CN107119027A

CN107119027A - A kind of corn II types diacylglycerol acyltransferase and the gene for encoding corn II types DGAT

Info

Publication number: CN107119027A
Application number: CN201710531269.6A
Authority: CN
Inventors: 李佐同; 闫博巍; 徐晶宇; 贺琳; 赵长江
Original assignee: Heilongjiang Bayi Agricultural University
Current assignee: Heilongjiang Bayi Agricultural University
Priority date: 2017-06-30
Filing date: 2017-06-30
Publication date: 2017-09-01

Abstract

A kind of corn II types diacylglycerol acyltransferase and the gene for encoding corn II types DGAT, it is related to a kind of corn diacylglycerol acyltransferase and encodes the gene of the corn diacylglycerol acyltransferase.The invention provides a kind of corn II types diacylglycerol acyltransferase and encode corn II types DGAT gene.Corn II type diacylglycerol acyltransferases of the present invention are named as ZmDGAT2.1, ZmDGAT2.1 amino acid sequence such as SEQ ID NO：Shown in 2.Encode the gene nucleotide series such as SEQ ID NO of above-mentioned corn II type diacylglycerol acyltransferases：Shown in 1 nucleotide sequence.

Description

A kind of corn II types diacylglycerol acyltransferase and encode corn II types DGAT Gene

Technical field

The present invention relates to a kind of corn diacylglycerol acyltransferase and encode the corn diacylglycerol acyl group transfer The gene of enzyme.

Background technology

Triacylglycerol (TriacylglycerolTriacylglycerol, TAG) is by nonpolar glycerine and aliphatic acid group Into, be the chief component of vegetable fat, be the major storage form of plant energy i (in vivo), while also assist in many physiology Biochemical process.Triacylglycerol is used as carbon source and the main provider of nutriment during plant germination and growth of seedling. Research in various plants shows, the triacylglycerol TAG not only energy for needed for being sprouted seed and growth of seedling is provided, and is sent out in pollen Educate and also played an important role in sexual reproduction.

Edible oil and fat and chemical industry among mankind's daily life with oil to be stored among oil crop seeds Oils be main source.About 75% is used as edible oil used in our daily lifes among global vegetable fat Fat, and vegetable fat includes most monounsaturated fatty acids, and such as oleic acid can be higher than the nutritive value of saturated fatty acid Some.The correlative study of nutrition and epidemiology shows that the edible edible oil rich in unrighted acid of people for a long time can Increase the ratio of blood high-density lipoprotein and low-density lipoprotein, so as to play cholesterol in reduction blood of human body, reduce dynamic The effect of the generation of arteries and veins hardening.Outside the edibility of vegetable fat, vegetable fat is used as potential reproducible bioenergy Product, application prospect is extremely extensive.The important source material of vegetable oil or many chemical products, many aliphatic acid such as bays Acid, ringdove chrysanthemum, erucic acid has application widely among industrial production, according to statistics, is applied to chemical industry life every year in the world Plant oil mass among production and pharmaceutical industries is very huge；Account for the 1/3 of vegetable fat total output.Along with holding for world population Continuous increase develops rapidly with economic, people is improved constantly the demand of vegetable fat, this also promotes people continuous The effective ways and easily approach of oil crops oil production can be increased by finding.

Corn is one of most important cereal crops in the whole world, and its quality and yield has extremely to world food industry development Close important influence.High oil corn is compared with conventional corn, with many superiority.It is higher due to containing among corn oil The compositions such as the unrighted acid and vitamin of ratio, make it have softening blood vessel and reduce blood pressure wait act on；High oil corn Content, lysine content and the carotenoid of protein are a kind of ideal oil for health care containing also unusual height. The nutrition improvement of particular components and composition not only to the mankind and the animal of simple stomach among corn oil has great importance, simultaneously Also it played an important role in terms of the raising of poultry animal.Its higher nutritional ingredient and important function make high oil corn from Simple grain or forage crop are gradually transformed into for dual-purpose crop.At the same time, corn also has very high productive potentialities, often The yield of the high oil corn of hectare is likely to the oil production more than most oil crops, at the same time, among high oil corn, its Product in addition to oil, either quantity or quality are likely to be more than other most cereal crops.In China market The corn oil of central sale, most of is all that, from external import, its fancy price causes corn oil to be located in market competition In inferior position.

The content of the invention

Triacylglycerol TAG assembling was found to find first by Kennedy in 1961, therefore was referred to as Kennedy Approach.Among the seed of development, triacylglycerol TAG exists in the form of 3 aliphatic acid are attached on glycerol backbone.In Kenny Among enlightening approach, the order in sn-1, sn-2 and sn-3 site of glycerine sequentially adds acyl CoA and ultimately forms triacylglycerol TAG：First, sn- glycerol-3-phosphates are acylated by glycerol-3-phosphate acyltransferase (GPAT), are then turned by phosphatidic acid acyl Move enzyme (LPAAT) catalysis and produce phosphatidic acid (PA), phosphatidic acid generates sn- by phosphatidic acid phosphatase (PAP) dephosphorylation again 1,2- diglyceride (DAG), is finally acylated by diacylglycerol acyltransferase (DGAT) and forms TAG.Triacylglycerol is biological Synthesis is mainly carried out on the net in endoplasm, is the catalytic reaction of film combination class；The Diacrylglycerol acyl transferase of dgat gene coding As a unique rate-limiting enzyme among Kennedy's approach；The final step for controlling triacylglycerol to synthesize.Therefore the gene pairs The economic benefit of raising oil crops plays the role of important.In order to improve the corn oil yield of China, improve the market of corn oil Competitiveness, the invention provides a kind of corn II types diacylglycerol acyltransferase and encodes corn II types DGAT base Cause.

Corn II type diacylglycerol acyltransferases of the present invention are named as ZmDGAT2.1, ZmDGAT2.1 amino acid sequence Row such as SEQ ID NO：Shown in 2.

Encode the gene nucleotide series such as SEQ ID NO of above-mentioned corn II type diacylglycerol acyltransferases：1 center Shown in nucleotide sequence.

It is the invention provides a kind of corn II types diacylglycerol acyltransferase (ZmDGAT2.1) and its DNA fragmentation Regulate and control the generation of corn grease, improve corn grease yield and quality has established material base.The present invention helps to disclose corn Effect of the dgat gene during corn growth and response abiotic stress, understands the work(of corn dgat gene in depth Can, provide new genetic resources and theoretical foundation for corn molecular breeding.

Brief description of the drawings

Fig. 1 is that ZmDGAT2.1 genes are expressed in different time points blade during the low-temperature treatment of embodiment one is tested The real-time fluorescence quantitative PCR test chart of analysis.

Fig. 2 is that ZmDGAT2.1 genes are expressed in different time points root system during the low-temperature treatment of embodiment one is tested The real-time fluorescence quantitative PCR test chart of analysis.

Fig. 3 is that ZmDGAT2.1 genes are expressed in different time points blade during the NaCl of embodiment one processing is tested The real-time fluorescence quantitative PCR test chart of analysis.

Fig. 4 is that ZmDGAT2.1 genes are expressed in different time points root system during the NaCl of embodiment one processing is tested The real-time fluorescence quantitative PCR test chart of analysis.

Fig. 5 is the NaHCO of embodiment one₃ZmDGAT2.1 genes table in different time points blade in processing experiment Up to the real-time fluorescence quantitative PCR test chart of analysis.

Fig. 6 is the NaHCO of embodiment one₃ZmDGAT2.1 genes table in different time points root system in processing experiment Up to the real-time fluorescence quantitative PCR test chart of analysis.

Fig. 7 be the ABA of embodiment one processing experiment in ZmDGAT2.1 genes express in different time points blade divide The real-time fluorescence quantitative PCR test chart of analysis.

Fig. 8 be the ABA of embodiment one processing experiment in ZmDGAT2.1 genes express in different time points root system divide The real-time fluorescence quantitative PCR test chart of analysis.

Fig. 9 be the PEG of embodiment one processing experiment in ZmDGAT2.1 genes express in different time points blade divide The real-time fluorescence quantitative PCR test chart of analysis.

Figure 10 is that ZmDGAT2.1 genes are expressed in different time points root system during the PEG of embodiment one processing is tested The real-time fluorescence quantitative PCR test chart of analysis.

Figure 11 is qRT-PCR analysis result figure of the ZmDGAT2.1 genes of embodiment one in different corn tissues.

Figure 12 is the corn ZmDGAT2.1 gene zymetology contractile studies figures of embodiment one.

Embodiment

Embodiment one：Corn II type diacylglycerol acyltransferases are named as ZmDGAT2.1, ZmDGAT2.1 Amino acid sequence such as SEQ ID NO：Shown in 2.Encode ZmDGAT2.1 gene nucleotide series such as SEQ ID NO：1 center Shown in nucleotide sequence.

Present embodiment ZmDGAT2.1 total lengths are made up of 1314bp, containing 437 amino acid, and size is 48.6kDa, etc. Electricity point is 10.6.

The secondary structure of ZmDGAT albumen is alpha-helix (Alpha helix), extended chain comprising 4 kinds of conformations (Extended strand), beta sheet (Beta turn) and random coil (Random coil), and this 4 kinds of conformations run through Whole amino acid chain.ZmDGAT2.1 alpha-helix includes 92 amino acid, accounts for 25.63%；Extended chain contains 92 amino Acid, accounts for 21.05%；Beta sheet contains 48 amino acid, accounts for 10.98%；Random coil contains 185 amino acid, accounts for 42.23%.

The promoter region of ZmDGAT2.1 genes includes LTR and MYB binding members；ZmDGAT2.1 includes 4 cross-film knots Structure domain.

Present embodiment extracts the total serum IgE at corn tissue position, specific step using TRIZOL (Invitrogen companies) method It is rapid as follows：

A. by the corn tissue after mortar and 105 DEG C of high temperature 2h, half an hour in -20 DEG C is put into, 1mL is added into centrifuge tube TRIZOL RNA extract solutions, take the corn tissue after rapid three grindings of about 100mg liquid nitrogen frozens to add in centrifuge tube, overturn Mix；30min in -80 DEG C of refrigerator is placed in, so that the RNA at corn tissue position fully cracks release.

B. lysate is taken out, is placed in after melting on ice to it, added 200 μ L chloroform, fully mix, stand 15min, 12000r/min, 4 DEG C of centrifugation 15min；Take the μ L of supernatant about 300 to move into new centrifuge tube, then add isometric isopropanol, Concussion is placed in 2h in -20 DEG C of refrigerators after mixing, after taking-up, 4 DEG C of centrifugation 15min of 12000r/min；

C. slowly outwell liquid evacuation after isopropanol, 4 DEG C of centrifugation 15min of 12000r/min, it is seen that ttom of pipe has a small amount of glue Shape precipitation is produced；1mL 70% ethanol solution (contain DEPC) washing RNA precipitate is added in precipitation, by RNA precipitate gently bullet Rise, fully mix；

D.1200rpm 4 DEG C of centrifugation 10min, outwell the ethanol solution in centrifuge tube, centrifuge tube are placed in into workbench room temperature Dry in the air several minutes, until ethanol volatilizees completely in pipe；

E. RNA is dissolved with 50 μ l 1%DEPC, and with micro-spectrophotometer detection detection RNA concentration, utilizes gel electricity Swimming detection RNA mass.

Reverse transcription：Carried out with reference to the reagent specification of Invitrogen companies.The cDNA reference genes that reverse transcription is obtained 18S rRNA carry out amplification and verify its quality, and internal control primer sequence is：18S-F：AGTTTGAGGCAATAACAGGTCT；18S-R： GATGAAATTTCCCAAGATTACC。

Full length gene PCR is expanded：Enter performing PCR amplification by template of maize root system cDNA, and enhancer is inserted in C-terminal.

PCR sense primers F1：5’-AGAATGGGGCTGGCAGTGGCGG-3’；Anti-sense primer R1：5’- TCAAAGAACTCTTAACTGAAGATCAGGG-3’。

PCR reaction systems：

10×PCR buffer	2μL
		2mM DNTPs	2μL
25mM MgCl₂	1.6μL
		Template	1μL
Primer F	1μL
		Primer R	1μL
KOD-plus	0.4μL
		PCR-Grade Water	11μL

PCR response procedures：94 DEG C of 2min of pre-degeneration；35 circulations：94 DEG C, 15s, 55 DEG C, 30s, 68 DEG C, 2min.

Using full length gene cloning process, with the system and reaction condition of same solution ratio, expand reaction system, enter Performing PCR product is enriched with, and present embodiment is used carries out product purchased from the glue reclaim kit (DP210) of Tiangeng biotech company Enrichment.Then it is sequenced, obtains nucleotide sequence such as SEQ ID NO：Shown in 1.

Expression vector establishment

Because the product that KOD high-fidelity enzyme clones go out total length is flat end, connection carrier T and Yeast expression carrier (pYES2.1) connected mode is the mode of cohesive end connection, therefore PCR enriched products are carried out before carrier construction Plus A, mixed according to following system：

PCR primer	15μL
		dATP	4μL
Taq DNA polymerase	1μL

20~30min is reacted under conditions of mixed system is placed in into 72 DEG C.

Construction of expression vector：

Carried out with the full length coding region structure Yeast expression carrier for the corn ZmDGAT2.1 genes being cloned into yeast different Express in source.Corn ZmDGAT2.1 full length genes CDS PCR primer fragment is by sticky end with the mode that carrier is attached End connection.Reaction system and reaction condition are as follows：

Reaction system is gently mixed and is fully placed in room temperature (22~30 DEG C) 30min, reaction end be immediately placed on ice or Preserved under the conditions of being put in -20 DEG C.

Escherichia coli convert：

A. 2 μ L yeast expression system mixture is added among 50 μ L competent cell, ice bath 30min.

B. the heat shock 30s among 42 DEG C of water-baths, is placed on ice at once after terminating.

C. the SOC culture mediums of 250 μ L room temperature are added, 37 DEG C is placed in, 1h is shaken under the conditions of 200rpm.

D. the bacterium solution of different volumes (10 μ L, 50 μ L, 100 μ L) is applied on Selective agar medium, incubated overnight under the conditions of 37 DEG C.

E. 10 single bacterium colonies of picking, testing for positive bacterium colony is carried out using the primer pair bacterium colony of carrier two ends primer and gene Demonstrate,prove

The positive bacteria being proved to be successful is dropped into row plasmid extraction, and is sequenced, successfully progress next step experiment is sequenced, this Embodiment uses the extraction that plasmid is carried out purchased from the plasmid extraction kit (DP105) of Tiangeng biotech company.And profit With the forward primer and the reverse primer of gene of carrier, the reverse primer of carrier and the forward primer of gene are inserted to genetic fragment Direction is verified, and further confirms to carry out checking carrier connection using PCR test methods using forward and reverse primer of gene Whether succeed.

Expression of the galactolipin inducing maize ZmDGAT2.1 genes among yeast：

Because galactolipin can induce the expression of the target protein comprising GAL1 promoters, by using glucose as carbon source The bacterium solution centrifugation of growth, removes supernatant, the culture medium renewed simultaneously adds galactolipin to induce target protein to express, recombinant protein It can be detected after galactolipin induction less than in 4h.It can be examined in 2h in the cell of galactolipin Fiber differentiation containing gossypose Measure the formation of protein.Concrete operation step is as follows：

A. picking deficiency Wine brewing yeast strain H1246 single bacterium colony, among 10mL YPD culture mediums, 30 DEG C, Incubated overnight under the conditions of 150rpm.

B. the OD of incubated overnight bacterium solution is determined₆₀₀Value, by the OD of incubated overnight bacterium solution₆₀₀Value be adjusted to every 50mL induction Culture medium is 0.4, and 2~4h of bacterium is shaken in continuation at 30 DEG C, under the conditions of 150rpm.

C. centrifugation makes yeast cells gather in ttom of pipe under 2500rpm room temperature conditions, removes supernatant, is resuspended with 1 × TE of 40mL thin Born of the same parents, yeast cells is resuspended with 2mL 1 × LiAc/0.5 × TE.

D. by yeast cells in placing 10min under room temperature condition.

E. added in each conversion 1 μ g ZmDGAT2.1/pYES2.1 plasmids and 100 μ g denaturation salmon sperm dna and Yeast cream in 100 μ L steps D.

F. 1 × LiAc/40%PEG-3350/1 × TE that 700 μ L are added among mixed liquor is sufficiently mixed；By reactant 88 μ L DMSO are added after 30min to be sufficiently mixed with reaction system, 7min is cultivated under the conditions of 42 DEG C under the conditions of system is placed in 30 DEG C, Centrifuge wink, from 10s, removes supernatant.

G. supernatant is removed in centrifugation after cell is resuspended with 1mL 1 × TE.

H. cell coated plate among 50~100 μ L 1 × TE is resuspended, is cultivated under the conditions of 30 DEG C.

Enzymatic function is tested：

Swaged Wine brewing yeast strain H1246 completely loses the function to form lipid, and corn ZmDGAT2.1 genes are transferred to In deficiency Wine brewing yeast strain H1246 bacterial strains, by extracting the lipid of transgenic strain, whether observation yeast strain has shape Into the function of lipid, the enzymatic function of corn ZmDGAT2.1 genes is further related to：

A. single bacterium colony, the transgenosis bacterium of arabidopsis DGAT1 genes of picking corn ZmDGAT2.1 transgenic strain are distinguished Strain single bacterium colony (positive control), the single bacterium colony (positive control) of the transgenic strain of the genes of DGAT2 containing algae, containing empty carrier The single bacterium colony (negative control) of transgenic strain, swaged Wine brewing yeast strain H1246 single bacterium colony (negative control) are in 5mL's Among YPD fluid nutrient mediums, 30 DEG C, under the conditions of 150rpm, incubated overnight.

B. take the bacterium solution of certain volume to centrifuge 3min under the conditions of room temperature, 2000rpm within second day, remove supernatant, add 20mL SC (containing glucose and raffinose), continue to shake bacterium overnight.

C. take the bacterium solution of certain volume to centrifuge and remove supernatant, with 1~2mL SC (containing 10% raffinose and 10% galactolipin) punching Bacterium solution is washed, bacterium solution is added to 50mL SC (containing raffinose and galactolipin), 18~36h of bacterium is shaken；Bacterium solution is centrifuged, supernatant is removed, used The deionized water of 1mL sterilizings is rinsed, and supernatant is removed in centrifugation.

D. 1mL methanol solution is added among the bacterium solution of collection, 0.5mL bead is added, using cell crushing instrument, Dynamics 10, crushes 10min.

E. mixed liquor is transferred among glass tube, adds 2mL chloroform and 1mL chloroform：Methanol (2：1) mixing Liquid, and 1mL 0.034% MgCl₂Solution, the concussion that is vortexed fully is mixed.

F. by system in room temperature, 2000rpm centrifuges 3min under room temperature condition.

G. layer organic phase is removed among new pipe, adds 1mL 2M KCl：Methanol=4：Among 1 mixed liquor, 5min is centrifuged under 2000rpm, room temperature condition；Then remove a layer organic phase to be placed in a new pipe, be placed in fume hood and blown using nitrogen Instrument is dried up.

H. 200 μ L chloroform is added in the pipe of drying：Methanol (2：1) among mixed liquor；Point sample in chromatography offset plate on, It is placed on after half an hour equipped with hexane：Ether：Acetic acid=70：30：In the chromatography cylinder of 1 mixed liquor, plate 45min or so is run, extremely Plate is taken out away from chromatoplate top 1cm or so place, is placed in fume hood the 6~8h that dries in the air by chromatographic solution.

I. the chromatography offset plate fully dried is placed in the chromatography cylinder equipped with solid iodine, watches chromatographic strip that, obtain zymetology Functional verification result.

Experimental result is shown, has been transferred to the EV (Empty vector) of the empty carrier of not connected genetic fragment as negative right According to thalline among, have no triacylglycerol TAG bands generate；It is used as the AD1 of the overexpression arabidopsis DGAT1 genes of positive control Bacterial strain and the TD for being overexpressed algae DGAT2 genes₂Bacterial strain, it can be seen that the formation of TAG bands on thin layer liquid chromatogram plate；Cross The transgenic strain of corn ZmDGAT2.1 genes is expressed, high-visible TAG bands (as shown in figure 12) are occurred in that.Therefore demonstrate,prove Bright, corn ZmDGAT2.1 genes have the function of forming lipid, and are weaker than the enzymatic activity of DGAT among arabidopsis, show corn ZmDGAT2.1 genes have the function of catalyzing and synthesizing lipid (TAG) in vitro.

Abiotic stress is tested：

Choose corn inbred line and close 344 full seeds, seed of the same size is rinsed well with running water, using 10% NaCLO₃10min is sterilized, distilled water is cleaned, seed is placed on 22 DEG C of light culture 24h in incubator, waits to plant by vernalization after seed soaking 12h Son is grown after about 1.5cm root, by seed kind in the cystosepiment having openning hole, and is suspended among plantation 1/2MS nutrient solutions, in illumination Cultivated in incubator, condition of culture is 22 DEG C, and 16h illumination/8h is dark.The heart stage of three leaf one is grown in corn seedling, non-life is carried out Thing Stress treatment, including low-temperature treatment (4 DEG C), NaCl (200mmolL^-1)、NaHCO₃Handle (100mmolL^-1)、ABA (100μmol·L^-1) handle and Osmotic treatment (20%PEG6000).0,12,24,48 and 72h is sampled after treatment respectively, every kind of 3 plant are chosen in processing, take root and each about 200mg of leaf tissue, liquid nitrogen flash freezer is after -80 DEG C of preservations.

Real-time fluorescence quantitative PCR reaction existsCarried out on real-time fluorescence quantitative PCR instrument.

Reaction system is：

Real-time quantitative PCR response procedures：95 DEG C of 3min of pre-degeneration；40 circulations：95 DEG C, 60s, 95 DEG C, 15s, 55 DEG C, 30s, 72 DEG C, 60s.3 repetitions of each sample.With 2^-ΔΔCtMethod deploys the relative expression quantity analysis of gene.

Sense primer F2：5’-TGGCACACCATTCCCCTTCC-3’；Anti-sense primer R2：5’- GGACTCTTAGATGAAGGCCAGGAT-3’。

Low-temperature treatment is tested：

The low-temperature treatment of 344 4 DEG C of root leaf progress is closed to corn inbred line, real-time quantitative analysis is carried out, in the leaf of corn Portion is organized among root tissue, and ZmDGAT2.1 genes show up-regulated expression trend, expression of the ZmDGAT2.1 genes in 12h Amount reaches that ZmDGAT2.1 genes are in the equal up-regulated expression of Each point in time among peak value, root tissue, and ZmDGAT2.1 genes are in 24h With 72h up-regulated expressions, and peak value is reached in 72h, the trend for lowering expression is presented in the other times point under the stress of low temperature, Different tissues position and different times of the ZmDGAT2.1 genes under low temperature stress treatment conditions show different reactions, show The complex mechanism of low temperature stress process has been shown (as shown in Fig. 1~2).

NaCl processing experiments：

The leaf tissue and root tissue of corn are under NaCl Stress treatment, on most of the time point, blade group The trend for having notable up-regulated expression with the ZmDGAT2.1 genes in root tissue is knitted, wherein ZmDGAT2.1 genes are presented on first Downward trend after rising, its expression quantity reaches peak value in 48h；Among corn root tissue, ZmDGAT2.1 genes are when multiple Between point up-regulated expression trend is presented, ZmDGAT2.1 genes are presented fluctuation expression trend, and have reached peak value in 12h expression quantity (as shown in figs. 3 4).

NaHCO₃Processing experiment：

When the root tissue and leaf tissue of corn receive alkaline stress, the ZmDGAT2.1 genes of corn in root and Different with degree by abduction mechanism in leaf, ZmDGAT2.1 genes have up-regulation trend in 48 and 72h among leaf tissue, But the expression quantity of two time point ZmDGAT2.1 genes has differences, ZmDGAT2.1 genes are in 48h and 72h expression quantity The trend now gradually reduced, 72h expression quantity is about 2 times of 48h.Among the root tissue of alkaline stress, ZmDGAT2.1 genes The trend of up-regulated expression is presented at each time point, the trend dropped after Mr. is presented in the expression quantity of ZmDGAT2.1 genes, and in 12h Time point expression quantity reaches peak value, is significantly higher than other times point up-regulated expression amount (as shown in Fig. 5~6).

ABA processing experiments：

In the leaf tissue and root tissue of corn, it is subjected under ABA stress conditions, ZmDGAT2.1 genes are when different Between point present up-regulated expression trend, in leaf tissue, when being coerced by ABA, ZmDGAT2.1 genes are at 12h time points Up-regulation trend is the most obvious compared to other times point, relatively low in other times point expression quantity；And in the supreme mileometer adjustment of 24h, 72h Up to trend, at 24h time points, ZmDGAT2.1 genes are without up-regulated expression trend, among root tissue, and ZmDGAT2.1 genes are same Sample is by ABA stress-inducings, and ZmDGAT2.1 genes are expressed highest in 24h, taken second place in 6h up-regulated expression amounts, equal in other times point Without up-regulated expression trend.ZmDGAT2.1 genes are induced under conditions of being coerced by ABA, show ZmDGAT2.1 genes in participation There is important effect among ABA hormones stress procedure (as shown in Fig. 7~8).

PEG processing experiments：

Among the leaf tissue and root tissue of corn, in the case where being subjected to drought stress, ZmDGAT2.1 genes exist in blade 12 and 48h has the trend substantially raised, and in other times point without up-regulation trend, the up-regulation of ZmDGAT2.1 genes is obvious in root, And having up-regulation trend in Each point in time, ZmDGAT2.1 genes are higher in the early expression amount coerced, 6h time points Expression quantity reaches peak value, and 12h time point expression quantity takes second place, and ZmDGAT2.1 gene expression amounts are gradually reduced；ZmDGAT2.1 genes Performance among drought stress shows that it is notable to the response of Drought Stress environment in regulation and control crop, but response mechanism is present Difference, plays an important roll (as shown in Fig. 9~10) to crop resistance environment stress.

Different corn tissue qRT-PCR analyses：

The growthdevelopmental stage samples different to corn are sampled, and Proper Sampling Period is respectively embryo before Seedling Stage, jointing stage, grouting Breast, typhon mouthful phase and seed stage.Sample liquid nitrogen flash freezer carries out RNA extractions in -80 DEG C of preservations, and reverse transcription is carried out into cDNA QRT-PCR, experimental method is ibid.

Real-time quantitative result shows that corn DGAT2.1 genes express higher among the endosperm before grouting；It is Seedling Stage 28 times；It is 19 times of jointing stage；It is 11 times of typhon mouthful phase；It is 24 times (as shown in figure 11) in seed period.It can be seen that identical Gene different tissues position expression there is also difference, illustrate to complete among the process of its function in gene, be one Extremely complex process, its mechanism of action also has to be studied and confirmed.

The CDS sequences Design total length primers that corn DGAT2.1 genes are downloaded according to maize database, by grads PCR and The trial for changing the experimental methods such as PCR enzymes does not obtain full length gene, therefore open according to ORF (Open Reading Frame) Reading frame predicts the outcome, and second translation initiation site of selection carries out the clone of full length gene, and it is 1002bp's to clone length Genetic fragment (such as SEQ ID NO：Shown in 3).The result is shown：Selected bacterium colony includes successful connection and ferment in the right direction Female expression vector.ZmDGAT2.1 checking product lengths are 1002bp.Choose 1-2 positive ZmDGAT2.1/pYES2.1 yeast table Sequencing company is sent to up to carrier and carries out sequencing analysis, and sequencing result is correct.Expression vector by checking is transformed into swaged wine brewing Yeast strain H1246 bacterial strains carry out heterogenous expression.As a result show, the expression of ZmDGAT2.1 genes can recover yeast mutants The phenotype of lipid is formed, illustrating the albumen of ZmDGAT2.1 gene codes has the enzymatic function of synthesis lipid.

ZmDGAT2.1 develops higher during endosperm formation；On the basis of the present invention, the homologous bases of DGAT in plant are utilized The spatial and temporal expression specificity and function difference of cause, are regulated and controled, to realizing accuracy controlling higher plant seed grease respectively to it Route of synthesis is significant.

ZmDGAT2.1 has response to the processing of a variety of abiotic stress, illustrates it in terms of resistance of the crop to environment stress Have certain effect, the genetic resources of crop breeding for stress tolerance can be enriched.

Sequence table

<110>Heilongjiang Bayi Agricultural Reclamation University

<120>A kind of corn II types diacylglycerol acyltransferase and the gene for encoding corn II types DGAT

<130> ZmDGAT2.1

<141> 2017-06-30

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1314

<212> DNA

<213> Zea mays

<400> 1

atggggctgg cagtggcggt gggcaggcgg ccgacgcagc ggtccggtgt ctcccgttct 60

cgctgcgctg gcaagagacc cactgccgcc gagccccgac accaccggca ccgcacggag 120

ggaagaaaag aaagaaatcc cgggggatca cgtcgttatc agcgaccaga ttcagacgcg 180

agccgagcgg gggaggcgga ccacactaga actagaaccc tctctacggc tctactacgc 240

tacgccccat cccgcccgga ccggaccgga cccaccttcc tccacctctc tgcccgccgc 300

cggccgaccc gaatgggggc gggaaccaat aatggcctga gcaacggcgc cgccgcaggg 360

cagcgcgcgg acgacgggac cacggtgttc cggggcacgg cgtactcgcc gctacggacc 420

acggtggcgc tcgcgctgtg gctcggggcc atccacttca acgccttcct cgtcctcgcc 480

tcgctcttcc tcttcccgcg ccgcgtcgcc gcactggtgc tggcgacgca gctcttcttc 540

atgttcctgc cgctcagtga taagagcaga ctgggccgca agatcgccag gttcataagc 600

aagtacgtca ttgggtattt tcccgtcact ttgcacgtgg aagactatgg cgcctttgat 660

cccaacaggg cttatgtgtt cggttatgag cctcattctg ttttgcccat agctgttggg 720

atcctcgggg accttgttgg attcatgccg ctaccaaaga tgaagattct tgcaagcagt 780

gcggtgttct acaccccgtt cctaaggcaa atatggacat ggttggggtt ggctcctgcg 840

tcgagaaaga gtttctactc ctaccttgga gctggttata gctgtattat agtgccagga 900

ggtgtgcagg aaatacttca tatggatcat gattcagagg ttgcttttct taaaccaaga 960

aaaggttttg ttaagatagc tattgagatg ggttgccctg tagtccccgt ttttgctttc 1020

ggacagagct atgtttacaa atggtggagg ccaggtggca agttaattgt caagattgct 1080

agagcaatca aattttctcc aataatcttc tggggaaaac tggggactcc catccctttt 1140

gcaacaccaa tgcatgtgat tgttggaagg ccaattgagg ttgtaaagaa tcctcaacct 1200

accattgatg agataaacca agtccacgga cagttcgttg ttgcgatgca agatctgttc 1260

gagaaataca agagcagaac tggataccct gatcttcagt taagagttct ttga 1314

<210> 2

<211> 437

<212> PRT

<213> Zea mays

<400> 2

Met Gly Leu Ala Val Ala Val Gly Arg Arg Pro Thr Gln Arg Ser Gly

1 5 10 15

Val Ser Arg Ser Arg Cys Ala Gly Lys Arg Pro Thr Ala Ala Glu Pro

20 25 30

Arg His His Arg His Arg Thr Glu Gly Arg Lys Glu Arg Asn Pro Gly

35 40 45

Gly Ser Arg Arg Tyr Gln Arg Pro Asp Ser Asp Ala Ser Arg Ala Gly

50 55 60

Glu Ala Asp His Thr Arg Thr Arg Thr Leu Ser Thr Ala Leu Leu Arg

65 70 75 80

Tyr Ala Pro Ser Arg Pro Asp Arg Thr Gly Pro Thr Phe Leu His Leu

85 90 95

Ser Ala Arg Arg Arg Pro Thr Arg Met Gly Ala Gly Thr Asn Asn Gly

100 105 110

Leu Ser Asn Gly Ala Ala Ala Gly Gln Arg Ala Asp Asp Gly Thr Thr

115 120 125

Val Phe Arg Gly Thr Ala Tyr Ser Pro Leu Arg Thr Thr Val Ala Leu

130 135 140

Ala Leu Trp Leu Gly Ala Ile His Phe Asn Ala Phe Leu Val Leu Ala

145 150 155 160

Ser Leu Phe Leu Phe Pro Arg Arg Val Ala Ala Leu Val Leu Ala Thr

165 170 175

Gln Leu Phe Phe Met Phe Leu Pro Leu Ser Asp Lys Ser Arg Leu Gly

180 185 190

Arg Lys Ile Ala Arg Phe Ile Ser Lys Tyr Val Ile Gly Tyr Phe Pro

195 200 205

Val Thr Leu His Val Glu Asp Tyr Gly Ala Phe Asp Pro Asn Arg Ala

210 215 220

Tyr Val Phe Gly Tyr Glu Pro His Ser Val Leu Pro Ile Ala Val Gly

225 230 235 240

Ile Leu Gly Asp Leu Val Gly Phe Met Pro Leu Pro Lys Met Lys Ile

245 250 255

Leu Ala Ser Ser Ala Val Phe Tyr Thr Pro Phe Leu Arg Gln Ile Trp

260 265 270

Thr Trp Leu Gly Leu Ala Pro Ala Ser Arg Lys Ser Phe Tyr Ser Tyr

275 280 285

Leu Gly Ala Gly Tyr Ser Cys Ile Ile Val Pro Gly Gly Val Gln Glu

290 295 300

Ile Leu His Met Asp His Asp Ser Glu Val Ala Phe Leu Lys Pro Arg

305 310 315 320

Lys Gly Phe Val Lys Ile Ala Ile Glu Met Gly Cys Pro Val Val Pro

325 330 335

Val Phe Ala Phe Gly Gln Ser Tyr Val Tyr Lys Trp Trp Arg Pro Gly

340 345 350

Gly Lys Leu Ile Val Lys Ile Ala Arg Ala Ile Lys Phe Ser Pro Ile

355 360 365

Ile Phe Trp Gly Lys Leu Gly Thr Pro Ile Pro Phe Ala Thr Pro Met

370 375 380

His Val Ile Val Gly Arg Pro Ile Glu Val Val Lys Asn Pro Gln Pro

385 390 395 400

Thr Ile Asp Glu Ile Asn Gln Val His Gly Gln Phe Val Val Ala Met

405 410 415

Gln Asp Leu Phe Glu Lys Tyr Lys Ser Arg Thr Gly Tyr Pro Asp Leu

420 425 430

Gln Leu Arg Val Leu

435

<210> 3

<211> 1002

<212> DNA

<213> Zea mays

<400> 3

atgggggcgg gaaccaataa tggcctgagc aacggcgccg ccgcagggca gcgcgcggac 60

gacgggacca cggtgttccg gggcacggcg tactcgccgc tacggaccac ggtggcgctc 120

gcgctgtggc tcggggccat ccacttcaac gccttcctcg tcctcgcctc gctcttcctc 180

ttcccgcgcc gcgtcgccgc actggtgctg gcgacgcagc tcttcttcat gttcctgccg 240

ctcagtgata agagcagact gggccgcaag atcgccaggt tcataagcaa gtacgtcatt 300

gggtattttc ccgtcacttt gcacgtggaa gactatggcg cctttgatcc caacagggct 360

tatgtgttcg gttatgagcc tcattctgtt ttgcccatag ctgttgggat cctcggggac 420

cttgttggat tcatgccgct accaaagatg aagattcttg caagcagtgc ggtgttctac 480

accccgttcc taaggcaaat atggacatgg ttggggttgg ctcctgcgtc gagaaagagt 540

ttctactcct accttggagc tggttatagc tgtattatag tgccaggagg tgtgcaggaa 600

atacttcata tggatcatga ttcagaggtt gcttttctta aaccaagaaa aggttttgtt 660

aagatagcta ttgagatggg ttgccctgta gtccccgttt ttgctttcgg acagagctat 720

gtttacaaat ggtggaggcc aggtggcaag ttaattgtca agattgctag agcaatcaaa 780

ttttctccaa taatcttctg gggaaaactg gggactccca tcccttttgc aacaccaatg 840

catgtgattg ttggaaggcc aattgaggtt gtaaagaatc ctcaacctac cattgatgag 900

ataaaccaag tccacggaca gttcgttgtt gcgatgcaag atctgttcga gaaatacaag 960

agcagaactg gataccctga tcttcagtta agagttcttt ga 1002

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223>Reverse transcription internal reference upstream primer 18S-F.

<400> 4

agtttgaggc aataacaggt ct 22

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223>Reverse transcription internal reference downstream primer 18S-R.

<400> 5

gatgaaattt cccaagatta cc 22

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223>Full length gene PCR amplification sense primers F1.

<400> 6

agaatggggc tggcagtggc gg 22

<210> 7

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223>Full length gene PCR amplification anti-sense primers R1.

<400> 7

tcaaagaact cttaactgaa gatcaggg 28

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223>Real-time quantitative PCR sense primer F2.

<400> 8

tggcacacca ttccccttcc 20

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223>Real-time quantitative PCR anti-sense primer R2.

<400> 9

ggactcttag atgaaggcca ggat 24

Claims

1. a kind of corn II type diacylglycerol acyltransferases, it is characterised in that corn II type diacylglycerols acyl group is shifted Enzyme is named as ZmDGAT2.1, ZmDGAT2.1 amino acid sequence such as SEQ ID NO：Shown in 2.

2. encode the gene of corn II type diacylglycerol acyltransferases described in claim 1, it is characterised in that the gene Nucleotide sequence such as SEQ ID NO：Shown in 1 nucleotide sequence.

3. encode the gene of corn II type diacylglycerol acyltransferases, it is characterised in that the nucleotide sequence of the gene is such as SEQ ID NO：Shown in 3 nucleotide sequences.