CN107064258B - The method of the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA - Google Patents
The method of the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA Download PDFInfo
- Publication number
- CN107064258B CN107064258B CN201710091611.5A CN201710091611A CN107064258B CN 107064258 B CN107064258 B CN 107064258B CN 201710091611 A CN201710091611 A CN 201710091611A CN 107064258 B CN107064258 B CN 107064258B
- Authority
- CN
- China
- Prior art keywords
- her2
- solution
- gold electrode
- dna
- electric signal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
- G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
- G01N27/3278—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction involving nanosized elements, e.g. nanogaps or nanoparticles
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Electrochemistry (AREA)
- Analytical Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Engineering & Computer Science (AREA)
- Nanotechnology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention discloses the methods of electrochemical aptamer sensor measurement HER2 that electric signal and its self assembly amplified signal are generated based on DNA a kind of, this method is to be used to capture HER2 in gold electrode surfaces by the modification of Au-S key by HER2 specific polypeptide, after HER2 and HER2 aptamers are fixed on the electrode with sandwich-format, two complementary single stranded DNAs, which are triggered, using the primer end in HER2 aptamers is self-assembled into a long double-stranded DNA structure, sodium molybdate is recycled to react with the phosphate group on DNA skeleton, it generates phosphomolybdate precipitating and generates electric signal, and the principle that the size of electric signal is directly proportional to the amount of electrode surface DNA, realize that human epidermal growth factor HER2's is quick, accurately, high sensitivity detection, the electrochemical aptamer sensor is at low cost, and nothing It need to mark, be conducive to promote and apply.
Description
Technical field
The present invention relates to a kind of overdelicate electrochemical aptamer sensors of building for detecting human epidermal growth factor
The method of receptor (HER2), in particular to a kind of electrochemistry adaptation that electric signal and its self assembly amplified signal are generated based on DNA
The method that body sensor is used to measure human epidermal growth factor acceptor HER2, belongs to biosensor technique field.
Background technique
Breast cancer is one of the most common malignant tumors in women, and data are shown, the women in the U.S. 12% in life will at it
Suffer from breast cancer.The mastocarcinoma gene for most concentrating research is HER2 gene, also known as CerbB-2 gene, in the cream of 25-30%
Adenocarcinoma patients are overexpressed, so that HER2 becomes the most common markers for breast cancer.In normal human serum HER2 content be about 2~
15ng/mL, the HER2 in blood serum of patients with human breast carcinoma are about 15~75ng/mL, and HER2 is important Prognosis in Breast Cancer judgement
The factor, the breast cancer of HER2 positive (amplification or overexpression), tumor cell invasion is strong, recur and shift it is relatively fast, usually
Make the prognostic level of the HER2 positive close to HER2 feminine gender using anti-HER2 targeted therapy, improves chances of survival, therefore quickly quasi-
It really detects HER2 and determines that its state is extremely important to the selection of Breast Cancer Patients Treated scheme.The method of clinical detection HER2
There are immune group chemical (IHC) and fluorescence in situ hybridization (FISH), wherein IHC detects the quantity of HER2 albumen, and FISH is then detected
The amplification of HER2 gene.However IHC and FISH need slicer sample, profession and specific instrument, time-consuming,
It is expensive, therefore establish simple, quick, sensitive, the accurate HER2 detection method of one kind and have great importance.
Aptamer (aptamer) is the nucleic acid fragment with high specific and strong affinity, can replace biography
The antibody of system causes extensive concern in bio-sensing and field of biomedicine.Aptamers generally pass through matching for index concentration
Based system evolution technology (SELEX) is screened, and is then synthesized with solid-phase synthesis.Aptamer is passed generally as aptamers
The identification probe of sensor, can identify and specifically combine with target substance, including polypeptide, protein, and small molecule is even
Cell etc..In order to improve the sensitivity of aptamer sensor, scientific worker develops a large amount of nucleic acid amplification technologies, such as poly-
It closes integrated enzyme reaction (PCR), rolling circle amplification (RCA), chain substitutes amplification technique (SDA) and DNA self assembly etc..Wherein only have
DNA self assembly does not need the participation of enzyme, and can be assembled into specific structure.The self assembly of single stranded DNA is formed by base-pair
When the free energy driving that generates, then by the chain reaction for being similar to chain polymerization in organism of primer strand triggering, and one-dimensional shape
Looks are the smallest structure and the transmitting that can promote electronics.
Recently, have been reported that the phosphate radical on DNA skeleton generates phosphomolybdate precipitating with molybdic acid reactant salt and can produce telecommunications
Number, but yet there are no and construct a kind of overdelicate electricity for generating electric signal and self assembly amplified signal based on DNA using the principle
Chemical aptamer sensor detects the relevant report of HER2.
Summary of the invention
Deficiency existing for method for existing detection HER2, the purpose of the invention is to provide a kind of sensitivity
Method high, at low cost, and detecting human epidermal growth factor HER2 without the electrochemical aptamer sensor of label.
Electric signal and its self assembly amplification letter are generated based on DNA in order to solve the above technical problems, the present invention provides one kind
Number electrochemical aptamer sensor measurement HER2 method, method includes the following steps:
1) after being activated gold electrode surfaces, HER2 specific polypeptide is modified, then close using sulfydryls hexanol;
2) HER2 standard solution is added dropwise in the gold electrode surfaces, specifically binds HER2 and HER2 specific polypeptide,
The modification of HER2 aptamers is formed into interlayer structure on HER2 again;The small segment DNA for recycling HER2 aptamers to include triggers two
Complementary single stranded DNA carries out being self-assembly of double-stranded DNA in the gold electrode surfaces;It is added dropwise again in the gold electrode surfaces
Na2MoO4Solution is reacted, and drying is tested gold electrode by square wave voltammetry, obtains peak point current;
3) a series of HER2 standard solution for taking various concentrations, is operated by step 2), obtains the HER2 with each concentration
The corresponding peak point current of standard solution, establishes the standard curve of HER2 concentration and peak point current;
4) by HER2 solution replacement step 2 to be measured) in HER2 standard solution, operated by step 2), obtain peak electricity
Flow valuve calculates HER2 solution concentration to be measured further according to standard curve.
Preferred scheme, gold electrode surfaces be activated process are as follows: gold electrode is successively used sodium hydroxide solution and
Piranha solution is activated.
More preferably scheme, gold electrode use sodium hydroxide solution activation process are as follows: gold electrode is placed in 0.08~
In the NaOH solution of 0.12M, by cyclic voltammetry, cyclic voltammetry curve 20~40 is swept in the voltage range of -1.5~0.6V
Circle, sweep speed are 0.5~1.5V/s, obtain the scanning curve of smooth steady.
More preferably scheme, gold electrode use Piranha solution activation process are as follows: gold electrode is placed in Piranha
In solution, impregnate 5~10 minutes.Piranha solution is preferably made of 30wt% hydrogen peroxide and the concentrated sulfuric acid by 1:3 volume ratio.
Gold electrode is impregnated 8~12h at a temperature of 4~25 DEG C by preferred scheme in HER2 specific polypeptide solution,
After washing with water gold electrode, then gold electrode is placed in sulfydryls hexanol solution and is impregnated 1~1.5 hour.
HER2 standard solution is added drop-wise to gold electrode surfaces by preferred scheme, and reaction is 1~2 small under the conditions of 4~25 DEG C
When;HER2 aptamers are added drop-wise to gold electrode surfaces again, 1~2 hour is reacted under the conditions of 4~25 DEG C;Two will be contained again mutually
The solution for mending single stranded DNA is added drop-wise to gold electrode surfaces, and 3~4 hours are reacted under the conditions of 35~39 DEG C;Again by Na2MoO4Solution
Gold electrode surfaces are added drop-wise to, are reacted 10~20 minutes.
More preferably scheme, the HER2 aptamers base sequence are as follows:
GCAGCGGTGTGGGGTATCGTTAATTCGGTCG。
The base sequence of more preferably scheme, two complementary single-stranded dnas is respectively as follows:
ATAGCAATTAAGCCAGCCAGGTTCGGTGCAT and GCTGGCTTAATTGCTATATGCACCGAACCTG.
Preferred scheme, square wave voltammetry are in H2SO4In solution, square wave is carried out in the potential range of 0.1~0.45V
The measurement of volt-ampere curve.Sulfuric acid solution is dilution heat of sulfuric acid, and preferred concentration is the dilution heat of sulfuric acid of 0.5M.
Preferred scheme, it is respectively 0pg/mL, 1pg/mL, 5pg/ that a series of HER2 standard solution of various concentrations, which is concentration,
The HER2 standard solution of mL, 10pg/mL, 25pg/mL, 50pg/mL, 100pg/mL and 200pg/mL.
The electrochemical aptamer sensor for generating electric signal and its self assembly amplified signal based on DNA of the invention measures people
The method of skins growth factor HER2, comprising the following specific steps
(1) it handles gold electrode: preparing more gold electrodes, after being handled respectively with sodium hydroxide (NaOH), Piranha solution,
It is polished, is cleaned with polishing powder again, dried up spare;
(2) it constructs aptamer sensor: utilizing Au-S key by HER2 specific polypeptide (CKLRLEWNR, Shanghai gill
Biochemistry is synthesized and is purified) it modifies in gold electrode surfaces, it is closed with sulfydryls hexanol (MCH), eliminates non-specific adsorption, it will
HER2 standard solution, which is added dropwise, combines it with HER2 specific polypeptide in gold electrode surfaces, then (HER2 is adapted to by aptamer
Body, the raw work in Shanghai synthesizes and are purified) modification forms interlayer structure on HER2, and a bit of DNA of the aptamer other end triggers two
The single stranded DNA (the raw work in Shanghai is synthesized and purified) of item complementation carries out self assembly in gold electrode surfaces, forms a long double-strand
DNA;Then by Na2MoO4Solution is added dropwise after gold electrode surfaces, reaction, and drying carries out square wave voltammetry survey to gold electrode respectively
Examination;
(3) aptamer sensor measures HER2: choosing the HER2 standard solution of one group of various concentration by above-mentioned steps (2)
Electrochemical aptamer sensor is constructed, and is measured, on the peak current and every gold electrode obtained according to square wave volt-ampere curve
The concentration of corresponding HER2 standard solution, does standard curve;
(4) patients serum the HER2 in aptamer sensor measurement Serum of Patients With Breast Cancer: is diluted into 2000 times of replacements
HER2 standard solution respectively by constructing electrochemical aptamer sensor in above-mentioned steps (2), and is measured, further according to measuring
Electric current establishing criteria curve calculate the amount of HER2 in different patients serums.
The electrochemical aptamer sensor and its use that electric signal and its self assembly amplified signal are generated based on DNA of the invention
In the principle of measurement human epidermal growth factor HER2: as shown in Figure 1, HER2 specific polypeptide is modified by Au-S key in golden electricity
Pole surface, then HER2 albumen and its aptamer are fixed on the electrode with sandwich-format, then drawing on aptamer
It triggers two complementary single stranded DNAs and is self-assembled into a long one-dimensional nano structure in object end.Phosphoric acid on sodium molybdate and DNA skeleton
Group reacts under acidic environment, generates phosphomolybdate (PMo12O40 3-) precipitating generation electric signal, and the size of electric signal and electricity
The amount of pole surface DNA is directly proportional.
Compared with prior art, technical solution bring advantageous effects of the invention are:
(1) present invention uses difunctional aptamer, can either specifically bind HER2 as identification probe, again
It can be used as electrochemical signals output probe, so that the aptamer sensor of building, without label, operating process is simple.
(2) present invention employs DNA self assemblies to carry out amplified signal, and without the participation of enzyme, DNA self assembly can be assembled into knot
Structure minimum, the DNA one-dimentional structure that electron transmission can be promoted, so that sensitivity greatly improves.
(3) present invention can directly measure the HER2 in patients serum, and IHC and FISH is overcome to need slicer sample
Originally, the deficiency of profession and specific instrument, and the present invention data measured and the result that clinic IHC is measured are coincide substantially.
(4) method of the invention is easy to operate, high sensitivity, this early diagnosis and therapeutic scheme for clinical breast cancer
Selection provides more convenient and fast thinking.
Detailed description of the invention
[Fig. 1] is the schematic illustration that the hypersensitive electrochemical aptamer sensor that the present invention constructs measures HER2.
[Fig. 2] is feasibility Experiment figure in present example, and (A) is cyclic voltammogram: (a) bare electrode, (b) 0.1ng/mL
Before HER2 self assembly, (c) after 0.1ng/mL HER2 self assembly;It (B) is square wave voltammogram: (a) bare electrode, (b) 0.01ng/mL
Before HER2 self assembly, (c) before 0.1ng/mL HER2 self assembly, (d) after 0.1ng/mL HER2 self assembly.
[Fig. 3] is the HER2 electrochemical response signal graph of various concentration in present example.
[Fig. 4] is the canonical plotting that concentration range is 1pg/mL~100pg/mL HER2 in present example.
Specific embodiment
Following embodiment is intended to further illustrate the content of present invention, rather than limits the protection model of the claims in the present invention
It encloses.
Embodiment 1
(1) gold electrode is activated: preparing more gold electrodes, the NaOH solution for being first 0.1M with concentration is in -1.5~0.6V
Voltage range in sweep ring volt-ampere curve 20 circle, sweep speed be 1V/s obtain the scanning curve of smooth steady, then will gold electricity
Pole is placed in Piranha solution (30% hydrogen peroxide and the concentrated sulfuric acid are mixed with the volume ratio of 1:3) and impregnates 5 minutes, then by electrode
It is polished with polishing powder, spends ethyl alcohol respectively and ionized water is cleaned by ultrasonic each 2 minutes, it is spare with being dried with nitrogen;
(2) clean gold electrode will be handled and be immersed in 40 μ L, concentration is the HER2 specific polypeptide of 50 μ g/mL
(CKLRLEWNR) in solution, in 4 DEG C of refrigerator overnight, unmodified HER2 specificity on the electrode is washed with deionized water
Polypeptide, then 40 μ L are immersed, the sulfydryls hexanol that concentration is 1mM closes 1.5 hours, to reduce non-specific adsorption, then by 5 μ L
HER2 standard solution is added drop-wise to electrode surface and reacts 2 hours under conditions of 4 DEG C, so that HER2 is filled with HER2 specific polypeptide
Divide and combine, then by 5 μ L, concentration is that 50 μM of HER2 aptamers (are connected to the aptamers of the HER2 of self assembly primer strand, base sequence
Be classified as: GCAGCGGTGTGGGGTATCGTTAATTCGGTCG, wherein the part TATCGTTAATTCGGTCG is primer strand) it is added dropwise
On electrode, 2 hours are equally reacted under conditions of 4 DEG C, are formed sandwich structure, are thoroughly cleaned, removed with deionized water
Extra HER2 aptamers are gone, then, by 5 μ L DNA hybridization buffer liquid (10mM Tri(Hydroxymethyl) Amino Methane Hydrochloride, Tris-
HCl;1mM ethylenediamine tetra-acetic acid, EDTA;1mM magnesium chloride solution, MgCl2;PH is 7.4) diluted 50 μM of complementary single-stranded dna (S1
Base sequence are as follows: ATAGCAATTAAGCCAGCCAGGTTCGGTGCAT;S2 base sequence are as follows:
GCTGGCTTAATTGCTATATGCACCGAACCTG it) is added dropwise in electrode surface, completes DNA from group in 4 hours of 37 DEG C of water-baths
Dress, then by the Na of 5 μ L, 5mM2MoO4Being added dropwise sufficiently to react to be formed for 15 minutes in electrode surface has the phosphomolybdate of electric signal heavy
It forms sediment, finally in 0.5M H2SO4Cyclic voltammetry curve is carried out in the potential range of 0.1~0.45V in solution and square wave volt-ampere is bent
The measurement of line.
(3) aptamer sensor measures HER2: take a series of HER2 standard solution of various concentrations, respectively 0,1,5,
10,25,50,100,200pg/mL building electrochemical aptamer sensor in above-mentioned steps (2), it is then bent according to square wave volt-ampere
The peak current that line obtains does standard curve with HER2 concentration corresponding on every gold electrode, wherein linearly dependent coefficient R2=
0.99878;
(4) serum of 1,2,3, No. 4 breast cancer patients is diluted 2000 times, 5 and No. 6 non-breast cancer patients serum dilutions
It 1000 times, instead of standard items HER2, is measured in the electrochemical aptamer sensor of building in above-mentioned steps (2) respectively,
The amount of HER2 in different patients serums is calculated according to the electric current establishing criteria curve measured.
Table 1 is to measure HER2 in patients serum with ELISA kit and electrochemical aptamer sensor in present example
Result compare.
Claims (7)
1. the method that the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA,
It is characterized by comprising following steps:
1) after being activated gold electrode surfaces, HER2 specific polypeptide is modified, then close using sulfydryls hexanol;
2) HER2 standard solution is added dropwise in the gold electrode surfaces, is adapted to HER2 in conjunction with its specific polypeptide, then by HER2
Body is modified on the electrode, and interlayer structure is formed;The small segment DNA for recycling HER2 aptamers to include trigger two it is complementary single-stranded
DNA carries out being self-assembly of double-stranded DNA in the gold electrode surfaces;Na is added dropwise in the gold electrode surfaces again2MoO4Solution carries out
Reaction, drying, gold electrode is tested by square wave voltammetry, obtains peak point current;
3) a series of HER2 standard solution for taking various concentrations, is operated by step 2), obtains the HER2 standard with each concentration
The corresponding peak point current of solution, establishes the standard curve of HER2 concentration and peak point current;
4) by HER2 solution replacement step 2 to be measured) in HER2 standard solution, operated by step 2), obtain peak point current,
HER2 solution concentration to be measured is calculated further according to standard curve;The HER2 aptamers base sequence are as follows:
GCAGCGGTGTGGGGTATCGTTAATTCGGTCG;The base sequence of two complementary single-stranded dnas is respectively as follows:
ATAGCAATTAAGCCAGCCAGGTTCGGTGCAT and GCTGGCT TAATTGCTATATGCACCGAACCTG.
2. the electrochemical aptamer according to claim 1 for generating electric signal and its self assembly amplified signal based on DNA passes
The method of sensor measurement HER2, it is characterised in that: the process that gold electrode surfaces are activated are as follows: gold electrode is successively used into hydrogen-oxygen
Change sodium solution and Piranha solution is activated.
3. the electrochemical aptamer according to claim 2 for generating electric signal and its self assembly amplified signal based on DNA passes
The method of sensor measurement HER2, it is characterised in that: gold electrode uses sodium hydroxide solution activation process are as follows: sets gold electrode
In the NaOH solution of 0.08~0.12M, by cyclic voltammetry, cyclic voltammetric song is swept in the voltage range of -1.5~0.6V
Line 20~40 encloses, and sweep speed is 0.5~1.5V/s, obtains the scanning curve of smooth steady;
Gold electrode uses Piranha solution activation process are as follows: gold electrode is placed in Piranha solution, impregnates 5~10 points
Clock.
4. the electrochemical aptamer according to claim 1 for generating electric signal and its self assembly amplified signal based on DNA passes
The method of sensor measurement HER2, it is characterised in that: at a temperature of 4~25 DEG C, by gold electrode in HER2 specific polypeptide solution
8~12h is impregnated, after washing with water gold electrode, then gold electrode is placed in sulfydryls hexanol solution and is impregnated 1~1.5 hour.
5. the electrochemical aptamer according to claim 1 for generating electric signal and its self assembly amplified signal based on DNA passes
The method of sensor measurement HER2, it is characterised in that: HER2 standard solution is added drop-wise to gold electrode surfaces, under the conditions of 4~25 DEG C
React 1~2 hour;HER2 adaptation liquid solution is added drop-wise to gold electrode surfaces again, reaction is 1~2 small under the conditions of 4~25 DEG C
When;The solution containing two complementary single-stranded dnas is added drop-wise to gold electrode surfaces again, reaction is 3~4 small under the conditions of 35~39 DEG C
When;Again by Na2MoO4Solution is added drop-wise to gold electrode surfaces, reacts 10~20 minutes.
6. the electrochemical aptamer according to claim 1 for generating electric signal and its self assembly amplified signal based on DNA passes
The method of sensor measurement HER2, it is characterised in that: square wave voltammetry is in H2SO4In solution, in the potential range of 0.1~0.45V
The interior measurement for carrying out square wave volt-ampere curve.
7. the electrochemical aptamer according to claim 1 for generating electric signal and its self assembly amplified signal based on DNA passes
Sensor measurement HER2 method, it is characterised in that: a series of HER2 standard solution of various concentrations be concentration be respectively 0pg/mL,
1pg/mL, 5pg/mL, 10pg/mL, 25pg/mL, 50pg/mL, 100pg/mL and 200pg/mLHER2 standard solution.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710091611.5A CN107064258B (en) | 2017-02-20 | 2017-02-20 | The method of the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710091611.5A CN107064258B (en) | 2017-02-20 | 2017-02-20 | The method of the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107064258A CN107064258A (en) | 2017-08-18 |
CN107064258B true CN107064258B (en) | 2019-06-28 |
Family
ID=59622422
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710091611.5A Expired - Fee Related CN107064258B (en) | 2017-02-20 | 2017-02-20 | The method of the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107064258B (en) |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108152483A (en) * | 2017-11-30 | 2018-06-12 | 苏州峰通光电有限公司 | A kind of immune electrochemical analyser |
CN108732232A (en) * | 2018-04-19 | 2018-11-02 | 山西农业大学 | Exempt from the micro potassium content electrochemical detection method of electrode modification |
CN109239173B (en) * | 2018-09-21 | 2019-12-20 | 中南大学 | Electrochemical method for detecting activity and concentration of bacteria |
US11466309B2 (en) | 2018-10-12 | 2022-10-11 | The Board Of Trustees Of The University Of Arkansas | Mechanically-strained oligonucleotide constructs and methods of using the same |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102912020A (en) * | 2012-10-20 | 2013-02-06 | 江南大学 | Construction method of aptamer sensor for measuring ochratoxin A |
CN106226374A (en) * | 2016-08-18 | 2016-12-14 | 中南大学 | A kind of detection method of ErbB-2 concentration |
-
2017
- 2017-02-20 CN CN201710091611.5A patent/CN107064258B/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102912020A (en) * | 2012-10-20 | 2013-02-06 | 江南大学 | Construction method of aptamer sensor for measuring ochratoxin A |
CN106226374A (en) * | 2016-08-18 | 2016-12-14 | 中南大学 | A kind of detection method of ErbB-2 concentration |
Non-Patent Citations (2)
Title |
---|
DNA Generated Electric Current Biosensor;Lanshuang Hu et al.;《analytical chemistry》;20170118;第89卷;2547-2552 |
Enzyme-Free and Label-Free Ultrasensitive Electrochemical Detection of Human Immunodeficiency Virus DNA in Biological Samples Based on Long-Range Self-Assembled DNA Nanostructures;Xian Chen et al.;《analytical chemistry》;20120906;第84卷;8277、8281 |
Also Published As
Publication number | Publication date |
---|---|
CN107064258A (en) | 2017-08-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10605761B2 (en) | Electrochemical biosensor based on aptamer/nano silver probe and EXO I enzyme | |
Mittal et al. | Biosensors for breast cancer diagnosis: A review of bioreceptors, biotransducers and signal amplification strategies | |
CN107064258B (en) | The method of the electrochemical aptamer sensor measurement HER2 of electric signal and its self assembly amplified signal is generated based on DNA | |
Liu et al. | A dual-functional electrochemical biosensor for the detection of prostate specific antigen and telomerase activity | |
CN103063715B (en) | Method for detecting surviving gene based on graphene-gold composite material electrochemical DNA (Deoxyribose Nucleic Acid) biosensor | |
CN105784796B (en) | A kind of sensitive determination method of the aptamer sensor based on gold/molybdenum disulfide/graphene nanocomposite material to lysozyme | |
CN103698375A (en) | Method for detecting miRNA (ribonucleic acid) | |
CN102262118A (en) | Bioelectrochemical sensor for detecting tumor markers and preparation method thereof | |
CN109797200A (en) | Ratio-type telomere enzyme active quantitive detection method | |
CN110243891A (en) | A kind of label-free homogeneous electrochemical biosensor method detecting cancer cell | |
CN105301241A (en) | Preparing method and application of sandwich type electrochemical luminescence immunosensor for detecting tumor marker | |
Song et al. | Development of electrochemical aptamer biosensor for tumor marker MUC1 determination | |
Li et al. | Electrochemical sensors applied for in vitro diagnosis | |
Fan et al. | A flexible label-free electrochemical aptasensor based on target-induced conjunction of two split aptamers and enzyme amplification | |
CN103439319B (en) | Carbon nano-particles modified electrode electrochemiluminescence measures the method for bleomycin | |
CN108195913B (en) | A kind of biosensor and its construction method for Electrochemical Detection HER2 | |
CN108088882B (en) | Electrochemical detection method of stem cells | |
Ren et al. | Detection of DNA and indirect detection of tumor cells based on circular strand-replacement DNA polymerization on electrode | |
Moussa | Molecularly imprinted polymers meet electrochemical cancer chemosensors: A critical review from a clinical and economic perspective | |
Zhang et al. | A novel electrochemical biosensor based on AMNFs@ ZIF-67 nano composite material for ultrasensitive detection of HER2 | |
Wang et al. | An entropy-driven DNA nanomachine for microRNA detection using a personal glucose meter | |
CN110044987A (en) | The method of the preparation method and its Electrochemical Detection troponin of the covalent organic frame modified electrode of ferrocenyl | |
CN107044978A (en) | Glutathione electrogenerated chemiluminescence assay method based on gold nano cluster probe | |
CN104034764A (en) | Electro-chemical cell sensor with double targeting and visual functions and preparation method thereof | |
CN106198503B (en) | A kind of electrochemiluminescence sandwich biosensor and preparation and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190628 Termination date: 20210220 |
|
CF01 | Termination of patent right due to non-payment of annual fee |