CN107130000A

CN107130000A - It is a kind of while knocking out KRAS genes and the CRISPR Cas9 systems of EGFR gene and its application

Info

Publication number: CN107130000A
Application number: CN201710332598.8A
Authority: CN
Inventors: 陈锦阳; 邓兆群
Original assignee: Zhejiang Wei Wei Biological Medicine Technology Co Ltd
Current assignee: Zhejiang Wei Wei Biological Medicine Technology Co Ltd
Priority date: 2017-05-12
Filing date: 2017-05-12
Publication date: 2017-09-05
Anticipated expiration: 2037-05-12
Also published as: CN107130000B

Abstract

The present invention discloses a kind of while knocking out the CRISPR Cas9 systems of KRAS genes and EGFR gene, include the sgRNA of selectively targeted KRAS genes, corresponding DNA sequence dna is as shown in SEQ ID NO.1 or/and SEQ ID NO.2, with the sgRNA of selectively targeted EGFR gene, corresponding DNA sequence dna is as shown in SEQ ID NO.11 or/and SEQ ID NO.12.The invention also discloses its application in treating cancer medicine is prepared.CRISPR Cas9 systems of the present invention can efficiently knock out two cancers driven factor KRAS and EGFR that the altimeter in lung cancer reaches simultaneously, and the system operatio is simple, knocks out efficiency high, is expected to be applied in the treatment of lung cancer.Present system is applied to the kinds cancer of EGFR and KRAS unconventionality expressions.

Description

It is a kind of at the same knock out KRAS genes and EGFR gene CRISPR-Cas9 systems and its Using

Technical field

The present invention relates to gene engineering technology field, and in particular to a kind of while knocking out KRAS genes and EGFR gene CRISPR-Cas9 systems and its application.

Background technology

Lung cancer is current morbidity and mortality highest malignant tumour, the morbidity and mortality of global lung cancer in the world It is in rising trend.In China, as commercial speeds are accelerated, environmental pollution is serious and aging population aggravates, the cancer of lung cancer Disease burden is increasingly aggravated.Lung cancer can be divided into according to Histopathology by two major classes：Non-small cell lung cancer (NSCLC, 85%) and small Cell lung cancer (SCLC, 15%), it is treated still as one of task of medical profession most challenge.

Tumour cell continued propagation in the presence of driving gene, and it is extremely sensitive to the suppression for driving gene, wherein KRAS and EGFR are mutation driving genes common in lung cancer.

It has been found that 1/3rd NSCLC and KRAS gene mutation are directly related, therefore be for the targeted therapy of KRAS The focus of lung cancer research in recent years.KRAS genes belong to a member in RAS gene families, and encoding proteins P21 is in the nature a single aggressiveness G-protein, on the inside of cell membrane, cell growth, differentiation are adjusted by being combined with GTP/GDP.P21 and GDP under normal condition With reference to remaining static, when by factors stimulated growth, p21 is activated as GTP bonding states, and signal system is opened, together When the GTP enzymatic activitys that have of p21 GTP hydrolysis is turned into GDP, p21 is inactivated after being combined again with GDP, and signal system is closed.Normally KRAS genes can suppress tumour growth, and the KRAS albumen p21 of mutation only has faint GTP activity, it is impossible to decompose GTP rapidly, because The state of activation that this RAS signal conductive protein " lock is close " is combined in GTP, makes cell obtain the stimulation of continued propagation signal, raises Albumen needed for receptor signal is propagated, transmits extracellular signal, influences the processes such as propagation, survival and the differentiation of cell, lasting to stimulate Cell growth, upsets growth rhythm, so as to cause tumour.

EGF-R ELISA (EGFR) gene is located at No. 7 chromosome p13~q22 area, is made up of 28 extrons, Encode 1186 amino acid.The gene code is a kind of protein receptor of cross-film, is one of EGFR family members.EGFR is mutated There is significant difference in different ethnic groups in rate.Mutantional hotspot is most of to concentrate on mainly in the code area of its EGFR-TK 18~21 extrons, most common mutation is positioned at the deletion mutation (account for EGFR mutation 44%) of 19 extrons and positioned at 21 The L858R point mutation (account for EGFR mutation 41%) of extron.

EGF (EGF) is external most strong rush epidermal cell splitting factor, can be secreted with some cells Transforming factor (TGFA) competitive binding EGFR, then activated receptor LCK, the latter makes many in itself and endochylema Protein substrate phosphorylation is planted, information is reached in nucleus, promotes the synthesis of protein and enzyme by triggering a series of signal transmission And the division growth of cell.Many tumours of the mankind all detect EGFR expression, and promote to swell by autocrine, paracrine action Knurl grows, and EGFR expression quantity shows that it has important work in the generation, development of lung cancer apparently higher than normal structure in lung cancer With.

In recent years, genome edit tool is widely used in biomedical sector, and the short palindrome of the regular intervals of cluster Repetitive sequence (CRISPR) technology turns into the focus of genome editor.CRISPR is naturally occurring the sequence in DNA of bacteria, Combined with CRISPR associated nucleic acids enzyme (Cas), bacterial genomes are protected from being detected in invasive bacteriophage with guide RNA s The effect for the targeting specific sequence attack arrived.CRISPR/Cas9 technologies are chosen as 2013 respectively by Nature, Science magazine One of star's technology in first 10 of year, and occupy first of ten great discoveries that Scientific Magazine in 2015 is chosen.This technology will As strong research tool in functional genomics and system biology field.

CRISPR/Cas9 is a kind of DNA restriction endonucleases of RNA mediations, passes through a single guiding RNA complementary with target sequence (singleguide RNA, sgRNA) guiding is navigated on the target sequence of genome, and this target sequence must be with one with NGG Or the PAM sequences of NAG forms are adjacent.CRISPR/Cas9 produces double-strand after being combined with target sequence in specific gene group region Fracture.So as to activate NHEJ (non-homologous end joining, Non-homologous end joining) DNA mutation reparation of body Mechanism.Due to no template under the repair mechanism, therefore DNA is to repair at random to recover its duplex structure, and this will certainly Cause to repair result and protogene group sequence is differently formed mutation-gene knockout.

CRISPR-Cas9 has mutation rate high, simple to operate, the characteristics of cost is low.Gene work based on CRISPR-Cas9 Journey is operated, and the directed modification to disease key gene can be achieved, to realize the purpose for slowing down or curing disease.

The treatment method of current lung cancer mainly has：Operative treatment, radiotherapy, chemotherapy and molecular targeted therapy.Chemotherapy is one The treatment method of suitable wide spectrum, but the constitution to patient is required, constitution is relatively poor or has being of patient of complication The taboo for the treatment of, and chemotherapy has certain side effect.The appearance of molecular targeted therapy in recent years be to this point than larger breakthrough, Some molecular targeted agents achieve effect on the clinical treatment of lung cancer, but targeted therapy is different from chemotherapy, there is a spy Fixed benefit crowd.With oncomolecularbiology, the development of the subject such as tumor immunology so that examined for the gene of tumour Disconnected, targeted therapy is increasingly becoming possibility, gene therapy as a kind of good novel clinical treatment method of high specificity, targeting, Increasingly paid attention to by vast lung cancer doctor scholar.

For the targeted inhibition of gene, at present conventional siRNA can effectively inhibition of gene expression, but siRNA makes It is low with the delivery efficiency with medicine, to be administered continuously, can not thoroughly effect a radical cure, and prodrug complex is used, it is not suitable for extensive Promote.ZFNs and TALEN technological expressions are complicated, and CRISPR-Cas9 have more rapidly, easy, efficient, many sites, spy The advantage of different in nature targeting knock out gene.Have no at present while knocking out the CRISPR-Cas9 systems of KRAS genes and EGFR gene Report.

The content of the invention

It is an object of the invention to provide it is a kind of and meanwhile knock out KRAS genes and EGFR gene CRISPR-Cas9 systems and its Using to solve the deficiencies in the prior art.

The present invention uses following technical scheme：

It is a kind of while knock out the CRISPR-Cas9 systems of KRAS genes and EGFR gene, including selectively targeted KRAS bases The sgRNA of cause and selectively targeted EGFR gene sgRNA；The corresponding DNA sequence dnas of sgRNA of selectively targeted KRAS genes are such as Shown in SEQ ID NO.1 or/and SEQ ID NO.2, the corresponding DNA sequence dnas of the sgRNA such as SEQ of selectively targeted EGFR gene Shown in ID NO.11 or/and SEQ ID NO.12.

Further, the CRISPR-Cas9 systems also include Cas9.

Further, the sgRNA and Cas9 of the sgRNA or selectively targeted EGFR genes of selectively targeted KRAS genes are deposited In same plasmid or it is respectively present in plasmid.

Further, the CRISPR-Cas9 systems also include 2 kinds the Cas9 bones with different resistance markers and fluorescence labeling Frame carrier.

Further, the Cas9 skeleton carriers are the Cas9 skeleton carriers for having U6 promoters to express.

It is above-mentioned while the CRISPR-Cas9 systems for knocking out KRAS genes and EGFR gene are preparing KRAS genes and EGFR bases Application in cell model or animal model that cause is knocked out simultaneously.

It is above-mentioned while knocking out the CRISPR-Cas9 systems of KRAS genes and EGFR gene in treating cancer medicine is prepared Using.

Further, the cancer includes lung cancer, liver cancer or cancer of pancreas.

Beneficial effects of the present invention：

1st, CRISPR-Cas9 systems of the present invention can efficiently knock out simultaneously two cancers driving that the altimeter in lung cancer reaches because Sub- KRAS and EGFR, the system operatio are simple, knock out efficiency high, are expected to be applied in the treatment of lung cancer.EGFR and KRAS It is all genes of unconventionality expression, and participate in the occurrence and development of tumour in the kinds cancers such as lung cancer, liver cancer and cancer of pancreas, this Invention system is applied to the kinds cancer of EGFR and KRAS unconventionality expressions.

2nd, the present invention is transformed by plasmid, is carried respectively from 2 cas9 skeletons with different resistance markers and fluorescence labeling Body, dual-gene knockout simultaneously is realized by cotransformation mode, and accelerated gene knocks out the process of research.

3rd, CRISPR-Cas9 system operatios are simple, and target position point selection is more, and targeting is accurate, and miss rate is low, the effect of knockout Rate is up to more than 90%.The present invention selects CRISPR-Cas9 systems, compared to more traditional targeting system, easy to operate and effect of practicing shooting Rate is high.

Brief description of the drawings

Fig. 1：Position of the CRISPR-Cas9 target sequences in KRAS genes.

Fig. 2：Position of the CRISPR-Cas9 target sequences in EGFR gene.

Fig. 3：T7EN1 restriction enzyme digestion and electrophoresis figures

Wherein, No. 1 swimming lane and No. 3 swimming lanes are untreated fish group DNA；No. 2 swimming lanes and No. 4 swimming lanes are treatment group DNA；M is represented Marker, band is respectively 600bp, 500bp, 400bp, 300bp, 200bp, 100bp from top to bottom.

Fig. 4：KRAS albumen relative expression quantities.

Fig. 5：EGFR albumen relative expression quantities.

Embodiment

The present invention is done with reference to embodiment and accompanying drawing and further explained.The following example is merely to illustrate this hair It is bright, but it is not used to limit the practical range of the present invention.

Embodiment 1

1.sgRNA is designed

According to people KRAS gene orders (the Sequence ID provided in GeneBank:) and EGFR gene NM_033360.3 Sequence (Sequence ID:NM_201282.1) separately designing 10 sgRNA, (corresponding DNA sequence dna is respectively such as SEQ ID Shown in NO.1-10 and shown in SEQ ID NO.11-20).The sgRNA of two genes is targeted on its exon region, It is compared in UCSC or NCBI with blast, it is ensured that the uniqueness of its target sequence.In 10 sgRNA separately designed, only 2 Bar can effectively knock out KRAS and EGFR, choose first kras-sg1 (corresponding DNA sequence dna is as shown in SEQ ID NO.1) and Egfr-sg1 (corresponding DNA sequence dna is as shown in SEQ ID NO.11) is explained in detail, as depicted in figs. 1 and 2.

2. build sgRNA double strand oligonucleotide

CACC, the ＇ ends of anti-sense primer 5 addition AAAC are added into the ＇ ends of KRAS target sequences sense primer 5 of determination, so annealed The double-stranded DNA cohesive end formed afterwards and the cohesive end that pX458-neo-GFP skeleton carriers are formed after Bbs I digestions are mutual Mend, be easy to the structure of later stage carrier to connect.Carrier pX458-neo-GFP has neomycin resistance and GFP fluorescence labelings.It is worth note Meaning, the first bit base of target sequence need to be G, be easy to U6 Promoter Recognitions on carrier.

Forwarc oigo→5′-CACCNNNNNNNNNNNNNNNNNNNN-3′

3′-NNNNNNNNNNNNNNNNNNNNNCAAA-5′←Reverse oligo

CACCG, the ＇ ends of anti-sense primer 5 addition AAAC, 3 ' ends plus C are added into the ＇ ends of EGFR target sequences sense primer 5 of determination, The double-stranded DNA cohesive end formed after so annealing and gluing that pX260-puro-RFP skeleton carriers are formed after Bbs I digestions Property termini-complementary, is easy to the structure of later stage carrier to connect.Carrier pX260-puro-RFP has puromycin-resistant and RFP fluorescence Mark.It is worth noting that, the first bit base of target sequence need to be G, it is easy to U6 Promoter Recognitions on carrier.

Forward oligo→5′-CACCGNNNNNNNNNNNNNNNNNNNN-3′

3′-CNNNNNNNNNNNNNNNNNNNNNCAAA-5′←Reverse oligo

Forward oligo and the Reverse oligo of the sgRNA oligonucleotides of synthesis are denatured in pairs, annealed, is moved back The double-strand of U6 carrier for expression of eukaryon can be connected into by being formed after fire.The upstream and downstream primer of synthesis is molten with 1 × Anneal buffer Solution, it is 100 μM to make its concentration, takes 2.5 μ l upstream and downstream primer to mix respectively, 1 μ l NEB buffer of addition, 4 μ l sterilized waters, Annealed according to following touchdown programs, form it into double-stranded DNA, be placed in -20 DEG C and save backup.

Cycle of annealing：

3.CRISPR vector constructions

Digestion is carried out to carrier with restriction enzyme Bbs I, system is as shown in table 1：

Table 1

In the PCR pipe for being sequentially added into 200 μ L, after 37 DEG C of constant temperature 6h, returned with concentration for 0.8% agarose gel electrophoresis Receive purpose carrier segments.

The double-strand target site oligonucleotides that the linearization plasmid of above-mentioned purifying is formed with annealing reconnects to form special Property targeting vector pX458-neo-GFP-Kras-sg1 and pX260-puro-RFP-egfr-sg1.Linked system is as follows：Double-strand is few The μ L of 1 μ L, T4 ligase of nucleotides 0.2pmol, linearization plasmid 20ng, 10 × T4 ligase buffer solution 1, add water to 10 μ L, 22 DEG C connection 1.5 hours.

Enzyme connect product thing is transformed into 100 μ L DH5 α competent cells, corresponding resistant antibiotic flat board, 37 DEG C of trainings is coated with Support overnight.Picking single bacterium colony is with general U6 primers sequence verification positive colony.

U6：ATGGACTATCATATGCTTACCGTA

37 DEG C of picking positive colony shakes bacterium overnight incubation, extracts plasmid pX458-neo-GFP-Kras- respectively with kit Sg1 and pX260-puro-RFP-egfr-sg1.

4. plasmid transfection lung carcinoma cell

A549 cells are inoculated with 6 orifice plates, it is 70% to treat cell density, according to Lipofectamine TM2000Transfection Reagent (Invitrogen, 11668-019) operation manual, the μ g pX458- of cotransfection 3 Change liquid after neo-GFP-Kras-sg1 and 3 μ g pX260-puro-RFP-egfr-sg1 recombinant plasmids, 6.5h, add neomycin and After puromycin screening and culturing 48h, survivaling cell is collected.

5. screening knocks out KRAS genes and the A549 stable cell lines of EGFR gene simultaneously.

Flow cytometer is screened：

Survivaling cell is subjected to sterile airflow classification, the cell of fluoresced green and red fluorescence simultaneously is filtered out, and received Collection.

In the present embodiment, carrier used could alternatively be the cas9 skeleton carriers of U6 promoters expression, such as PX330 Deng；Neomycin used, puromycin can be replaced other antibiotic in addition to ammonia benzyl mycin；And GFP and RFP can be replaced Other different fluorescence.

Embodiment 2

T7EN1 digestions are tested：

The cell that embodiment 1 is collected is cracked, and is extracted genomic DNA with kit, is finally dissolved in 50 μ L deionizations In water.

It is special with the Software for Design of Primer 5.0 according to the GenBank KRAS gene orders announced and EGFR gene sequence Property primer, as shown in table 2：

Table 2

Part cell genomic dna is extracted with kit, using the cell genomic dna of said extracted as template, table 2 is utilized The primer amplified purpose fragment of middle design.Amplification system：The μ L of 2 × PCR Mix 10, the μ L of genomic DNA 1, upstream and downstream Each 1 μ L of primer, plus dd H₂O to 20 μ L.Response procedures：94 DEG C of pre-degenerations 5 minutes；94 DEG C are denatured 30 seconds, and 60 DEG C are annealed 30 seconds, 72 DEG C extend 35 seconds, totally 30 circulations；72 DEG C extend 10 minutes；4 DEG C of preservations.

Take the PCR primers of 100ng to be after purification denatured in NEB Buffer 2, after renaturation, with T7 endonucleases (NEB, M0302L) 37 DEG C of incubation 40min, are then separated with 2% agarose gel electrophoresis.T7 endonucleases can be recognized not exclusively The double-stranded DNA of pairing is simultaneously cut, if CRISPR-Cas9 causes mutation to target spot, is possible to be recognized and made by the enzyme Into double-strand DNA cleavage.Therefore, show that other bands in addition to PCR illustrate that target spot DNA has mutation after electrophoresis.Such as Fig. 3 institutes Show, treatment group occurs in that 2 new bands after digestion, illustrate that treatment group introduces mutation really.Above-mentioned steps are obtained PCR purifying recovery product carry out TA clones, step：1ul products are taken to be connected simultaneously transformed competence colibacillus with pMD19-T vector thin Born of the same parents DH5 α, picking monoclonal is sequenced with universal primer U6 sequences atggactatcatatgcttaccgta, it is ensured that obtain stable strike Except KRAS and EGFR A549 mutant strains.

Embodiment 3

Immunoblot experiment：

Cell before and after lung carcinoma cell KRAS and EGFR are knocked out respectively takes 1x10⁶20 μ L lysates are added after cell, collection (50mM HEPES, PH7.0,1%NP-40,5mM EDTA, 450mM Nacl, 10mM Na pyrophosphate and 50mM NaF), various Fresh inhibitors (1mM Na orthovanadate, 1mM PMSF, 10 μ g/ml are added in lysate Aprotinin, Leupeptin, pepstatin).Ultrasonically treated rear add in 1% mercaptoethanol, 100 DEG C places 5min at room temperature It is denatured by boiling, in SDS-PAGE glue, per the μ L of hole loading 10.Protein sample is transferred to nitrocellulose filter by transferring film after electrophoresis On.Transferring film washes film with TBST once after terminating, and is closed 1 hour with 5% skimmed milk power, film is washed with TBST once, after dilution Primary antibody hybridizes 2 hours or 4 DEG C overnight with film room temperature.Wash after three times that the secondary antibody after dilution and the hybridization 1 of film room temperature is small with TTBS When, film is washed with TBST 3 times, the colour developing of ECL developing agents is added, with albumen gray analysis software analysis result.

Fig. 4 and Fig. 5 quantitative analysis results are shown, compared with untreated fish group, and treatment group KRAS protein versus expression quantity is 0.107 ± 0.025, EGFR protein versus expression quantity are 0.081 ± 0.023, represent that EGFR and KRAS protein expressions are all had Inhibit to effect.

Embodiment 4

Proliferation experiment：

Cell before and after lung carcinoma cell KRAS and EGFR are knocked out is inoculated in 96 orifice plates respectively, separately sets only nutrient solution Blank group, every group sets 6 repetitions.Cultivate and add 20 μ L MTT solution after 24h, 48h, 72h per hole, 37 DEG C of incubation 2h, ELIASA It is upper to read per hole 460nm absorbances, and calculate inhibitory rate of cell growth.Data withRepresent, counted using SPSS16.0 Software carries out statistical analysis, and both compare is examined using T, and P ＜ 0.05 are that difference has statistical significance.As a result it is as shown in table 3：

Table 3

Note：* compared with A549-con, P ＜ 0.05

Mtt assay determines cell proliferation experiment result and shown：Individually suppress KRAS expression (A549-KRAS groups) or individually suppression The expression of EGFR (A549-EGFR groups) processed, the propagation of cell can be all suppressed；KRAS and EGFR is by (A549- after silence simultaneously Double groups), A549 cell propagation is substantially suppressed.

SEQUENCE LISTING

<110>Zhejiang Wei Wei biological medicines Science and Technology Ltd.

<120>It is a kind of while knocking out KRAS genes and the CRISPR-Cas9 systems of EGFR gene and its application

<130>

<160> 20

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213>Artificial sequence

<400> 1

ggactctgaa gatgtaccta 20

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence

<400> 2

ggaggatgct ttttatacat 20

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence

<400> 3

caggacttag caagaagtta 20

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence

<400> 4

agtagacaca aaacaggctc 20

<210> 5

<211> 20

<212> DNA

<213>Artificial sequence

<400> 5

gatgtaccta tggtcctagt 20

<210> 6

<211> 20

<212> DNA

<213>Artificial sequence

<400> 6

tagaacagta gacacaaaac 20

<210> 7

<211> 20

<212> DNA

<213>Artificial sequence

<400> 7

atgcttttta tacattggtg 20

<210> 8

<211> 20

<212> DNA

<213>Artificial sequence

<400> 8

tttttaattt tcacacagcc 20

<210> 9

<211> 20

<212> DNA

<213>Artificial sequence

<400> 9

ttatttccta ctaggaccat 20

<210> 10

<211> 20

<212> DNA

<213>Artificial sequence

<400> 10

tttgctgatg tttcaataaa 20

<210> 11

<211> 20

<212> DNA

<213>Artificial sequence

<400> 11

tgaaccgcac ggcgccatgc 20

<210> 12

<211> 20

<212> DNA

<213>Artificial sequence

<400> 12

gaattcgctc cactgtgttg 20

<210> 13

<211> 20

<212> DNA

<213>Artificial sequence

<400> 13

tgcaaataaa accggactga 20

<210> 14

<211> 20

<212> DNA

<213>Artificial sequence

<400> 14

cacagtggag cgaattcctt 20

<210> 15

<211> 20

<212> DNA

<213>Artificial sequence

<400> 15

aattcgctcc actgtgttga 20

<210> 16

<211> 20

<212> DNA

<213>Artificial sequence

<400> 16

tgaaccgcac ggcgccatgc 20

<210> 17

<211> 20

<212> DNA

<213>Artificial sequence

<400> 17

tgctgactat gtcccgccac 20

<210> 18

<211> 20

<212> DNA

<213>Artificial sequence

<400> 18

ggatgctctc cacgttgcac 20

<210> 19

<211> 20

<212> DNA

<213>Artificial sequence

<400> 19

agggttgttg ctgaaccgca 20

<210> 20

<211> 20

<212> DNA

<213>Artificial sequence

<400> 20

ctttctcagc aacatgtcga 20

Claims

1. it is a kind of while knocking out the CRISPR-Cas9 systems of KRAS genes and EGFR gene, it is characterised in that including specific target To the sgRNA and the sgRNA of selectively targeted EGFR gene of KRAS genes；The sgRNA of selectively targeted KRAS genes is corresponding DNA sequence dna is as shown in SEQ ID NO.1 or/and SEQ ID NO.2, the corresponding DNA sequences of sgRNA of selectively targeted EGFR gene Row are as shown in SEQ ID NO.11 or/and SEQ ID NO.12.

2. according to claim 1 while knocking out the CRISPR-Cas9 systems of KRAS genes and EGFR gene, its feature exists In the CRISPR-Cas9 systems also include Cas9.

3. according to claim 2 while knocking out the CRISPR-Cas9 systems of KRAS genes and EGFR gene, its feature exists Exist in same plasmid in the sgRNA and Cas9 of, sgRNA or selectively targeted EGFR genes of selectively targeted KRAS genes or It is respectively present in plasmid.

4. according to claim 1 while knocking out the CRISPR-Cas9 systems of KRAS genes and EGFR gene, its feature exists Also include 2 kinds the Cas9 skeleton carriers with different resistance markers and fluorescence labeling in, CRISPR-Cas9 systems.

5. according to claim 4 while knocking out the CRISPR-Cas9 systems of KRAS genes and EGFR gene, its feature exists In the Cas9 skeleton carriers are the Cas9 skeleton carriers for having U6 promoters to express.

6. the CRISPR-Cas9 systems of KRAS genes and EGFR gene are knocked out while described in claim 1-5 any claims The application united in cell model or animal model that KRAS genes and EGFR gene are knocked out is prepared simultaneously.

7. the CRISPR-Cas9 systems of KRAS genes and EGFR gene are knocked out while described in claim 1-5 any claims The application united in treating cancer medicine is prepared.

8. application according to claim 7, it is characterised in that the cancer includes lung cancer, liver cancer or cancer of pancreas.