for template) and blank control (using deionized water as template)；
3.2.2.1 PCR reaction systems：
3.2.2.2 PCR response procedures are：95 DEG C of pre-degenerations 5min, 95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 45s, 30 are followed Ring, 72 DEG C of 10min, 10 DEG C of for ever,
3.2.2.3 primer sequence is as follows：
M13R：CAGGAAACAGCTATGACC
M13F：TGTAAAACGACGGCCAGT
3.2.3 PCR primer verifies size, clone of the clip size between 500-600bp in 1.5% Ago-Gel Son is considered as positive colony, and the Ago-Gel of PCR primer 1.5% checking collection of illustrative plates is as shown in Figure 4.
4. extracting positive clone molecule plasmid, each cloned sequence selects the plasmid of 3 positive clone molecules to send out sequencing, sequencing knot Fruit is committed to NCBI, online to compare the Pseudomonas status for determining sequence；
The positive colony that 4.1 pickings are determined is inoculated in 5mL LB fluid nutrient mediums and (adds 5 μ L 50mg/mL's before inoculation Amp in), 37 DEG C, 200rmp cultivates 12~14h, and matter is extracted with a small amount of extraction agent boxes of SanPrep pillar DNAs of raw work In grain, the deionized water for being dissolved in 50 μ L, -20 DEG C save backup, wherein, extract the 0.7% Ago-Gel checking collection of illustrative plates of plasmid As shown in Figure 5；
4.1.1 the LB Liquid Cultures based formulas (1L) used:Tryptone 10g, sodium chloride 5g, yeast extract 5g.
The plasmid of 4.2 3 positive clone molecules of each cloned sequences selection is delivered to Shanghai BGI Technology Co., Ltd. and entered Row sequencing；
4.3 sequencing results are committed to NCBI, online to compare the Pseudomonas status for determining sequence；
5. DGGE analyses are carried out again, position of the checking band on DGGE films；
5.1 ELIASAs survey the concentration for extracting plasmid, with deionized water dilution plasmid concentration to 20ng/ μ L or so, to dilute Plasmid is that template enters performing PCR amplification, i.e., the 4th time PCR amplification；
5.1.1 PCR reaction systems：
5.1.2 PCR response procedures are：95 DEG C of pre-degenerations 5min, 95 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 60s, 34 circulations, 72 DEG C of 10min, 10 DEG C of for ever,
5.1.3 primer sequence is as follows：
0357f-GC：CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCCTACGGGGCGCAGCAG；
0691r-A：GGATTACAAGATTTCAC；
0691r-G：GGATTACAGGATTTCAC.
5.2PCR amplified productions are analyzed for DGGE loadings, 2.1 in DGGE electrophoresis processes reference specific embodiment 1, 2.2nd, 2.3 carry out, band electrophoresis behavior person consistent with template band electrophoresis behavior is then elected to be DNA Marker's on DGGE collection of illustrative plates Band is constituted, the DGGE collection of illustrative plates of checking is as shown in Figure 6.
6. make the DNA Marker that coal geomicrobiology PCR-DGGE detects middle ancient times fungus kind；
6.1 enter performing PCR amplification by template of plasmid, and each plasmid template amount control expands body in the range of 16-21ng/ μ L System, condition, the primer are with reference to step 5.1.1,5.1.2,5.1.3 in specific embodiment 1.
6.2 take the μ L of pcr amplification product 20 of each plasmid to be mixed in equal volume, and mixed PCR primer is in vacuum refrigeration Concentrated in drying machine, treat PCR primer volume concentration to 30 μ L or so with 6 × DNA Loading buffer with volume ratio 5： 1 is well mixed, that is, obtains DNA Marker, and the DNA Marker prepared are analyzed for DGGE loadings, DGGE electrophoresis processes ginseng According to the step 2.1 in specific embodiment 1,2.2,2.3, DGGE collection of illustrative plates as shown in Figure 7；
7. the Pseudomonas status with reference to representated by every DNA Marker band, to DNA in the PCR-DGGE detections of preparation Marker is named, and the standby DNA Marker of patent system of the present invention are named as CBMarc1.
Embodiment 2
1. in the prometaphase enrichment culture liquid for extracting Qinshui Basin In Shanxi Province high-order coal seam output water sample and Zhaotong County, Yunnan lignite Genomic DNA, enter performing PCR amplification from 2 sets of primers, genome is extracted and PCR amplifications are with reference in specific embodiment 1 1.1、1.2、1.3。
2.DGGE is analyzed：
2.1 selection polyacrylamide gel gum concentrations are 8%, and glue denaturation scope is 40%~60%, takes 40%, 60% glue Each 18ml, is separately added into 50 μ L TEMED and 40 μ L 10% ammonium persulfate, gradient mixing glue, the solidification of summer room temperature, winter It can be placed in 37 DEG C of incubators and solidify, if room temperature solidifies, gel time at least 3h；
After 2.2 treat gelling admittedly completely, comb is pulled out, whole plank is arranged on DGGE supports, plank will be installed DGGE supports be put into electrophoresis tank, cleaning glue hole switches on power, when electrophoresis liquid temperature rises to 60 DEG C, 200V prerunnings 5min, with 50 microlitres of quick loadings of microsyringe, loading sample is the Gu Jun V3-V4 areas of later stage output water enrichment culture sample The ancient bacterium DNA Marker prepared in pcr amplification product and specific embodiment 1.The ancient bacterium V3-V4 of output water enrichment culture sample Area's pcr amplification product applied sample amount is 45-50 μ L, and ancient bacterium DNA Marker applied sample amounts are 30 μ L.The electrophoresis under the conditions of 60 DEG C, 85V 12h；
After 2.3 electrophoresis are finished, glue is put into 3 × GelRed dye liquors and dyes 30min or so, is taken pictures, DGGE collection of illustrative plates is for example attached Shown in Fig. 8；
2.4 interpretation of result：As shown in Figure 8, the DNA Marker parts composition band and sample that prepared by invention Part band contained by product is corresponded, it was initially believed that band corresponding with Marker is that Marker composition bands are relative in sample The Pseudomonas answered.That is enrichment culture sample liquid middle ancient times in prometaphase of Qinshui Basin In Shanxi Province high-order coal seam output water sample and Zhaotong County, Yunnan lignite The Bacterial community of bacterium prepares the part Pseudomonas corresponding to Marker comprising invention.
3. sample strip sequence analysis：
3.1 cut band co-located with the ancient bacterium DNA Marker of preparation in enrichment culture sample, are put into In sterile EP pipes, numbering；
3.2 are washed with deionized adhesive tape, and break into adhesive tape into pieces segment, add the immersion of 30 μ L deionized waters, 4 DEG C of mistakes Night；
3.3 enter performing PCR amplification again using without the GC primers pressed from both sides, and pcr amplification reaction system, condition and primer are with reference to tool 2.6.1,2.6.2 and 2.6.3 in body embodiment 1.The limited public affairs of Ke Ruitai (Beijing) biotechnology during obtained PCR primer is used The Ago-Gel DNA QIAquick Gel Extraction Kits purifying of department is reclaimed, and the DNA fragmentation of recovery delivers to Shanghai BGI Technology Co., Ltd. It is sequenced；
3.4 sequencing results are committed to NCBI, online to compare the Pseudomonas status for determining sequence, through comparing analysis and Marker It is identical with corresponding Marker in the affiliated Pseudomonas status of the band of same position, and Pseudomonas similitude is all higher than 97%.Demonstrate Qinshui Basin In Shanxi Province high-order coal seam output water sample and the flora knot of the prometaphase enrichment culture sample liquid middle ancient times bacterium of Zhaotong County, Yunnan lignite Structure contains invention and prepares part Pseudomonas corresponding to Marker.Main advantage is ancient i.e. in the early stage sample of enrichment culture Bacterium Pseudomonas is Methanocelleus.In the mid-term of enrichment culture, main advantage Gu bacterium Pseudomonas be Methanosarina with Methanocelleus。
SEQUENCE LISTING
<110>University Of Shanxi
<120>DNA Marker and preparation method and application for detecting the ancient fungus kind of coal geomicrobiology
<130> .
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 327
<212> DNA
<213> Methanobacterium
<400> 1
ccctacgggg cgcagcaggc gcgaaacctc cgcaatgcga gcaatcgcga cggggggacc 60
ccaagtgcca ctcttaacgg ggtggctttt cttaagtgta aaaagctttt ggaataaggg 120
ctgggcaaga ccggtgccag ccgccgcggt aacaccggca gctctagtgg tagccatttt 180
tattgggcct aaagcgttcg tagccggttt gataagtctc tggtgaaatc ctatagctta 240
actgtgggac ttgctggaga tactattaga cttgaggtcg ggagaggtta gcggtactcc 300
cagggtaggg gtgaaatcct gtaatcc 327
<210> 2
<211> 327
<212> DNA
<213> Methanosarcina
<400> 2
ccctacgggg cgcagcaggc gcgaaaactt tacaatgcgg gaaaccgtga taaggggaca 60
ccgagtgcca gcatcatatg ctggctgtcc ggatgtgtaa aatacatccg ttagcaaggg 120
ccgggcaaga ccggtgccag ccgccgcggt aacaccggcg gcccgagtgg tgatcgtgat 180
tattgggtct aaagggtccg tagccggttt ggtcagtcct ccgggaaatc tgatagctta 240
actattaggc tttcggggga tactgccaga cttggaaccg ggagaggtaa gaggtactac 300
aggggtagga gtgaaatctt gtaatcc 327
<210> 3
<211> 327
<212> DNA
<213> Methanosarina
<400> 3
ggattacaag atttcactcc tacccctgta gtacctctta cctctcccgg ttccaagtct 60
ggcagtatcc cccgaaagcc taatagttga gctatcagat ttcccggagg actgaccaaa 120
ccggctacgg accctttaga cccaataatc acgatcacca ctcgggccgc cggtgttacc 180
gcggcggctg gcaccggtct tgcccggccc ttgctaacgg atgtatttta cacatccgga 240
cagccagcat atgatgctgg cactcggtgt ccccttatca cggtttcccg cattgtaaag 300
ttttcgcgcc tgctgcgccc cgtaggg 327
<210> 4
<211> 327
<212> DNA
<213> Methanosarcina
<400> 4
ggattacaag atttcactcc tacccctgta gtacctctta cctctcccgg ttccaagcct 60
ggcagtatcc cccgaaagcc taacagttaa gctatcagat ttcccggagg actgaccaaa 120
ccggctacgg accctttaga cccaataata acggtcacca ctcgggccgc cggtgttacc 180
gcggcggctg gcaccggtct tgcccggccc ttgctaacag atgtagttta cacatctgga 240
cagccagcat atgatgctgg cactcggtgt tcccttatca cggtttcccg cattgtaaag 300
ttttcgcgcc tgctgcgccc cgtaggg 327
<210> 5
<211> 323
<212> DNA
<213> Methanocelleus
<400> 5
ccctacgggg cgcagcaggc gcgaaaactt tacaatgcgg gcaaccgtga taagggaacc 60
tcgagtgcct gtacatgcag gctgtctggg tgtctaaaac acacccaaag aaagggccgg 120
gcaagaccgg tgccagccgc cgcggtaata ccggcggctc gagtggtggc cacttttatt 180
gggcttaaag cgttcgtagc tgggttgtta agtctcttgg gaaatctgac ggctcaaccg 240
tcaggcgtct aagggatact ggcaatcttg gaaccgggag aggtgagggg tacttcgggg 300
gtaggagtga aatcctgtaa tcc 323
<210> 6
<211> 323
<212> DNA
<213> Methanospirillum
<400> 6
ggattacagg atttcactcc taccccggca gtacctctca cctctcccgg tccctagaaa 60
tgcagtttcc cctgaacgcc caccagttga gctggcggat ttctcaagag acttgcatat 120
caagctacgg accctttaag cccagtaata gtggccacca ctcgagccgc cggtattacc 180
gcggcggctg gcaccggtct tgcccggccc tttcttcacc agttatttac actggcggac 240
agccagcctg tgctggcact cggggtttcc ttatcacggt tgcccgcatg gtaaagtttt 300
cgcgcctgct gcgccccgta ggg 323
<210> 7
<211> 346
<212> DNA
<213> Methanomethylovorans
<400> 7
ccctacgggg cgcagcaggc gcgacggggc gcagcaggcg cgaaaacttt acaatgcggg 60
aaaccgcgat aaggggacac cgagtgccag catcctatgt tggctgtcca tatgtataaa 120
tcacatgtgt tagcaagggc cgggcaagac cggtgccagc cgccgcggta acaccggcgg 180
cccgagtggt ggccactatt attgggtcta aagggtccgt agccggtttg gtcagtcttc 240
cgggaaatct gacggcttaa ccgttaggct ttcgggggat actacctggc ttgggaccgg 300
gagaggtaag aggtactacg ggggtaggag tgaaatcctg taatcc 346
<210> 8
<211> 327
<212> DNA
<213> Methanosarcina
<400> 8
ccctacgggg cgcagcaggc gcgaaaactt tacaatgcgg gaaaccgtga taaggggaca 60
ccgagtgcca gcatcatatg ctggctgtcc gggtgtgtaa aatacacctg ttagcaaggg 120
ccgggcaaga ccggtgccag ccgccgcggt aacaccggcg gcccgagtgg tgatcgtgat 180
tattgggtct aaagggtccg tagccggttt ggtcagtcct ccgggaaatc tgacggctta 240
accgttaggc tttcggggga tactgccagg cttggaaccg ggagaggtaa gaggtactac 300
aggggtagga gtgaaatcct gtaatcc 327

Claims (9)

1. the DNA Marker for detecting the ancient fungus kind of coal geomicrobiology, it is characterised in that：The DNA Marker are by 8 DNA fragmentation a-h is constituted, and DNA fragmentation a nucleotide sequence is as shown in SEQ.ID.NO.1, and DNA fragmentation b nucleotide sequence is such as Shown in SEQ.ID.NO.2, DNA fragmentation c nucleotide sequence is as shown in SEQ.ID.NO.3, and DNA fragmentation d nucleotide sequence is such as Shown in SEQ.ID.NO.4, DNA fragmentation e nucleotide sequence is as shown in SEQ.ID.NO.5, and DNA fragmentation f nucleotide sequence is such as Shown in SEQ.ID.NO.6, DNA fragmentation g nucleotide sequence is as shown in SEQ.ID.NO.7, and DNA fragmentation h nucleotide sequence is such as Shown in SEQ.ID.NO.8.
2. being used for described in claim 1 detects the DNA Marker preparation methods of the ancient fungus kind of coal geomicrobiology, its feature It is to comprise the following steps：
(1) microbe genome DNA in coal geological environment sample, using the microbe genome DNA of extraction as template, first are extracted The secondary ancient bacterium 16S rDNA V3-V4 region sequences of PCR amplifications, row agarose gel electrophoresis analysis is entered by first time pcr amplification product, And reclaim target DNA fragments；
(2) second of PCR amplification is carried out by template of the target DNA fragments of recovery, second of pcr amplification product is subjected to DGGE Analysis, the DNA fragmentation cut from DGGE glue is Gu bacterium 16S rDNA V3-V4 areas DNA fragmentation；
(3) the ancient bacterium 16S rDNA V3-V4 area's DNA fragmentations cut using on step (2) DGGE glue expand as template through third time PCR Increase, reclaim third time pcr amplification product；
(4) the third time pcr amplification product of step (3) is cloned into carrier T and obtains connection product；
(5) connection product obtained through step (4) is transferred to Host Strains, screens positive recombinant；
(6) the 4th PCR amplification is carried out using positive recombinant as template；
(7) the 4th pcr amplification product of step (6) is subjected to DGGE analyses again, verifies pillar location, pillar location is correct DNA fragmentation is used as the DNA fragmentation a in coal geomicrobiology Gu fungus kind DNA Marker compositions；
(8) repeat step (1) to (7), prepares the DNA fragmentation b-h in coal geomicrobiology Gu fungus kind DNA Marker compositions；
(9) combination of step (7) and (8) constitutes the DNA Marker of the ancient fungus kind of coal geomicrobiology.
3. the DNA Marker preparation methods according to claim 2 for being used to detect the ancient fungus kind of coal geomicrobiology, its It is characterised by that the template concentrations in step (6) used in the 4th PCR amplification are 16~21ng/ μ L.
4. the DNA Marker preparation methods according to claim 2 for being used to detect the ancient fungus kind of coal geomicrobiology, its It is characterised by：The DNA fragmentation cut from DGGE glue in the step (2) is soaked with 30 μ L deionized waters under the conditions of 4 DEG C Overnight, soak is taken as the template of step (3).
5. the DNA Marker preparation methods according to claim 2 for being used to detect the ancient fungus kind of coal geomicrobiology, its It is characterised by：Carrier T is Beijing Quanshijin Biotechnology Co., Ltd in the step (4)- T3 carriers.
6. the DNA Marker preparation methods according to claim 2 for being used to detect the ancient fungus kind of coal geomicrobiology, its It is characterised by：Host Strains are bacillus coli DH 5 alpha in the step (5).
7. the DNA Marker preparation methods according to claim 2 for being used to detect the ancient fungus kind of coal geomicrobiology, its It is characterised by：First time PCR amplifications and the primer used in step (3) during third time PCR amplifications are in the step (1) 0357f/0691r；The primer used in the step (2) during second of PCR amplification is 0357f-GC/0691r；The step (4) primer used in during the 4th PCR amplification is 0357f-GC/0691r-A and 0357f-GC/0691r-G.
8. the DNA Marker preparation methods according to claim 7 for being used to detect the ancient fungus kind of coal geomicrobiology, its It is characterised by：Described primer 0357f/0691r, 0357f-GC/0691r, 0357f-GC/0691r-A and 0357f-GC/0691r- G sequence is：
0357f：CCCTACGGGGCGCAGCAG；
0357f-GC：CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCCTACGGGGCGCAGCAG；
0691r：GGATTACARGATTTCAC；
0691r-A：GGATTACAAGATTTCAC；
0691r-G：GGATTACAGGATTTCAC.
9. being used for described in claim 1 detects the DNA Marker of the ancient fungus kind of coal geomicrobiology application, it is characterized in that Species DNA Marker are mixed with 6 × DNA sample-loading buffers with volume ratio 5: 1, it is ancient for coal geomicrobiology PCR-DGGE The detection of fungus kind.
CN201710349248.2A 2017-05-17 2017-05-17 DNA Marker for detecting coal geology microorganism archaea species and preparation method and application thereof Active CN107130030B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710349248.2A CN107130030B (en) 2017-05-17 2017-05-17 DNA Marker for detecting coal geology microorganism archaea species and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710349248.2A CN107130030B (en) 2017-05-17 2017-05-17 DNA Marker for detecting coal geology microorganism archaea species and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN107130030A true CN107130030A (en) 2017-09-05
CN107130030B CN107130030B (en) 2020-12-18

Family

ID=59731764

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710349248.2A Active CN107130030B (en) 2017-05-17 2017-05-17 DNA Marker for detecting coal geology microorganism archaea species and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN107130030B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112626243A (en) * 2020-12-24 2021-04-09 山西大学 Kit and method for rapidly detecting bacteria in coal geological environment
CN112646902A (en) * 2020-12-24 2021-04-13 山西大学 Kit and method for rapidly detecting archaea
CN113151410A (en) * 2020-01-22 2021-07-23 上海市园林科学规划研究院 Method for rapidly detecting total potassium content of urban green land soil by using archaea molecular marker OTU240

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010109173A1 (en) * 2009-03-23 2010-09-30 Envirogene Ltd A microbiological detection method
CN103981259A (en) * 2014-05-06 2014-08-13 山西晋城无烟煤矿业集团有限责任公司 Analysis method for diversity of microbes and abundance of species in coal seam water
CN105802957A (en) * 2016-05-30 2016-07-27 山西大学 Method for extracting microorganism total DNA from coal seam water sample
CN105907753A (en) * 2016-05-25 2016-08-31 山东出入境检验检疫局检验检疫技术中心 Burkholderia gladioli molecular standard sample and preparation method thereof
CN106222249A (en) * 2016-07-14 2016-12-14 哈尔滨工业大学（威海） The method for designing measuring the species-specific primer of known group information species in microbiologic population and the method measuring strain content
WO2016210251A1 (en) * 2015-06-25 2016-12-29 Ascus Biosciences, Inc. Methods, apparatuses, and systems for analyzing microorganism strains from complex heterogeneous communities, predicting and identifying functional relationships and interactions thereof, and selecting and synthesizing microbial ensembles based thereon

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010109173A1 (en) * 2009-03-23 2010-09-30 Envirogene Ltd A microbiological detection method
CN103981259A (en) * 2014-05-06 2014-08-13 山西晋城无烟煤矿业集团有限责任公司 Analysis method for diversity of microbes and abundance of species in coal seam water
WO2016210251A1 (en) * 2015-06-25 2016-12-29 Ascus Biosciences, Inc. Methods, apparatuses, and systems for analyzing microorganism strains from complex heterogeneous communities, predicting and identifying functional relationships and interactions thereof, and selecting and synthesizing microbial ensembles based thereon
CN105907753A (en) * 2016-05-25 2016-08-31 山东出入境检验检疫局检验检疫技术中心 Burkholderia gladioli molecular standard sample and preparation method thereof
CN105802957A (en) * 2016-05-30 2016-07-27 山西大学 Method for extracting microorganism total DNA from coal seam water sample
CN106222249A (en) * 2016-07-14 2016-12-14 哈尔滨工业大学（威海） The method for designing measuring the species-specific primer of known group information species in microbiologic population and the method measuring strain content

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHRISTOPH REITSCHULER ET AL.: "Abundances, diversity and seasonality of (nonextremophilic) Archaea in Alpine freshwaters", 《ANTONIE VAN LEEUWENHOEK》 *
TAKESHI WATANABE ET AL.: "DGGE method for analyzing 16S rDNA of methanogenic archaeal community in paddy field soil", 《FEMS MICROBIOLOGY LETTERS》 *
杨秀清等: "基于mcrA基因的沁水盆地煤层气田产甲烷菌群与途径分析", 《微生物学通报》 *
陈彦梅: "煤层微生物生产甲烷及其物种DNA Marker的制备和应用", 《中国优秀硕士学位论文全文数据库 基础科学辑》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113151410A (en) * 2020-01-22 2021-07-23 上海市园林科学规划研究院 Method for rapidly detecting total potassium content of urban green land soil by using archaea molecular marker OTU240
CN113151410B (en) * 2020-01-22 2022-10-14 上海市园林科学规划研究院 Method for rapidly detecting total potassium content of urban green land soil by using archaea molecular marker OTU240
CN112626243A (en) * 2020-12-24 2021-04-09 山西大学 Kit and method for rapidly detecting bacteria in coal geological environment
CN112646902A (en) * 2020-12-24 2021-04-13 山西大学 Kit and method for rapidly detecting archaea

Also Published As

Publication number Publication date
CN107130030B (en) 2020-12-18

Similar Documents

Publication Publication Date Title
Li et al. Molecular detection of anaerobic ammonium-oxidizing (anammox) bacteria in high-temperature petroleum reservoirs
Wang et al. Characterization of an alkane-degrading methanogenic enrichment culture from production water of an oil reservoir after 274 days of incubation
Mori et al. Aceticlastic and NaCl-requiring methanogen “Methanosaeta pelagica” sp. nov., isolated from marine tidal flat sediment
Kong et al. Diversity and expression of RubisCO genes in a perennially ice-covered Antarctic lake during the polar night transition
Dumestre et al. Changes in bacterial and archaeal assemblages in an equatorial river induced by the water eutrophication of Petit Saut dam reservoir (French Guiana)
Gao et al. An exogenous surfactant-producing Bacillus subtilis facilitates indigenous microbial enhanced oil recovery
Bao et al. Laboratory study on activating indigenous microorganisms to enhance oil recovery in Shengli Oilfield
CN104152394B (en) A kind of method orienting the functional microorganism that recovers the oil in activation crude oil
NO20111275A1 (en) Process for Improving Oil Recovery from an Oil Reservoir Using Enriched Anaerobic Stationary Microbial Consortium
Yun et al. Diversity of methanotrophs in Zoige wetland soils under both anaerobic and aerobic conditions
CN107130030A (en) DNA Marker and preparation method and application for detecting the ancient fungus kind of coal geomicrobiology
Chen et al. Methanoculleus sediminis sp. nov., a methanogen from sediments near a submarine mud volcano
Al-Bahry et al. Microbial consortia in Oman oil fields: a possible use in enhanced oil recovery
Zhang et al. Soil available phosphorus content drives the spatial distribution of archaeal communities along elevation in acidic terrace paddy soils
Fazli et al. Characteristics of methanogens and methanotrophs in rice fields: a review
Rathi et al. Evaluating the potential of indigenous methanogenic consortium for enhanced oil and gas recovery from high temperature depleted oil reservoir
WO2020011052A1 (en) Microbacterium paraoxydans and preparation method for broad-spectrum polychlorinated biphenyl enzyyme preparation thereof and use thereof
He et al. Factors associated with the diversification of the microbial communities within different natural and artificial saline environments
Wang et al. Methanogenic archaeal communities in paddy field soils in north-east China as evaluated by PCR-DGGE, sequencing and real-time PCR analyses
Han et al. PCR–DGGE Analysis on Microbial Community Structure of Rural Household Biogas Digesters in Qinghai Plateau
Cai et al. Effects of oxygen injection on oil biodegradation and biodiversity of reservoir microorganisms in Dagang oil field, China
Pereira-Mora et al. Methanogenic community linked to organic acids fermentation from root exudates are affected by rice intensification in rotational soil systems
Chang et al. Change of soil microorganism communities under saline‐sodic land degradation on the Songnen Plain in northeast China#
CN105950514A (en) Microbial oil recovery bacteria W-Y3 and application thereof
Tang et al. Ammonia-oxidizing archaea and comammox Nitrospira clade B as freeze–thaw resistant nitrifiers in wetland soils

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20231122

Address after: 034000, No. 5 Xinye 3rd Street, Douluo Building Materials Industrial Park, Douluo Town, Xinfu District, Xinzhou City, Shanxi Province

Patentee after: Shanxi Hengrui Resource Recycling Technology Co.,Ltd.

Address before: 030006, No. 92, Hollywood Road, Xiaodian District, Shanxi, Taiyuan

Patentee before: SHANXI University

TR01 Transfer of patent right