CN107064258B - The method of the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA - Google Patents

The method of the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA Download PDF

Info

Publication number
CN107064258B
CN107064258B CN201710091611.5A CN201710091611A CN107064258B CN 107064258 B CN107064258 B CN 107064258B CN 201710091611 A CN201710091611 A CN 201710091611A CN 107064258 B CN107064258 B CN 107064258B
Authority
CN
China
Prior art keywords
her2
solution
gold electrode
dna
electric signal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201710091611.5A
Other languages
Chinese (zh)
Other versions
CN107064258A (en
Inventor
阳明辉
申聪聪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Central South University
Original Assignee
Central South University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Central South University filed Critical Central South University
Priority to CN201710091611.5A priority Critical patent/CN107064258B/en
Publication of CN107064258A publication Critical patent/CN107064258A/en
Application granted granted Critical
Publication of CN107064258B publication Critical patent/CN107064258B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/28—Electrolytic cell components
    • G01N27/30—Electrodes, e.g. test electrodes; Half-cells
    • G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
    • G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
    • G01N27/3278—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction involving nanosized elements, e.g. nanogaps or nanoparticles
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Electrochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Engineering & Computer Science (AREA)
  • Nanotechnology (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The invention discloses the methods of electrochemical aptamer sensor measurement HER2 that electric signal and its self assembly amplified signal are generated based on DNA a kind of, this method is to be used to capture HER2 in gold electrode surfaces by the modification of Au-S key by HER2 specific polypeptide, after HER2 and HER2 aptamers are fixed on the electrode with sandwich-format, two complementary single stranded DNAs, which are triggered, using the primer end in HER2 aptamers is self-assembled into a long double-stranded DNA structure, sodium molybdate is recycled to react with the phosphate group on DNA skeleton, it generates phosphomolybdate precipitating and generates electric signal, and the principle that the size of electric signal is directly proportional to the amount of electrode surface DNA, realize that human epidermal growth factor HER2's is quick, accurately, high sensitivity detection, the electrochemical aptamer sensor is at low cost, and nothing It need to mark, be conducive to promote and apply.

Description

It is passed based on the DNA electrochemical aptamer for generating electric signal and its self assembly amplified signal The method of sensor measurement HER2
Technical field
The present invention relates to a kind of overdelicate electrochemical aptamer sensors of building for detecting human epidermal growth factor The method of receptor (HER2), in particular to a kind of electrochemistry adaptation that electric signal and its self assembly amplified signal are generated based on DNA The method that body sensor is used to measure human epidermal growth factor acceptor HER2, belongs to biosensor technique field.
Background technique
Breast cancer is one of the most common malignant tumors in women, and data are shown, the women in the U.S. 12% in life will at it Suffer from breast cancer.The mastocarcinoma gene for most concentrating research is HER2 gene, also known as CerbB-2 gene, in the cream of 25-30% Adenocarcinoma patients are overexpressed, so that HER2 becomes the most common markers for breast cancer.In normal human serum HER2 content be about 2~ 15ng/mL, the HER2 in blood serum of patients with human breast carcinoma are about 15~75ng/mL, and HER2 is important Prognosis in Breast Cancer judgement The factor, the breast cancer of HER2 positive (amplification or overexpression), tumor cell invasion is strong, recur and shift it is relatively fast, usually Make the prognostic level of the HER2 positive close to HER2 feminine gender using anti-HER2 targeted therapy, improves chances of survival, therefore quickly quasi- It really detects HER2 and determines that its state is extremely important to the selection of Breast Cancer Patients Treated scheme.The method of clinical detection HER2 There are immune group chemical (IHC) and fluorescence in situ hybridization (FISH), wherein IHC detects the quantity of HER2 albumen, and FISH is then detected The amplification of HER2 gene.However IHC and FISH need slicer sample, profession and specific instrument, time-consuming, It is expensive, therefore establish simple, quick, sensitive, the accurate HER2 detection method of one kind and have great importance.
Aptamer (aptamer) is the nucleic acid fragment with high specific and strong affinity, can replace biography The antibody of system causes extensive concern in bio-sensing and field of biomedicine.Aptamers generally pass through matching for index concentration Based system evolution technology (SELEX) is screened, and is then synthesized with solid-phase synthesis.Aptamer is passed generally as aptamers The identification probe of sensor, can identify and specifically combine with target substance, including polypeptide, protein, and small molecule is even Cell etc..In order to improve the sensitivity of aptamer sensor, scientific worker develops a large amount of nucleic acid amplification technologies, such as poly- It closes integrated enzyme reaction (PCR), rolling circle amplification (RCA), chain substitutes amplification technique (SDA) and DNA self assembly etc..Wherein only have DNA self assembly does not need the participation of enzyme, and can be assembled into specific structure.The self assembly of single stranded DNA is formed by base-pair When the free energy driving that generates, then by the chain reaction for being similar to chain polymerization in organism of primer strand triggering, and one-dimensional shape Looks are the smallest structure and the transmitting that can promote electronics.
Recently, have been reported that the phosphate radical on DNA skeleton generates phosphomolybdate precipitating with molybdic acid reactant salt and can produce telecommunications Number, but yet there are no and construct a kind of overdelicate electricity for generating electric signal and self assembly amplified signal based on DNA using the principle Chemical aptamer sensor detects the relevant report of HER2.
Summary of the invention
Deficiency existing for method for existing detection HER2, the purpose of the invention is to provide a kind of sensitivity Method high, at low cost, and detecting human epidermal growth factor HER2 without the electrochemical aptamer sensor of label.
Electric signal and its self assembly amplification letter are generated based on DNA in order to solve the above technical problems, the present invention provides one kind Number electrochemical aptamer sensor measurement HER2 method, method includes the following steps:
1) after being activated gold electrode surfaces, HER2 specific polypeptide is modified, then close using sulfydryls hexanol；
2) HER2 standard solution is added dropwise in the gold electrode surfaces, specifically binds HER2 and HER2 specific polypeptide, The modification of HER2 aptamers is formed into interlayer structure on HER2 again；The small segment DNA for recycling HER2 aptamers to include triggers two Complementary single stranded DNA carries out being self-assembly of double-stranded DNA in the gold electrode surfaces；It is added dropwise again in the gold electrode surfaces Na2MoO4Solution is reacted, and drying is tested gold electrode by square wave voltammetry, obtains peak point current；
3) a series of HER2 standard solution for taking various concentrations, is operated by step 2), obtains the HER2 with each concentration The corresponding peak point current of standard solution, establishes the standard curve of HER2 concentration and peak point current；
4) by HER2 solution replacement step 2 to be measured) in HER2 standard solution, operated by step 2), obtain peak electricity Flow valuve calculates HER2 solution concentration to be measured further according to standard curve.
Preferred scheme, gold electrode surfaces be activated process are as follows: gold electrode is successively used sodium hydroxide solution and Piranha solution is activated.
More preferably scheme, gold electrode use sodium hydroxide solution activation process are as follows: gold electrode is placed in 0.08~ In the NaOH solution of 0.12M, by cyclic voltammetry, cyclic voltammetry curve 20~40 is swept in the voltage range of -1.5~0.6V Circle, sweep speed are 0.5~1.5V/s, obtain the scanning curve of smooth steady.
More preferably scheme, gold electrode use Piranha solution activation process are as follows: gold electrode is placed in Piranha In solution, impregnate 5~10 minutes.Piranha solution is preferably made of 30wt% hydrogen peroxide and the concentrated sulfuric acid by 1:3 volume ratio.
Gold electrode is impregnated 8~12h at a temperature of 4~25 DEG C by preferred scheme in HER2 specific polypeptide solution, After washing with water gold electrode, then gold electrode is placed in sulfydryls hexanol solution and is impregnated 1~1.5 hour.
HER2 standard solution is added drop-wise to gold electrode surfaces by preferred scheme, and reaction is 1~2 small under the conditions of 4~25 DEG C When；HER2 aptamers are added drop-wise to gold electrode surfaces again, 1~2 hour is reacted under the conditions of 4~25 DEG C；Two will be contained again mutually The solution for mending single stranded DNA is added drop-wise to gold electrode surfaces, and 3~4 hours are reacted under the conditions of 35~39 DEG C；Again by Na2MoO4Solution Gold electrode surfaces are added drop-wise to, are reacted 10~20 minutes.
More preferably scheme, the HER2 aptamers base sequence are as follows: GCAGCGGTGTGGGGTATCGTTAATTCGGTCG。
The base sequence of more preferably scheme, two complementary single-stranded dnas is respectively as follows: ATAGCAATTAAGCCAGCCAGGTTCGGTGCAT and GCTGGCTTAATTGCTATATGCACCGAACCTG.
Preferred scheme, square wave voltammetry are in H2SO4In solution, square wave is carried out in the potential range of 0.1~0.45V The measurement of volt-ampere curve.Sulfuric acid solution is dilution heat of sulfuric acid, and preferred concentration is the dilution heat of sulfuric acid of 0.5M.
Preferred scheme, it is respectively 0pg/mL, 1pg/mL, 5pg/ that a series of HER2 standard solution of various concentrations, which is concentration, The HER2 standard solution of mL, 10pg/mL, 25pg/mL, 50pg/mL, 100pg/mL and 200pg/mL.
The electrochemical aptamer sensor for generating electric signal and its self assembly amplified signal based on DNA of the invention measures people The method of skins growth factor HER2, comprising the following specific steps
(1) it handles gold electrode: preparing more gold electrodes, after being handled respectively with sodium hydroxide (NaOH), Piranha solution, It is polished, is cleaned with polishing powder again, dried up spare；
(2) it constructs aptamer sensor: utilizing Au-S key by HER2 specific polypeptide (CKLRLEWNR, Shanghai gill Biochemistry is synthesized and is purified) it modifies in gold electrode surfaces, it is closed with sulfydryls hexanol (MCH), eliminates non-specific adsorption, it will HER2 standard solution, which is added dropwise, combines it with HER2 specific polypeptide in gold electrode surfaces, then (HER2 is adapted to by aptamer Body, the raw work in Shanghai synthesizes and are purified) modification forms interlayer structure on HER2, and a bit of DNA of the aptamer other end triggers two The single stranded DNA (the raw work in Shanghai is synthesized and purified) of item complementation carries out self assembly in gold electrode surfaces, forms a long double-strand DNA；Then by Na2MoO4Solution is added dropwise after gold electrode surfaces, reaction, and drying carries out square wave voltammetry survey to gold electrode respectively Examination；
(3) aptamer sensor measures HER2: choosing the HER2 standard solution of one group of various concentration by above-mentioned steps (2) Electrochemical aptamer sensor is constructed, and is measured, on the peak current and every gold electrode obtained according to square wave volt-ampere curve The concentration of corresponding HER2 standard solution, does standard curve；
(4) patients serum the HER2 in aptamer sensor measurement Serum of Patients With Breast Cancer: is diluted into 2000 times of replacements HER2 standard solution respectively by constructing electrochemical aptamer sensor in above-mentioned steps (2), and is measured, further according to measuring Electric current establishing criteria curve calculate the amount of HER2 in different patients serums.
The electrochemical aptamer sensor and its use that electric signal and its self assembly amplified signal are generated based on DNA of the invention In the principle of measurement human epidermal growth factor HER2: as shown in Figure 1, HER2 specific polypeptide is modified by Au-S key in golden electricity Pole surface, then HER2 albumen and its aptamer are fixed on the electrode with sandwich-format, then drawing on aptamer It triggers two complementary single stranded DNAs and is self-assembled into a long one-dimensional nano structure in object end.Phosphoric acid on sodium molybdate and DNA skeleton Group reacts under acidic environment, generates phosphomolybdate (PMo12O40 3-) precipitating generation electric signal, and the size of electric signal and electricity The amount of pole surface DNA is directly proportional.
Compared with prior art, technical solution bring advantageous effects of the invention are:
(1) present invention uses difunctional aptamer, can either specifically bind HER2 as identification probe, again It can be used as electrochemical signals output probe, so that the aptamer sensor of building, without label, operating process is simple.
(2) present invention employs DNA self assemblies to carry out amplified signal, and without the participation of enzyme, DNA self assembly can be assembled into knot Structure minimum, the DNA one-dimentional structure that electron transmission can be promoted, so that sensitivity greatly improves.
(3) present invention can directly measure the HER2 in patients serum, and IHC and FISH is overcome to need slicer sample Originally, the deficiency of profession and specific instrument, and the present invention data measured and the result that clinic IHC is measured are coincide substantially.
(4) method of the invention is easy to operate, high sensitivity, this early diagnosis and therapeutic scheme for clinical breast cancer Selection provides more convenient and fast thinking.
Detailed description of the invention
[Fig. 1] is the schematic illustration that the hypersensitive electrochemical aptamer sensor that the present invention constructs measures HER2.
[Fig. 2] is feasibility Experiment figure in present example, and (A) is cyclic voltammogram: (a) bare electrode, (b) 0.1ng/mL Before HER2 self assembly, (c) after 0.1ng/mL HER2 self assembly；It (B) is square wave voltammogram: (a) bare electrode, (b) 0.01ng/mL Before HER2 self assembly, (c) before 0.1ng/mL HER2 self assembly, (d) after 0.1ng/mL HER2 self assembly.
[Fig. 3] is the HER2 electrochemical response signal graph of various concentration in present example.
[Fig. 4] is the canonical plotting that concentration range is 1pg/mL~100pg/mL HER2 in present example.
Specific embodiment
Following embodiment is intended to further illustrate the content of present invention, rather than limits the protection model of the claims in the present invention It encloses.
Embodiment 1
(1) gold electrode is activated: preparing more gold electrodes, the NaOH solution for being first 0.1M with concentration is in -1.5~0.6V Voltage range in sweep ring volt-ampere curve 20 circle, sweep speed be 1V/s obtain the scanning curve of smooth steady, then will gold electricity Pole is placed in Piranha solution (30% hydrogen peroxide and the concentrated sulfuric acid are mixed with the volume ratio of 1:3) and impregnates 5 minutes, then by electrode It is polished with polishing powder, spends ethyl alcohol respectively and ionized water is cleaned by ultrasonic each 2 minutes, it is spare with being dried with nitrogen；
(2) clean gold electrode will be handled and be immersed in 40 μ L, concentration is the HER2 specific polypeptide of 50 μ g/mL (CKLRLEWNR) in solution, in 4 DEG C of refrigerator overnight, unmodified HER2 specificity on the electrode is washed with deionized water Polypeptide, then 40 μ L are immersed, the sulfydryls hexanol that concentration is 1mM closes 1.5 hours, to reduce non-specific adsorption, then by 5 μ L HER2 standard solution is added drop-wise to electrode surface and reacts 2 hours under conditions of 4 DEG C, so that HER2 is filled with HER2 specific polypeptide Divide and combine, then by 5 μ L, concentration is that 50 μM of HER2 aptamers (are connected to the aptamers of the HER2 of self assembly primer strand, base sequence Be classified as: GCAGCGGTGTGGGGTATCGTTAATTCGGTCG, wherein the part TATCGTTAATTCGGTCG is primer strand) it is added dropwise On electrode, 2 hours are equally reacted under conditions of 4 DEG C, are formed sandwich structure, are thoroughly cleaned, removed with deionized water Extra HER2 aptamers are gone, then, by 5 μ L DNA hybridization buffer liquid (10mM Tri(Hydroxymethyl) Amino Methane Hydrochloride, Tris- HCl；1mM ethylenediamine tetra-acetic acid, EDTA；1mM magnesium chloride solution, MgCl2；PH is 7.4) diluted 50 μM of complementary single-stranded dna (S1 Base sequence are as follows: ATAGCAATTAAGCCAGCCAGGTTCGGTGCAT；S2 base sequence are as follows: GCTGGCTTAATTGCTATATGCACCGAACCTG it) is added dropwise in electrode surface, completes DNA from group in 4 hours of 37 DEG C of water-baths Dress, then by the Na of 5 μ L, 5mM2MoO4Being added dropwise sufficiently to react to be formed for 15 minutes in electrode surface has the phosphomolybdate of electric signal heavy It forms sediment, finally in 0.5M H2SO4Cyclic voltammetry curve is carried out in the potential range of 0.1~0.45V in solution and square wave volt-ampere is bent The measurement of line.
(3) aptamer sensor measures HER2: take a series of HER2 standard solution of various concentrations, respectively 0,1,5, 10,25,50,100,200pg/mL building electrochemical aptamer sensor in above-mentioned steps (2), it is then bent according to square wave volt-ampere The peak current that line obtains does standard curve with HER2 concentration corresponding on every gold electrode, wherein linearly dependent coefficient R2= 0.99878；
(4) serum of 1,2,3, No. 4 breast cancer patients is diluted 2000 times, 5 and No. 6 non-breast cancer patients serum dilutions It 1000 times, instead of standard items HER2, is measured in the electrochemical aptamer sensor of building in above-mentioned steps (2) respectively, The amount of HER2 in different patients serums is calculated according to the electric current establishing criteria curve measured.
Table 1 is to measure HER2 in patients serum with ELISA kit and electrochemical aptamer sensor in present example Result compare.

Claims (7)

1. the method that the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA, It is characterized by comprising following steps:
1) after being activated gold electrode surfaces, HER2 specific polypeptide is modified, then close using sulfydryls hexanol；
2) HER2 standard solution is added dropwise in the gold electrode surfaces, is adapted to HER2 in conjunction with its specific polypeptide, then by HER2 Body is modified on the electrode, and interlayer structure is formed；The small segment DNA for recycling HER2 aptamers to include trigger two it is complementary single-stranded DNA carries out being self-assembly of double-stranded DNA in the gold electrode surfaces；Na is added dropwise in the gold electrode surfaces again2MoO4Solution carries out Reaction, drying, gold electrode is tested by square wave voltammetry, obtains peak point current；
3) a series of HER2 standard solution for taking various concentrations, is operated by step 2), obtains the HER2 standard with each concentration The corresponding peak point current of solution, establishes the standard curve of HER2 concentration and peak point current；
4) by HER2 solution replacement step 2 to be measured) in HER2 standard solution, operated by step 2), obtain peak point current, HER2 solution concentration to be measured is calculated further according to standard curve；The HER2 aptamers base sequence are as follows: GCAGCGGTGTGGGGTATCGTTAATTCGGTCG；The base sequence of two complementary single-stranded dnas is respectively as follows: ATAGCAATTAAGCCAGCCAGGTTCGGTGCAT and GCTGGCT TAATTGCTATATGCACCGAACCTG.
2. the electrochemical aptamer according to claim 1 for generating electric signal and its self assembly amplified signal based on DNA passes The method of sensor measurement HER2, it is characterised in that: the process that gold electrode surfaces are activated are as follows: gold electrode is successively used into hydrogen-oxygen Change sodium solution and Piranha solution is activated.
3. the electrochemical aptamer according to claim 2 for generating electric signal and its self assembly amplified signal based on DNA passes The method of sensor measurement HER2, it is characterised in that: gold electrode uses sodium hydroxide solution activation process are as follows: sets gold electrode In the NaOH solution of 0.08~0.12M, by cyclic voltammetry, cyclic voltammetric song is swept in the voltage range of -1.5~0.6V Line 20~40 encloses, and sweep speed is 0.5~1.5V/s, obtains the scanning curve of smooth steady；
Gold electrode uses Piranha solution activation process are as follows: gold electrode is placed in Piranha solution, impregnates 5~10 points Clock.
4. the electrochemical aptamer according to claim 1 for generating electric signal and its self assembly amplified signal based on DNA passes The method of sensor measurement HER2, it is characterised in that: at a temperature of 4~25 DEG C, by gold electrode in HER2 specific polypeptide solution 8~12h is impregnated, after washing with water gold electrode, then gold electrode is placed in sulfydryls hexanol solution and is impregnated 1~1.5 hour.
5. the electrochemical aptamer according to claim 1 for generating electric signal and its self assembly amplified signal based on DNA passes The method of sensor measurement HER2, it is characterised in that: HER2 standard solution is added drop-wise to gold electrode surfaces, under the conditions of 4~25 DEG C React 1~2 hour；HER2 adaptation liquid solution is added drop-wise to gold electrode surfaces again, reaction is 1~2 small under the conditions of 4~25 DEG C When；The solution containing two complementary single-stranded dnas is added drop-wise to gold electrode surfaces again, reaction is 3~4 small under the conditions of 35~39 DEG C When；Again by Na2MoO4Solution is added drop-wise to gold electrode surfaces, reacts 10~20 minutes.
6. the electrochemical aptamer according to claim 1 for generating electric signal and its self assembly amplified signal based on DNA passes The method of sensor measurement HER2, it is characterised in that: square wave voltammetry is in H2SO4In solution, in the potential range of 0.1~0.45V The interior measurement for carrying out square wave volt-ampere curve.
7. the electrochemical aptamer according to claim 1 for generating electric signal and its self assembly amplified signal based on DNA passes Sensor measurement HER2 method, it is characterised in that: a series of HER2 standard solution of various concentrations be concentration be respectively 0pg/mL, 1pg/mL, 5pg/mL, 10pg/mL, 25pg/mL, 50pg/mL, 100pg/mL and 200pg/mLHER2 standard solution.
CN201710091611.5A 2017-02-20 2017-02-20 The method of the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA Expired - Fee Related CN107064258B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710091611.5A CN107064258B (en) 2017-02-20 2017-02-20 The method of the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710091611.5A CN107064258B (en) 2017-02-20 2017-02-20 The method of the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA

Publications (2)

Publication Number Publication Date
CN107064258A CN107064258A (en) 2017-08-18
CN107064258B true CN107064258B (en) 2019-06-28

Family

ID=59622422

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710091611.5A Expired - Fee Related CN107064258B (en) 2017-02-20 2017-02-20 The method of the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA

Country Status (1)

Country Link
CN (1) CN107064258B (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108152483A (en) * 2017-11-30 2018-06-12 苏州峰通光电有限公司 A kind of immune electrochemical analyser
CN108732232A (en) * 2018-04-19 2018-11-02 山西农业大学 Exempt from the micro potassium content electrochemical detection method of electrode modification
CN109239173B (en) * 2018-09-21 2019-12-20 中南大学 Electrochemical method for detecting activity and concentration of bacteria
US11466309B2 (en) 2018-10-12 2022-10-11 The Board Of Trustees Of The University Of Arkansas Mechanically-strained oligonucleotide constructs and methods of using the same

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102912020A (en) * 2012-10-20 2013-02-06 江南大学 Construction method of aptamer sensor for measuring ochratoxin A
CN106226374A (en) * 2016-08-18 2016-12-14 中南大学 A kind of detection method of ErbB-2 concentration

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102912020A (en) * 2012-10-20 2013-02-06 江南大学 Construction method of aptamer sensor for measuring ochratoxin A
CN106226374A (en) * 2016-08-18 2016-12-14 中南大学 A kind of detection method of ErbB-2 concentration

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DNA Generated Electric Current Biosensor;Lanshuang Hu et al.;《analytical chemistry》;20170118;第89卷;2547-2552
Enzyme-Free and Label-Free Ultrasensitive Electrochemical Detection of Human Immunodeficiency Virus DNA in Biological Samples Based on Long-Range Self-Assembled DNA Nanostructures;Xian Chen et al.;《analytical chemistry》;20120906;第84卷;8277、8281

Also Published As

Publication number Publication date
CN107064258A (en) 2017-08-18

Similar Documents

Publication Publication Date Title
US10605761B2 (en) Electrochemical biosensor based on aptamer/nano silver probe and EXO I enzyme
Mittal et al. Biosensors for breast cancer diagnosis: A review of bioreceptors, biotransducers and signal amplification strategies
CN107064258B (en) The method of the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA
Liu et al. A dual-functional electrochemical biosensor for the detection of prostate specific antigen and telomerase activity
CN103063715B (en) Method for detecting surviving gene based on graphene-gold composite material electrochemical DNA (Deoxyribose Nucleic Acid) biosensor
CN105784796B (en) A kind of sensitive determination method of the aptamer sensor based on gold/molybdenum disulfide/graphene nanocomposite material to lysozyme
CN103698375A (en) Method for detecting miRNA (ribonucleic acid)
CN102262118A (en) Bioelectrochemical sensor for detecting tumor markers and preparation method thereof
CN109797200A (en) Ratio-type telomere enzyme active quantitive detection method
CN110243891A (en) A kind of label-free homogeneous electrochemical biosensor method detecting cancer cell
CN105301241A (en) Preparing method and application of sandwich type electrochemical luminescence immunosensor for detecting tumor marker
Song et al. Development of electrochemical aptamer biosensor for tumor marker MUC1 determination
Li et al. Electrochemical sensors applied for in vitro diagnosis
Fan et al. A flexible label-free electrochemical aptasensor based on target-induced conjunction of two split aptamers and enzyme amplification
CN103439319B (en) Carbon nano-particles modified electrode electrochemiluminescence measures the method for bleomycin
CN108195913B (en) A kind of biosensor and its construction method for Electrochemical Detection HER2
CN108088882B (en) Electrochemical detection method of stem cells
Ren et al. Detection of DNA and indirect detection of tumor cells based on circular strand-replacement DNA polymerization on electrode
Moussa Molecularly imprinted polymers meet electrochemical cancer chemosensors: A critical review from a clinical and economic perspective
Zhang et al. A novel electrochemical biosensor based on AMNFs@ ZIF-67 nano composite material for ultrasensitive detection of HER2
Wang et al. An entropy-driven DNA nanomachine for microRNA detection using a personal glucose meter
CN110044987A (en) The method of the preparation method and its Electrochemical Detection troponin of the covalent organic frame modified electrode of ferrocenyl
CN107044978A (en) Glutathione electrogenerated chemiluminescence assay method based on gold nano cluster probe
CN104034764A (en) Electro-chemical cell sensor with double targeting and visual functions and preparation method thereof
CN106198503B (en) A kind of electrochemiluminescence sandwich biosensor and preparation and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20190628

Termination date: 20210220

CF01 Termination of patent right due to non-payment of annual fee