CN107099518A - A kind of method of removal TAQ archaeal dna polymerase center acid pollutions - Google Patents
A kind of method of removal TAQ archaeal dna polymerase center acid pollutions Download PDFInfo
- Publication number
- CN107099518A CN107099518A CN201710170705.1A CN201710170705A CN107099518A CN 107099518 A CN107099518 A CN 107099518A CN 201710170705 A CN201710170705 A CN 201710170705A CN 107099518 A CN107099518 A CN 107099518A
- Authority
- CN
- China
- Prior art keywords
- binuclease
- archaeal dna
- taq archaeal
- wide spectrum
- dna polymerases
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/07—Nucleotidyltransferases (2.7.7)
- C12Y207/07007—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
Abstract
The invention discloses a kind of method of removal TAQ archaeal dna polymerase center acid pollutions, the method of the present invention hydrolyzes the nucleic acid polluted in TAQ archaeal dna polymerases by Binuclease, and Binuclease is removed completely with different methods, while the nucleic acid that TAQ archaeal dna polymerase sample contaminations are completely eliminated is reached, the problem of solving micro remaining Binuclease reduction PCR sensitiveness or cause false negative result.
Description
Technical field
The present invention relates to technological field of biochemistry, more particularly to a kind of removal TAQ archaeal dna polymerase center acid pollutions
Method.
Background technology
The unusual sensitiveness of PCR-based, micro pollution of nucleic acid may result in undesirable false positive results.Some
Based on prokaryotes housekeeping gene, such as 16S, detection method, the problem of micro pollution of nucleic acid can cause very big cause big
The false positive results of amount, it is impossible to correctly detect pathogen.This pollution of nucleic acid may be from the water used in PCR, and dNTPs draws
Thing, PCR buffer solutions, PCR reaction tubes and TAQ archaeal dna polymerases, preceding 5 kinds of pollution of nucleic acid can use Engineering Control (engineering
Controls) avoid or eliminate, the problem of pollution of nucleic acid in TAQ archaeal dna polymerases is main.It is generally necessary to remove or substantially
DNA or RNA of the upper elimination in TAQ archaeal dna polymerases.These diagnosis agents useful for same protease are mostly thin with protokaryon
Cellular expression purifying, some products do not take elimination pollution of nucleic acid method, or are not completely eliminated the DNA of pollution effectively
Method.Conventional a variety of company's archaeal dna polymerases, all more or less pollute containing DNA of bacteria in the market.Removed from RNA sample
The common method for removing DNA is to handle RNA sample with I types deoxyribonuclease (DNase), then by being heated and inactivated or combining
The step of resin, removes DNase I, but this method can not eliminate DNA in TAQ archaeal dna polymerases well.Wide spectrum nuclease
Binuclease can eliminate the nucleic acid polluted by the oligonucleotide that nucleic acid hydrolysis is 3-5bp, then by methods such as chromatographies,
But Binuclease is thermostable enzyme, micro remaining Binuclease can hydrolyze primer and template in PCR system, reduction
PCR sensitiveness even causes false negative result.
Although employing the method and steps of certain elimination nucleic acid in TAQ archaeal dna polymerase purge processes, such as add
Plus DNase and RNase digestion DNA and RNA, but this can not digesting nucleic acid completely, main purpose is to reduce gluing for albumen sample
Denseness, in order to later protein purification steps.After preliminary purification TAQ archaeal dna polymerases, it can be sunk with polyethyleneimine (PEI)
Form sediment, water/organic two-phase system precipitation method remove a part of e. coli dna, but can not remove the nucleic acid of depollution completely.For many years
Come, have been developed at a variety of DNA of bacteria methods for further removing and being polluted in TAQ archaeal dna polymerases, such as physics ray
Reason, chemical substance treatment, physics ray combination chemical substance treatment, cellulase treatment is (outside endonuclease DNase I, nucleic acid
Enzyme cutting III and limitation restriction endonuclease), and plurality of step and agents in combination processing.These methods by individually testing, also have
Inconsistent result report, in addition, most of decontamination procedures cause Taq polymerase hydraulic performance decline.Some methods, such as endonuclease
Enzyme DNase I processing can only hydrolyze DNA, it is impossible to handle RNA.Most of all, these processing are for eliminating very low molecule amount
DNA fragmentation (being shorter than 200bp) effect it is not good.
Wide spectrum nuclease Binuclease acts on the nucleic acid of form of ownership, including double-stranded DNA, DNA：RNA hybrid molecules,
Single stranded DNA, single stranded RNA etc., oligonucleotide chain less than or equal to 4 nucleotides length is degraded to by it, then by chromatography
It is easy to eliminate the nucleic acid of pollution etc. method.But Binuclease is thermostable enzyme, micro remaining Binuclease can water
The primer and template in PCR system are solved, the sensitiveness for reducing PCR even causes false negative result.
The content of the invention
The present invention removes TAQ archaeal dna polymerase center acid pollutions to solve one kind that above mentioned problem of the prior art is proposed
Method, the nucleic acid that pollutes in TAQ archaeal dna polymerases is hydrolyzed by Binuclease, and complete by the ad hoc approach of the present invention
Binuclease is removed, so as to reach the nucleic acid that TAQ archaeal dna polymerase sample contaminations are completely eliminated.
In order to realize above-mentioned technical purpose, the technical measures that the present invention is taken are：
A kind of method of removal TAQ archaeal dna polymerase center acid pollutions, comprises the following steps：
TAQ archaeal dna polymerases are handled with wide spectrum nuclease Binuclease directly incubations, poly- with nickel resin-bonded TAQ DNA
Synthase, washs nickel resin, removes wide spectrum nuclease Binuclease and its hydrolysate.
Meanwhile, above-mentioned method may be replaced by：
TAQ archaeal dna polymerases are first attached to nickel resin, then inject nickel resin with appropriate wide spectrum nuclease Binuclease,
Incubation is handled, and washs nickel resin, removes wide spectrum nuclease Binuclease and its hydrolysate.
Preferably, the nickel resin uses other divalent metal (such as Ni, Co, Cu, Fe) agarose resins or magnetic bead
Substitute.
Preferably, the present invention answers method and still further comprises the fixed TAQ archaeal dna polymerase amounts tentatively produced, uses different ladders
The wide spectrum nuclease Binuclease directly incubations for spending unit are handled, it is determined that the step of optimal wide spectrum nuclease Binuclease consumptions
Suddenly.
Preferably, wide spectrum nuclease Binuclease and its hydrolysate are removed using sieve method.
Preferably, wide spectrum nuclease Binuclease and its hydrolysate are removed using ion-exchange.
Further, method of the invention can also be optimized for coupling wide spectrum nuclease Binuclease in solid-phase media,
Handled with the directly incubation of TAQ archaeal dna polymerases, centrifugation or pass through the filtration void column separating broad spectrum nuclease containing mesh screen
Binuclease。
Further, method of the invention can also be optimized for coupling wide spectrum nuclease Binuclease in solid-phase media
Post, then post is coupled with appropriate TAQ archaeal dna polymerases injection, incubation processing elutes the TAQ archaeal dna polymerases handled well.
On the other hand, the present invention also provides the TAQ archaeal dna polymerases prepared according to above-mentioned method.
The present invention uses above-mentioned technical proposal, compared with prior art, have the following technical effect that：
This patent hydrolyzes the nucleic acid polluted in TAQ archaeal dna polymerases by Binuclease, and complete with different methods
Binuclease is removed, while the nucleic acid that TAQ archaeal dna polymerase sample contaminations are completely eliminated is reached, micro remaining is solved
The problem of Binuclease reduces PCR sensitiveness or causes false negative result.
Brief description of the drawings
Fig. 1 is the different degrees of Escherichia coli nucleic acid pollution condition of the common archaeal dna polymerase of in the market in embodiment one
Test result, specific band explanation is shown in embodiment one；
Fig. 2 is directly incubated with TAQ archaeal dna polymerases for wide spectrum nuclease Binuclease and DNase I in embodiment three and tied
Really；Wherein, (Isosorbide-5-Nitrae) band is the TAQ archaeal dna polymerases without any processing；37 degree of TAQ archaeal dna polymerases and DNase I
After being directly incubated 30 minutes, then 75 degree of process is inactivated 10 minutes, is as a result (2,5) band；TAQ archaeal dna polymerases and wide spectrum nucleic acid
After 37 degree of enzyme Binuclease is directly incubated 30 minutes, the result of 75 degree of 10 minutes inactivation treatments is shown in (3,6) band；
Fig. 3 is wide spectrum nuclease Binuclease and the incubation of TAQ archaeal dna polymerases in example IV, and removes wide spectrum nucleic acid
Comparative determination result after enzyme Binuclease；Wherein, (Isosorbide-5-Nitrae) band is the TAQ archaeal dna polymerases without any processing；
After TAQ archaeal dna polymerases are directly incubated 30 minutes with 37 degree of DNase I, then the results of 75 degree of inactivations 10 minutes of process are shown in (2,5)
Band；After TAQ archaeal dna polymerases are directly incubated 30 minutes with 37 degree of wide spectrum nuclease Binuclease, 75 degree inactivate for 10 minutes,
Wide spectrum nuclease Binuclease results are removed to see (3,6).
Embodiment
The present invention is described in more detail below by specific embodiment, for a better understanding of the present invention,
But following embodiments are not intended to limit the scope of the invention.
The common archaeal dna polymerase Escherichia coli nucleic acid pollution condition of the in the market of embodiment one
The TAQ archaeal dna polymerases of most in the markets are purified with Bacillus coli expression, although in purge process
The method and steps of certain elimination nucleic acid is employed, but because of the limitation of method, it is substantially more or less dirty containing DNA of bacteria
Dye.We regard pcr template with the 16S of Escherichia coli, have detected the conventional a variety of company's archaeal dna polymerases of in the market, all contain
The DNA pollution of different degrees of Escherichia coli.As shown in figure 1, no matter e. coli dna is added or is not added with PCR system,
Target gene can be amplified with Escherichia coli 16S primer.It is not added with Fig. 1 in 1-7PCR in e. coli dna, Fig. 1
E. coli dna is added with 8-14PCR.(1,8) is that Shanghai Mo Li biological medicines Science and Technology Ltd. tentatively produces in Fig. 1
TAQ archaeal dna polymerases, (2,9) are the Taq DNA polymerase (batch 10910609) of Qiagen companies, and (3,10) are
The Gotaq Hot start Green master Mix (batch 0000155474) of Promega companies, (4,11) are Biorad
The 2x iQ of companyTM Green Supermix (batch 750000145), (5,12) are NEB companiesHigh-
Fidelity 2X Master Mix (batch 0101506), (6,13) are NEB companiesTaq 2X Master
Mix (batch 0181303), (7,14) are ABI companiesUniversal PCR Master Mix (batches
M12982)。
The preliminary purification TAQ archaeal dna polymerases of embodiment two
After being induced 12 hours through IPTG in TAQ DNA polymerase gene expression type Bacillus coli cells, pass through centrifugation
Harvesting, and add 50mL buffer As (50mM Tris-HCl, pH 7.9 in every liter of original culture volume；50mM glucose,
1mM EDTA, 1mM PMSF) suspend.Cell precipitation is obtained by centrifugation again, and is resuspended in 50mL buffer As.In liquid
After freezing and being thawed twice under 37 degree in nitrogen, 1mL lysozymes (100mg/mL) are added, mixture is kept to 30 points at room temperature
Clock.Add isometric lysis buffer (10mM Tris-HCl, pH 7.9；50mM KCl, 1mM EDTA, 1mM DTT, 1mM
PMSF, 0.5%Tween 20,0.5%Nonidet P40).Cleavage mixture is incubated 30 minutes at 75 DEG C, and at 4 DEG C
With 16,000 × g centrifuges 10 minutes to remove cell fragment, adds 1% digestion solution (10mM Tris-HCl, pH 7.5；
15mM NaCl, 2mM CaCl 2,10mM MgCl 2,50% glycerine, 0.5mg/mL DNA enzymatics I, 10mg/mL ribonuclease A)
To remove overwhelming majority DNA and RNA.After 30 minutes, mixture is handled 30 minutes so that DNA enzymatic I again in 75 DEG C of water-baths
Denaturation, and at 4 DEG C with 16,000 × g is centrifuged 10 minutes.Supernatant is transferred in other centrifugation plastic bottles, and adds ethanol extremely
Final concentration of 55%, and with 16 at 4 DEG C, 000 × g centrifuges 15 minutes to reclaim TAQ archaeal dna polymerases.Precipitation is dissolved in 25mL
Storage buffer solution (50mM Tris-HCl, pH 7.9；50mM KCl, 0.1mM EDTA, 1mM DTT, 0.5mM PMSF, 50% is sweet
Oil) in, it is then stored at -20 DEG C.
The nuclease of embodiment three is directly incubated with TAQ archaeal dna polymerases
With the primer (table 1) of Escherichia coli 16S genes, it is not added with conditions of any DNA profiling, with preliminary purification
TAQ archaeal dna polymerases and in the market it is common to archaeal dna polymerase be directly PCR, 16S gene 200bp fragments can be amplified, this
Illustrate preliminary purification TAQ archaeal dna polymerases and in the market it is common to archaeal dna polymerase contain e. coli dna pollution (Fig. 1).
The TAQ DNA polymerase buffers of preliminary purification preserve liquid and are converted into 1X nucleic acid enzyme reaction solution (10mM Tris-HCl, 2.5mM
7.6 25 DEG C of MgCl 2,0.5mM CaCl 2, pH) after, in 100U TAQ archaeal dna polymerases, about 20 microlitres, add 1 microlitre
(2U)ABI TURBOTMDNase or 2U wide spectrum nucleases Binuclease, after 37 degree are directly incubated 30 minutes, then 75 degree of process is gone out
Handle within 10 minutes living.1 microlitre of TAQ archaeal dna polymerases after incubation processing, are not added with any DNA profiling or addition Escherichia coli
Under conditions of gDNA, with the primer of Escherichia coli 16S genes, 200bp Escherichia coli 16S genetic fragments are expanded.
Be not added with the conditions of any DNA profiling, plus nucleic acid ferment treatment and TURBOTMThe TAQ DNA of DNase processing gather
Synthase can amplify 200bp Escherichia coli 16S genetic fragments (Fig. 2).Repeatedly handle and increase TURBOTMAt DNase consumptions
Reason all obtains same result.TURBOTMDNase can not remove the Escherichia coli polluted in TAQ archaeal dna polymerases well
gDNA.Under the conditions of no matter being not added with any DNA profiling or adding Escherichia coli gDNA, Binuclease processing can not all be expanded
Go out 200bp Escherichia coli 16S genetic fragments (Fig. 2), Binuclease does not have completely heated up inactivation, the Binuclease meetings of residual
Degraded primer and the Escherichia coli gDNA of addition, and 200bp Escherichia coli 16S genetic fragments can not be amplified so as to cause
As a result.
Table 1：Detect the primer of Escherichia coli 16S genes.PCR primer size is 200bp
| E.coli16S353F | GCAGCAGTGGGGAATATTGC |
| E.coli16S552R | CGCTTGCACCCTCCGTATTA |
Example IV：TAQ archaeal dna polymerase methods are separated with nickel resin-bonded
The C-terminal of part TAQ archaeal dna polymerases contain 6 it is histidine-tagged, nickel resin can be combined.1 milligram of TAQ DNA gathers
Synthase (1mg/ml) buffering preserves liquid and is converted into 1X nucleic acid enzyme reaction solution (10mM Tris-HCl, 2.5mM MgCl 2,0.5mM
7.6 25 DEG C of CaCl 2, pH) after, respectively with the wide spectrum nuclease Binuclease of not commensurate (20U, 40U, 80U, 160U,
320U, 640U) 37 degree be directly incubated 30 minutes and handle, specific processing scheme is shown in embodiment three.It is separately added into 50 milliliters of nickel resins
Combination buffer (50mM NaH2PO4,300mM NaCl, pH8.0), adds 50 microlitres of nickel resin, and 4 degree combine 2 hours,
1000g centrifugation nickel resins, washing 4 times is centrifuged repeatedly with 50 milliliters of nickel resin-bonded buffer solutions, removes what is remained with abundant
Wide spectrum nuclease Binuclease.Again with 1 milliliter of nickel resin elution buffer (50mM NaH2PO4,300mM NaCl, 500mM
Imidazoles pH8.0) elute the TAQ archaeal dna polymerases handled well.It is converted into after TAQ archaeal dna polymerase storage buffer solutions, then stores up
In the presence of -20 DEG C.The TAQ archaeal dna polymerases handled well with 0.5 microlitre (about 2.5U), with the primer of Escherichia coli 16S genes, amplification
It is not added with any DNA profiling and addition Escherichia coli gDNA PCR system.Suitable wide spectrum nuclease Binuclease consumptions should
This is can not to expand to be not added with any DNA profiling (eliminating e. coli dna), but amplification can add Escherichia coli gDNA.
Because in different batches production TAQ archaeal dna polymerases contained Escherichia coli gDNA amounts difference, it is often a batch of tentatively to produce
TAQ archaeal dna polymerases are required for being tested in a small amount with different amounts of wide spectrum nuclease Binuclease, find optimal wide spectrum nuclease
Binuclease consumptions, then amplify this method and in high volume remove Escherichia coli gDNA in the TAQ archaeal dna polymerases tentatively produced
Pollute (Fig. 3).
The present embodiment can also use following method.1 milligram of TAQ archaeal dna polymerase (1mg/ml) is first attached to nickel resin column
Or after nickel resin suspends, then with 1X nucleic acid enzyme reaction solution (10mM Tris-HCl, 2.5mM MgCl 2,0.5mM CaCl 2, pH
7.6 25 DEG C) rinse several times repeatedly after, with containing not commensurate wide spectrum nuclease Binuclease (20U, 40U, 80U,
160U, 320U, 640U) 1X nucleic acid enzyme reaction solution injects nickel resin column or nickel resin suspends, and 37 degree are incubated processing in 30 minutes.Use nickel
Resin-bonded buffer solution is centrifuged repeatedly washing 4 times, with the abundant wide spectrum nuclease Binuclease for removing residual.Nickel resin is used again
Elution buffer (50mM NaH2PO4,300mM NaCl, 500mM imidazoles pH8.0) elutes the TAQ DNA polymerizations handled well
Enzyme.It is converted into after TAQ archaeal dna polymerase storage buffer solutions, is then stored at -20 DEG C.Handled well with 0.5 microlitre (about 2.5U)
TAQ archaeal dna polymerases, with the primer of Escherichia coli 16S genes, are detected by the method for embodiment two and determine optimal wide spectrum nuclease
Binuclease consumptions.Then amplification this method in high volume removes Escherichia coli gDNA in the TAQ archaeal dna polymerases tentatively produced
Pollution.
Nickel resin used in the present embodiment as example metal, can also with other divalent metals (such as Ni, Co,
Cu, Fe) agarose resin or magnetic bead.
Embodiment five：Wide spectrum nuclease Binuclease is removed with molecular sieve or ion-exchange
Wide spectrum nuclease Binuclease molecular weight about 30kDa, and TAQ archaeal dna polymerases molecular weight about 95kDa,
Therefore wide spectrum nuclease Binuclease can be separated off with appropriate molecular sieve.It is fixed preliminary raw by example IV method
The TAQ archaeal dna polymerase amounts of production, with the wide spectrum nuclease Binuclease processing of not commensurate, it is determined that optimal wide spectrum nuclease
Binuclease consumptions, then amplify this method and in high volume remove Escherichia coli gDNA in the TAQ archaeal dna polymerases tentatively produced
Pollution.With not glycerinated TAQ archaeal dna polymerases storage buffer solution 2X (100mM Tris-HCl, pH 7.9；100mM KCl,
0.2mM EDTA, 2mM DTT, 1.0mM PMSF) after pre-equilibration Superdex 75 or the molecular sieve columns of Superdex 200, wide spectrum
The direct loading of TAQ archaeal dna polymerases after nuclease Binuclease processing is separated off Binuclease.After molecular sieve purification
TAQ archaeal dna polymerases, plus equivalent 100% glycerine, be stored in -20 DEG C.Preferably with Superdex 200, it can not only divide
From Binuclease is removed, the impurity that molecular weight is more than TAQ archaeal dna polymerases can also be separated.
Wide spectrum nuclease Binuclease isoelectric point is 7.50, and the silent gift biological medicine in the Shanghai used in the present embodiment
The isoelectric point of the TAQ archaeal dna polymerases of Science and Technology Ltd. is 6.08, when in the buffer solutions of pH 7.0, wide spectrum nuclease
Binuclease is positively charged, and TAQ archaeal dna polymerases are negatively charged, therefore can be according to the difference ion exchange of electric charge
Method removes wide spectrum nuclease Binuclease.By example IV method, the fixed TAQ archaeal dna polymerase amounts tentatively produced, with not
The wide spectrum nuclease Binuclease processing of commensurate, it is determined that optimal wide spectrum nuclease Binuclease consumptions, then amplification should
Method in high volume removes Escherichia coli gDNA in the TAQ archaeal dna polymerases tentatively produced and polluted.With 100 times of ion exchange combination liquid
After (7.0 25 DEG C of 10mM Tris-HCl, pH) dilution, pH to 7.0 is adjusted.With ion exchange combination liquid pre-equilibration anion exchange
Post (such as HiScreen Q HP), dilutes and adjusts pH to 7.0 TAQ archaeal dna polymerases to be attached to anion-exchange column, and wide spectrum
Nuclease Binuclease can not combine anion-exchange column because positively charged, flow directly out anion-exchange column.Repeatedly with from
Sub- exchange liquid is rinsed after anion-exchange column, with ion-exchanging eluent (10mM Tris-HCl, 1M NaCI, pH 7.0
25 DEG C) gradient elution goes out the TAQ archaeal dna polymerases handled well.Wide spectrum nuclease can be not only removed with anion-exchange column
Binuclease, can also remove some other impurity in TAQ archaeal dna polymerases.Can also be with cation exchange column (such as
HiScreen SP HP) wide spectrum nuclease Binuclease is removed, because TAQ archaeal dna polymerases are negatively charged, it is impossible to reference to sun
Ion exchange column, directly can flow out from cation exchange column, and wide spectrum nuclease Binuclease can combine cation and hand over
Change post.Preferred plan is to first pass through cation exchange column, is allowed on wide spectrum nuclease Binuclease combination cation exchange columns, then
Directly by anion-exchange column, allow TAQ archaeal dna polymerases to be attached to anion-exchange column, allow the wide spectrum nuclease of omission
Binuclease is flowed directly out, and is repeatedly rinsed with ion exchange combination liquid after anion-exchange column, is used ion-exchanging eluent
(7.0 25 DEG C of 10mM Tris-HCl, 1M NaCI, pH) gradient elution goes out the TAQ archaeal dna polymerases handled well.This combination is
Wide spectrum nuclease Binuclease is effectively removed, some other impurity in TAQ archaeal dna polymerases can also be removed.
Embodiment six：Wide spectrum nuclease Binuclease is coupled in solid-phase media method
Some functional groups (such as amido-NH 2) of protease molecule can be with the solid support (agarose resin of activation
Magnetic bead of pearl, the pearl acrylamide of activation and activation etc.) chemical covalent bonds are connected between the reactive group of surface, this connecting key
Very firmly, therefore will not occur enzyme during enzyme is used to come off, stability is preferable.In the market has a variety of matured product pins
Sell.By taking NHS- activated agaroses as an example, 10KU wide spectrum nuclease Binuclease powder is dissolved in into coupling/lavation buffer solution
In (0.1M sodium phosphates, 0.15M NaCl, pH 7.2), it is added in the dried resin of activation, and reactant mixture stirring 1 is small
When, reaction can extend to 2 hours room temperatures or 4 DEG C are stayed overnight.Centrifuged 1 minute under 1000 × g, remove supernatant, add coupling/washing
Buffer solution (two volumes of resin), then centrifuged 1 minute under 1000 × g, supernatant is removed, this step is repeated once.Add quenching
Buffer solution (1M monoethanolamines or 1M Tris, pH 7.4, resin volume twice), at room temperature mix 15-20 minutes.With coupling/
Lavation buffer solution (two volumes of resin) centrifuge washing 2 times under 1000 × g, with containing 0.05% sodium azide or other anti-corrosions
The PBS of agent be stored in 4 DEG C it is standby.The wide spectrum nuclease Binuclease of same equal portions is taken to couple resin, with 1X nucleic acid enzyme reaction solutions
(10mM Tris-HCl, 2.5mM MgCl 2,0.5mM CaCl 2,7.6 25 DEG C of pH) be centrifuged repeatedly washing 2 times after, respectively plus
Enter the different amounts of TAQ archaeal dna polymerases tentatively produced, 37 degree are directly incubated 30 minutes and handle, centrifugation or by containing net
The filtration void column separating broad spectrum nuclease Binuclease coupling resins of sieve and the TAQ archaeal dna polymerases handled well.With large intestine bar
The primer of bacterium 16S genes, amplification is not added with any DNA profiling and addition Escherichia coli gDNA PCR system.Because wide spectrum nucleic acid
The amount of enzyme Binuclease coupling resins is certain, and the TAQ archaeal dna polymerases of the preliminary production of suitable amount should be expanded
Increasing is not added with any DNA profiling (eliminating e. coli dna), but can expand addition Escherichia coli gDNA.Once optimal bar
After part and consumption are determined, magnification ratio, the TAQ archaeal dna polymerases for largely producing seedless acid pollution.
In embodiment five, coupling method is not limited solely in the solid-phase media powder for the method for living, and can also be coupled wide spectrum nucleic acid
Then enzyme Binuclease determines the optimal TAQ DNA tentatively produced as stated above in the solid-phase media post of prepackage method living
It polymerize enzyme dosage, then amplifies this method and in high volume remove Escherichia coli gDNA pollutions in the TAQ archaeal dna polymerases tentatively produced.
The specific embodiment of the present invention is described in detail above, but it is intended only as example, and the present invention is not limited
It is formed on particular embodiments described above.To those skilled in the art, it is any to the equivalent modifications that carry out of the present invention and
Substitute also all among scope of the invention.Therefore, the impartial conversion made without departing from the spirit and scope of the invention and
Modification, all should be contained within the scope of the invention.
Claims (9)
1. a kind of method of removal TAQ archaeal dna polymerase center acid pollutions, it is characterised in that comprise the following steps：TAQ DNA gather
Synthase is handled with wide spectrum nuclease Binuclease directly incubations, with nickel resin-bonded TAQ archaeal dna polymerases, washs nickel resin,
Remove wide spectrum nuclease Binuclease and its hydrolysate.
2. a kind of method of removal TAQ archaeal dna polymerase center acid pollutions, it is characterised in that comprise the following steps：TAQ DNA gather
Synthase is first attached to nickel resin, then injects nickel resin with appropriate wide spectrum nuclease Binuclease, and nickel tree is washed in incubation processing
Fat, removes wide spectrum nuclease Binuclease and its hydrolysate.
3. method according to claim 1 or 2, it is characterised in that the nickel resin uses other divalent metal agar
Glucoresin or magnetic bead are substituted.
4. method according to claim 1 or 2, it is characterised in that also including the fixed TAQ archaeal dna polymerases tentatively produced
Amount, is handled with the wide spectrum nuclease Binuclease directly incubations of different gradient units, it is determined that optimal wide spectrum nuclease
The step of Binuclease consumptions.
5. according to the method described in claim 1, it is characterised in that remove wide spectrum nuclease Binuclease using sieve method
And its hydrolysate.
6. according to the method described in claim 1, it is characterised in that remove wide spectrum nuclease using ion-exchange
Binuclease and its hydrolysate.
7. according to the method described in claim 1, it is characterised in that wide spectrum nuclease Binuclease can also be coupled in solid phase
Medium, is handled with the directly incubation of TAQ archaeal dna polymerases, centrifugation or passes through the filtration void column separating broad spectrum nucleic acid containing mesh screen
Enzyme Binuclease.
8. according to the method described in claim 1, it is characterised in that wide spectrum nuclease Binuclease can also be coupled in solid phase
Dielectric posts, then post is coupled with appropriate TAQ archaeal dna polymerases injection, incubation processing elutes the TAQ DNA polymerizations handled well
Enzyme.
9. the TAQ archaeal dna polymerases that the method according to claim 1-8 any one is prepared.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710170705.1A CN107099518A (en) | 2017-03-21 | 2017-03-21 | A kind of method of removal TAQ archaeal dna polymerase center acid pollutions |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710170705.1A CN107099518A (en) | 2017-03-21 | 2017-03-21 | A kind of method of removal TAQ archaeal dna polymerase center acid pollutions |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107099518A true CN107099518A (en) | 2017-08-29 |
Family
ID=59675973
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710170705.1A Pending CN107099518A (en) | 2017-03-21 | 2017-03-21 | A kind of method of removal TAQ archaeal dna polymerase center acid pollutions |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107099518A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111693686A (en) * | 2020-05-28 | 2020-09-22 | 长沙都正生物科技有限责任公司 | Preparation method and detection method of TMAO biological negative sample and biological standard substance |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101903521A (en) * | 2007-12-20 | 2010-12-01 | 人类遗传标记控股有限公司 | Elimination of contaminants associated with nucleic acid amplification |
| CN102112627A (en) * | 2008-05-23 | 2011-06-29 | 生命技术公司 | Methods for removing nucleic acid contamination from reagents |
| CN105420201A (en) * | 2015-11-20 | 2016-03-23 | 北京科兴生物制品有限公司 | Method for removing Vero cell DNA in vaccine |
-
2017
- 2017-03-21 CN CN201710170705.1A patent/CN107099518A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101903521A (en) * | 2007-12-20 | 2010-12-01 | 人类遗传标记控股有限公司 | Elimination of contaminants associated with nucleic acid amplification |
| CN102112627A (en) * | 2008-05-23 | 2011-06-29 | 生命技术公司 | Methods for removing nucleic acid contamination from reagents |
| CN105420201A (en) * | 2015-11-20 | 2016-03-23 | 北京科兴生物制品有限公司 | Method for removing Vero cell DNA in vaccine |
Non-Patent Citations (2)
| Title |
|---|
| OLSZEWSKI, MARCIN ET.AL: "Benzonase--possibility of practical application", 《POSTEPY BIOCHEM.》 * |
| 贾平: "高纯度Taq DNA聚合酶制备技术研究", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111693686A (en) * | 2020-05-28 | 2020-09-22 | 长沙都正生物科技有限责任公司 | Preparation method and detection method of TMAO biological negative sample and biological standard substance |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10669571B2 (en) | Compositions and methods for targeted depletion, enrichment, and partitioning of nucleic acids using CRISPR/Cas system proteins | |
| EP3481838B1 (en) | Novel processes for the production of oligonucleotides | |
| CN105925678B (en) | Primer group for amplifying multiple target DNA sequences in sample and application thereof | |
| CN105176946A (en) | Uracil DNA (deoxyribonucleic acid) glycosidase, and preparation method and application thereof | |
| US20220220522A1 (en) | Method for producing anhydrous galactose derived from seaweed | |
| CN110938579A (en) | Recombinant tyrosine ammonia lyase strain, tyrosine ammonia lyase and preparation method and application thereof | |
| CN103755815A (en) | Novel fusion protein of mispairing binding protein and cellulose binding domain 3 and method thereof for removing errors in DNA (Desoxvribose Nucleic Acid) synthesis at high flux | |
| US7709240B2 (en) | AMP deaminase originating streptomyces and utilization thereof | |
| JP2002507128A (en) | Additives for use in cycling probe reactions | |
| JP2024504439A (en) | Esterase variants and their uses | |
| CN112941635A (en) | Second-generation sequencing library building kit and method for improving library conversion rate | |
| CN101016551B (en) | Method of introducing a plurality of DNA fragments simultaneously into DNA vector | |
| CN107099518A (en) | A kind of method of removal TAQ archaeal dna polymerase center acid pollutions | |
| Kikani et al. | Biocatalytic potential of thermophilic bacteria and actinomycetes | |
| CN107904668A (en) | A kind of microbial diversity library constructing method and its application | |
| Saravanan et al. | A novel process for the production of high-purity galactooligosaccharides (GOS) using consortium of microbes | |
| CN106929495A (en) | Improve than alpha amylase BasAmy mutant living and its encoding gene and application | |
| CN106318922A (en) | Preparation method of Pfu DNA polymerase | |
| CN111378611B (en) | Glutamic acid decarboxylase recombinant bacterium and construction method and application thereof | |
| CN101659960A (en) | Biological preparation method of chitin deacetylase | |
| CN104789540A (en) | Protein-type PCR (polymerase chain reaction) accelerant based on deoxyuridine triphosphate hydrolase as well as preparation method and application of protein-type PCR accelerant | |
| Zainudin et al. | Genome sequence of thermophilic cellulolytic actinobacterium Thermobifida fusca strain UPMC 901 producing thermostable cellulases. | |
| CN109971825B (en) | Method for rapidly preparing Sangge sequencing template | |
| CN106191017B (en) | Uridine-5' -diphosphate apiose/xylose synthetase derived from ornithogalum caudatum, nucleotide sequence and application thereof | |
| CN101407820A (en) | Gene of encoding glycosyl hydrolase family 32 sucrase and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170829 |
|
| RJ01 | Rejection of invention patent application after publication |