CN107058514B - Primer for rapid detection of RPA of Shigella and tetracycline drug-resistant gene - Google Patents
Primer for rapid detection of RPA of Shigella and tetracycline drug-resistant gene Download PDFInfo
- Publication number
- CN107058514B CN107058514B CN201710126445.8A CN201710126445A CN107058514B CN 107058514 B CN107058514 B CN 107058514B CN 201710126445 A CN201710126445 A CN 201710126445A CN 107058514 B CN107058514 B CN 107058514B
- Authority
- CN
- China
- Prior art keywords
- shigella
- rpa
- concentration
- amplification
- chloroform
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer for rapidly detecting Shigella and tetracycline drug-resistant gene RPA. The primer designed by the invention has better inter-species specificity and intra-species conservation, the reaction can specifically detect a target gene and can respectively identify Shigella (fop. Shigella, shigella sonnei) and tetracycline-resistant gene (tetM) at the same time, so that the occurrence of false positive is avoided; according to the invention, a pair of specific primers is designed according to a tetracycline-resistant gene (tetM), and a pair of primers is designed according to homology of genes of the shigella fogiceras, namely the shigella sonnei, the 2 pairs of primers can amplify 3 items of genes, and compared with the traditional method, the number of the primers is greatly reduced (3 pairs of primers are needed for amplifying 3 items of genes by the traditional method), so that the occurrence of false positives is reduced. The amplified fragments have different lengths and sizes and can be separated and distinguished by electrophoresis.
Description
Technical Field
The invention belongs to the technical field of biology, and relates to a primer for rapid detection of Recombinase Polymerase Amplification (RPA) of shigella and tetracycline-resistant genes and application thereof, in particular to a primer for rapid detection of RPA capable of simultaneously detecting fot shigella, shigella sonnei and tetracycline-resistant genes (tetM) in a sample.
Background
Shigellasis (Shigellosis), also called bacillary dysentery, is an acute intestinal infectious disease caused by Shigella dysentery bacilli (fortune. Shigella, shigella sonnei, etc.), has high infectivity and serious harmfulness, and is mainly suitable for children under 5 years old and people with immunological disorders. Patients with dysentery infection often have abdominal pain, diarrhea, mucoid bloody pus stool and fever, and serious patients may have life-threatening symptoms such as renal failure and neurotoxicity, which seriously jeopardize human health and life safety. Moreover, nowadays, the abusive use of antibiotics causes the increasing number of drug-resistant strains of various food-borne pathogenic bacteria, and tetracycline antibiotics, as a broad-spectrum antibiotic, have been widely used in the prevention and treatment of antibacterial growth promoters for livestock and poultry and bacterial infections in human, veterinary and plants due to the advantages of low price, wide range of action, low toxicity and the like, resulting in the generation of serious drug resistance for many bacteria. Shigella, as a zoonosis pathogen, has developed serious drug resistance, especially to tetracycline. The existence and prevalence of a large number of drug-resistant strains lead to the continuous increase of morbidity and mortality of the disease, and cause wide attention of the world population. Therefore, a modern method for detecting Shigella, which is simple, convenient, rapid and accurate to operate and high in sensitivity and specificity, is urgently needed to be established. At present, the rapid detection methods of shigella mainly comprise a conventional detection method, a rapid biochemical instrument detection method, a molecular biology detection method, a toxin detection method, a loop-mediated isothermal amplification technology, an enzyme-linked immunosorbent assay and the like, but the methods are difficult to adapt to the requirements of the safe and rapid detection of modern food due to complex operation procedures, long detection time, high cost, low accuracy and poor specificity. So we need to try to find a better fast detection method to replace them.
Recombinase Polymerase Amplification (RPA) is a nucleic acid amplification technique developed in recent years, and one of the major advantages of RPA techniques is isothermicity, as compared with the classical PCR technique. The conventional PCR must be carried out through different temperature links, and the RPA reaction can be carried out at normal temperature. The second advantage is that the detection takes a short time. The whole process can be completed within 10-20 minutes without denaturation. The third advantage is sensitivity. RPA techniques maintain high sensitivity while reducing reaction time. The fourth advantage is the diversity of result reading. The RPA result can be detected by agarose gel electrophoresis, can be monitored in real time in an amplification process similar to real-time PCR, and can be read by a test strip.
The method adopts the RPA technology to research the fop-Shigella, the Shigella sonnei and the tetracycline-resistant gene (tetM) in the sample, ensures sensitivity and specificity, has simple operation and short time consumption, can amplify target DNA within 10-20 minutes at normal temperature, and can detect the tetracycline-resistant gene (tetM) while detecting the shigella fop-Shigella and the Shigella sonnei. Provides theoretical basis and scientific basis for the molecular epidemic basis of the tetracycline-resistant Shigella, and has important significance in veterinary medicine, food sanitation, public health and other aspects.
Disclosure of Invention
The invention aims to solve the technical problem of providing a primer sequence for rapidly detecting the RPA of the fortune-telling resistant Shigella, the Song-Netschneidella and the tetracycline resistant gene (tetM) simultaneously.
The technical scheme adopted by the invention for solving the technical problems is as follows:
in order to achieve the purpose, the invention designs 2 pairs of specific primers F1/R1 and F2/R2 according to characteristic target genes of Shigella (fop. Shigella and Shigella sonnei) and tetracycline resistant gene (tetM), which are shown in table 1, wherein the fop shigella sonnei and the Shigella sonnei share one pair of primers F1/R1. Each specific primer has the advantages of high intraspecies conservation, interspecific specificity and the like. The amplified fragments have different lengths, the size of the product after the amplification of the Shigella foenbergii is 186bp, the size of the product after the amplification of the Shigella sonnei is 253bp, and the size of the product after the amplification of the tetracycline resistant gene (tetM) is 534bp, and the fragments can be separated and distinguished through electrophoresis.
TABLE 1 fast detection of specific primer sequences for RPA
The specific detection method comprises the following steps:
step (1) sample pretreatment
Sampling 25g (pork, chicken, etc.), adding 225mL sterilized distilled water, and homogenizing with a tissue homogenizer for 1min to obtain a tissue homogenate sample.
Step (2) sample DNA extraction
Taking 50mg of the tissue homogenate sample treated in the step (1), adding 200 mu l of TE buffer solution with the pH value of 8.0, and uniformly mixing by vortex; adding 400 μ l of lysis solution, mixing, adding 600 μ l of phenol-chloroform-isoamyl alcohol mixed solvent, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform-isoamylol mixed solvent with the same volume as the supernatant, violently shaking, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform with the same volume as the supernatant, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding isopropanol with the volume of 0.8 times of that of the supernatant, and centrifuging for 10min at 12000 g; collecting precipitate, washing with 70 vol% ethanol for 1 time, air drying at room temperature or 50 deg.C for 20min, and dissolving in 80 μ l TE buffer solution with pH of 8.0 to obtain DNA extract; the DNA extract is template DNA; determining the concentration and purity of the template DNA of the DNA extract by a nucleic acid protein detector;
the phenol-chloroform-isoamyl alcohol mixed solvent is formed by mixing phenol, chloroform and isoamyl alcohol according to the volume ratio of 25:24: 1;
the chloroform-isoamyl alcohol mixed solvent is formed by mixing chloroform and isoamyl alcohol according to the volume ratio of 24: 1;
the TE buffer solution is 1ml of Tris-Cl with the concentration of 1M and the pH value of 8.0, 0.2ml of EDTA with the concentration of 0.5M and the pH value of 8.0, and the volume is fixed to 100ml of solution;
the lysis solution is a mixed solution consisting of Tris-HCl, EDTA, naCl, proteinase K and sodium dodecyl sulfate SDS, wherein the concentration of Tris-HCl is 50mM, the pH value is 8.0, the concentration of EDTA is 25mM, the concentration of NaCl is 100mM, the concentration of proteinase K is 20 mu g/mu L, and the mass fraction of sodium dodecyl sulfate SDS is 10%;
step (3) amplification of RPA
And oscillating and uniformly mixing the RPA amplification reaction system, and performing RPA amplification to obtain an amplification product.
The RPA amplification reaction system, namely the RPA gel detection system, is composed of 50 mu L of 0.2ml twist Amp Basic reaction tube containing freeze-dried enzyme powder, and is added with 29.5 mu L of Rehydration Buffer (Rehydration Buffer), 11 mu L of deionized water, 6 mu L (10 mu mol/L) of mixed primer, 1 mu L of extracted sample genome DNA and 2.5 mu L (280 mmol/L) of magnesium acetate solution.
Oscillating and uniformly mixing an RPA amplification reaction system, and then putting the mixture into a constant-temperature metal bath at 37 ℃ for reaction for 25min to obtain an amplification product;
the added mixed primers are mixed primers of 2 pairs of specific primers, wherein the concentration ratio of the 2 pairs of specific primers is F1: R1: F2: R2=2: 1.
Step (4) electrophoresis detection of amplification product
After the reaction is finished, 2-3 mu L of the amplification product is taken, electrophoresis is carried out on 2.0% agarose gel, and a corresponding electrophoresis strip judgment result is obtained according to imaging of a gel imaging system.
The invention has the beneficial effects that: the primer designed by the invention has better inter-species specificity and intra-species conservation, and the reaction can specifically detect a target gene and simultaneously can respectively identify the Shigella foenbergii, the Shigella sonnei and a tetracycline-resistant gene (tetM), so that the method is more convenient and efficient; 1 pair of primers are designed according to the homology of genes of Shigella foex anti-and Shigella sonnei, so that 2 genes can be amplified, and compared with the traditional method, the number of the primers is greatly reduced (2 pairs of primers are needed for amplifying the 2 genes by the traditional method), thereby reducing the occurrence of false positives.
Drawings
FIG. 1 is a tetracycline-resistant Shigella RPA detection profile, wherein M: marker; lane 1: amplifying bands of the shigella foerson in the sample; lane 2: amplifying bands of Shigella sonnei in the sample; lane 3: amplifying a tetracycline resistance gene (tetM) in the sample; lane 4: amplifying bands of Shigella (fof. Fortune. Shigella, shigella sonnei) and tetracycline-resistant gene (tetM) in the sample; lane 5: amplifying bands of Shigella (fof. Fortune. Shigella) and tetracycline-resistant gene (tetM) in the sample; lane 6: amplifying bands of Shigella sonnei and tetracycline-resistant gene (tetM) in the sample; lane 7: amplifying the band by Shigella (fof. Senii, shigella sonnei) in the sample; lane 8: and (5) negative control.
Detailed Description
The invention is further analyzed with reference to the following specific examples.
Example 1.
Step (1) sample pretreatment
A pork sample 25g in the vegetable market is taken, 225mL of sterilized distilled water is added, and the mixture is homogenized for 1min by a tissue homogenizer to obtain a tissue homogenate sample.
Step (2) extraction of sample DNA
Taking 50mg of the tissue homogenate sample treated in the step (1), adding 200 mu l of TE buffer solution with the pH value of 8.0, and uniformly mixing by vortex; adding 400 μ l of lysate, mixing, adding 600 μ l of phenol-chloroform-isoamyl alcohol mixed solvent, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform-isoamylol mixed solvent with the same volume as the supernatant, violently shaking, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform with the same volume as the supernatant, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding isopropanol with the volume of 0.8 times of that of the supernatant, and centrifuging for 10min at 12000 g; collecting precipitate, washing with 70 vol% ethanol for 1 time, air drying at room temperature or 50 deg.C for 20min, and dissolving in 80 μ l TE buffer solution with pH of 8.0 to obtain DNA extract; the DNA extract is template DNA; determining the concentration and purity of the DNA extract by a nucleic acid protein detector;
the phenol-chloroform-isoamyl alcohol mixed solvent is formed by mixing phenol, chloroform and isoamyl alcohol according to the volume ratio of 25:24: 1;
the chloroform-isoamylol mixed solvent is formed by mixing chloroform and isoamylol according to the volume ratio of 24: 1;
the TE buffer solution is 1ml of Tris-Cl with the concentration of 1M and the pH value of 8.0, 0.2ml of EDTA with the concentration of 0.5M and the pH value of 8.0, and the volume is fixed to 100 ml;
the lysis solution is a mixed solution consisting of Tris-HCl, EDTA, naCl, proteinase K and sodium dodecyl sulfate SDS, wherein the concentration of Tris-HCl is 50mM, the pH value is 8.0, the concentration of EDTA is 25mM, the concentration of NaCl is 100mM, the concentration of proteinase K is 20 mu g/mu L, and the mass fraction of sodium dodecyl sulfate SDS is 10%;
step (3) amplification of RPA
And oscillating and uniformly mixing the RPA amplification reaction system, and then carrying out RPA amplification to obtain an amplification product.
The RPA amplification reaction system, namely the RPA gel detection system, is 50 mu L, and consists of a 0.2ml twist Amp Basic reaction tube containing freeze-dried enzyme powder, and added with 29.5 mu L of Rehydration Buffer solution (Rehydration Buffer), 11 mu L of deionized water, 6 mu L (10 mu mol/L) of mixed primers, 1 mu L of extracted sample genome DNA and 2.5 mu L (280 mmol/L) of magnesium acetate solution.
Oscillating and uniformly mixing an RPA amplification reaction system, and then putting the mixture into a constant-temperature metal bath at 37 ℃ for reaction for 25min to obtain an amplification product;
step (4) electrophoresis detection of amplification product
After the reaction is finished, 2-3 mu L of the amplification product is taken and subjected to electrophoresis on 2.0% agarose gel, and a corresponding electrophoresis strip judgment result is obtained according to imaging of a gel imaging system. The result shows that there is a specific band at 186bp, indicating that the sample is contaminated by Shigella foerson.
Example 2.
Step (1) sample pretreatment
Taking 25g of fish meal sample, adding 225mL of sterilized distilled water, and homogenizing for 1min by using a tissue homogenizer to obtain a tissue homogenate sample.
Step (2) sample DNA extraction
Taking 50mg of the tissue homogenate sample treated in the step (1), adding 200 mu l of TE buffer solution with the pH value of 8.0, and uniformly mixing by vortex; adding 400 μ l of lysate, mixing, adding 600 μ l of phenol-chloroform-isoamyl alcohol mixed solvent, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform-isoamylol mixed solvent with the same volume as the supernatant, violently shaking, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform with the same volume as the supernatant, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding isopropanol with the volume of 0.8 times of that of the supernatant, and centrifuging for 10min at 12000 g; collecting precipitate, cleaning with 70 vol% ethanol for 1 time, air drying at room temperature or 50 deg.C for 20min, and dissolving in 80 μ l TE buffer solution with pH of 8.0 to obtain DNA extract; the DNA extract is template DNA; determining the concentration and purity of the template DNA of the DNA extract by a nucleic acid protein detector;
the phenol-chloroform-isoamyl alcohol mixed solvent is formed by mixing phenol, chloroform and isoamyl alcohol according to the volume ratio of 25:24: 1;
the chloroform-isoamyl alcohol mixed solvent is formed by mixing chloroform and isoamyl alcohol according to the volume ratio of 24: 1;
the TE buffer solution is 1ml of Tris-Cl with the concentration of 1M and the pH value of 8.0, 0.2ml of EDTA with the concentration of 0.5M and the pH value of 8.0, and the volume is fixed to 100ml of solution;
the lysis solution is a mixed solution consisting of Tris-HCl, EDTA, naCl, proteinase K and sodium dodecyl sulfate SDS, wherein the concentration of Tris-HCl is 50mM, the pH value is 8.0, the concentration of EDTA is 25mM, the concentration of NaCl is 100mM, the concentration of proteinase K is 20 mu g/mu L, and the mass fraction of sodium dodecyl sulfate SDS is 10%;
step (3) amplification of RPA
And oscillating and uniformly mixing the RPA amplification reaction system, and performing RPA amplification to obtain an amplification product.
The RPA amplification reaction system, namely the RPA gel detection system, is composed of 50 mu L of 0.2ml twist Amp Basic reaction tube containing freeze-dried enzyme powder, and is added with 29.5 mu L of Rehydration Buffer (Rehydration Buffer), 11 mu L of deionized water, 6 mu L (10 mu mol/L) of mixed primer, 1 mu L of extracted sample genome DNA and 2.5 mu L (280 mmol/L) of magnesium acetate solution.
Oscillating and uniformly mixing an RPA amplification reaction system, and then putting the mixture into a constant-temperature metal bath at 37 ℃ for reaction for 25min to obtain an amplification product;
step (4) electrophoresis detection of amplification product
After the reaction is finished, 2-3 mu L of the amplification product is taken, electrophoresis is carried out on 2.0% agarose gel, and a corresponding electrophoresis strip judgment result is obtained according to imaging of a gel imaging system. The result shows that there is a specific band at 253bp, which indicates that the sample is polluted by Shigella sonnei.
Example 3.
Step (1) sample pretreatment
Taking 25g of chicken samples in the vegetable market, adding 225mL of sterilized distilled water, and homogenizing for 1min by using a tissue homogenizer to obtain tissue homogenate samples.
Step (2) sample DNA extraction
Taking 50mg of the tissue homogenate sample treated in the step (1), adding 200 mu l of TE buffer solution with the pH value of 8.0, and uniformly mixing by vortex; adding 400 μ l of lysate, mixing, adding 600 μ l of phenol-chloroform-isoamyl alcohol mixed solvent, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform-isoamylol mixed solvent with the same volume as the supernatant, violently shaking, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform with the same volume as the supernatant, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding isopropanol with the volume of 0.8 times of that of the supernatant, and centrifuging for 10min at 12000 g; collecting precipitate, washing with 70 vol% ethanol for 1 time, air drying at room temperature or 50 deg.C for 20min, and dissolving in 80 μ l TE buffer solution with pH of 8.0 to obtain DNA extract; the DNA extract is template DNA; determining the concentration and purity of the template DNA of the DNA extract by a nucleic acid protein detector;
the phenol-chloroform-isoamylol mixed solvent is formed by mixing phenol, chloroform and isoamylol according to the volume ratio of 25:24: 1;
the chloroform-isoamylol mixed solvent is formed by mixing chloroform and isoamylol according to the volume ratio of 24: 1;
the TE buffer solution is 1ml of Tris-Cl with the concentration of 1M and the pH value of 8.0, 0.2ml of EDTA with the concentration of 0.5M and the pH value of 8.0, and the volume is fixed to 100 ml;
the lysis solution is a mixed solution consisting of Tris-HCl, EDTA, naCl, proteinase K and sodium dodecyl sulfate SDS, wherein the concentration of Tris-HCl is 50mM, the pH value is 8.0, the concentration of EDTA is 25mM, the concentration of NaCl is 100mM, the concentration of proteinase K is 20 mu g/mu L, and the mass fraction of sodium dodecyl sulfate SDS is 10%;
step (3) amplification of RPA
And oscillating and uniformly mixing the RPA amplification reaction system, and performing RPA amplification to obtain an amplification product.
The RPA amplification reaction system, namely the RPA gel detection system, is composed of 50 mu L of 0.2ml twist Amp Basic reaction tube containing freeze-dried enzyme powder, and is added with 29.5 mu L of Rehydration Buffer (Rehydration Buffer), 11 mu L of deionized water, 6 mu L (10 mu mol/L) of mixed primer, 1 mu L of extracted sample genome DNA and 2.5 mu L (280 mmol/L) of magnesium acetate solution.
Oscillating and uniformly mixing an RPA amplification reaction system, and then putting the mixture into a constant-temperature metal bath at 37 ℃ for reaction for 25min to obtain an amplification product;
step (4) electrophoresis detection of amplification product
After the reaction is finished, 2-3 mu L of the amplification product is taken and subjected to electrophoresis on 2.0% agarose gel, and a corresponding electrophoresis strip judgment result is obtained according to imaging of a gel imaging system. The results show a specific band at 534bp, indicating the presence of the tetracycline resistance gene (tetM) in the sample.
Example 4.
Step (1) sample pretreatment
Taking 25g of a potato sample, adding 225mL of sterilized distilled water, and homogenizing for 1min by using a tissue homogenizer to obtain a tissue homogenate sample.
Step (2) sample DNA extraction
Taking 50mg of the tissue homogenate sample treated in the step (1), adding 200 mu l of TE buffer solution with the pH value of 8.0, and uniformly mixing by vortex; adding 400 μ l of lysate, mixing, adding 600 μ l of phenol-chloroform-isoamyl alcohol mixed solvent, shaking vigorously, and centrifuging at 12000g for 10min; taking supernatant, adding chloroform-isoamyl alcohol mixed solvent with the same volume as the supernatant, violently shaking, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform with the same volume as the supernatant, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding isopropanol with the volume of 0.8 times of that of the supernatant, and centrifuging for 10min at 12000 g; collecting precipitate, washing with 70 vol% ethanol for 1 time, air drying at room temperature or 50 deg.C for 20min, and dissolving in 80 μ l TE buffer solution with pH of 8.0 to obtain DNA extract; the DNA extract is template DNA; determining the concentration and purity of the template DNA of the DNA extract by a nucleic acid protein detector;
the phenol-chloroform-isoamyl alcohol mixed solvent is formed by mixing phenol, chloroform and isoamyl alcohol according to the volume ratio of 25:24: 1;
the chloroform-isoamyl alcohol mixed solvent is formed by mixing chloroform and isoamyl alcohol according to the volume ratio of 24: 1;
the TE buffer solution is 1ml of Tris-Cl with the concentration of 1M and the pH value of 8.0, 0.2ml of EDTA with the concentration of 0.5M and the pH value of 8.0, and the volume is fixed to 100 ml;
the lysis solution is a mixed solution consisting of Tris-HCl, EDTA, naCl, proteinase K and sodium dodecyl sulfate SDS, wherein the concentration of Tris-HCl is 50mM, the pH value is 8.0, the concentration of EDTA is 25mM, the concentration of NaCl is 100mM, the concentration of proteinase K is 20 mu g/mu L, and the mass fraction of sodium dodecyl sulfate SDS is 10%;
step (3) amplification of RPA
And oscillating and uniformly mixing the RPA amplification reaction system, and performing RPA amplification to obtain an amplification product.
The RPA amplification reaction system, namely the RPA gel detection system, is 50 mu L, and consists of a 0.2ml twist Amp Basic reaction tube containing freeze-dried enzyme powder, and added with 29.5 mu L of Rehydration Buffer solution (Rehydration Buffer), 11 mu L of deionized water, 6 mu L (10 mu mol/L) of mixed primers, 1 mu L of extracted sample genome DNA and 2.5 mu L (280 mmol/L) of magnesium acetate solution.
Oscillating and uniformly mixing an RPA amplification reaction system, and then putting the mixture into a constant-temperature metal bath at 37 ℃ for reaction for 25min to obtain an amplification product;
step (4) electrophoresis detection of amplification product
After the reaction is finished, 2-3 mu L of the amplification product is taken, electrophoresis is carried out on 2.0% agarose gel, and a corresponding electrophoresis strip judgment result is obtained according to imaging of a gel imaging system. The results showed that there were specific bands at 186bp and 534bp, indicating the presence of Shigella fowardii, tetracycline-resistant gene (tetM) in the sample.
Example 5.
Step (1) sample pretreatment
Taking 25g of macaroni sample, adding 225mL of sterilized distilled water, and homogenizing for 1min by using a tissue homogenizer to obtain a tissue homogenate sample.
Step (2) sample DNA extraction
Taking 50mg of the tissue homogenate sample treated in the step (1), adding 200 mu l of TE buffer solution with the pH value of 8.0, and uniformly mixing by vortex; adding 400 μ l of lysate, mixing, adding 600 μ l of phenol-chloroform-isoamyl alcohol mixed solvent, shaking vigorously, and centrifuging at 12000g for 10min; taking supernatant, adding chloroform-isoamyl alcohol mixed solvent with the same volume as the supernatant, violently shaking, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform with the same volume as the supernatant, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding isopropanol with the volume of 0.8 times of that of the supernatant, and centrifuging for 10min at 12000 g; collecting precipitate, cleaning with 70 vol% ethanol for 1 time, air drying at room temperature or 50 deg.C for 20min, and dissolving in 80 μ l TE buffer solution with pH of 8.0 to obtain DNA extract; the DNA extract is template DNA; determining the concentration and purity of the template DNA of the DNA extract by a nucleic acid protein detector;
the phenol-chloroform-isoamyl alcohol mixed solvent is formed by mixing phenol, chloroform and isoamyl alcohol according to the volume ratio of 25:24: 1;
the chloroform-isoamyl alcohol mixed solvent is formed by mixing chloroform and isoamyl alcohol according to the volume ratio of 24: 1;
the TE buffer solution is 1ml of Tris-Cl with the concentration of 1M and the pH value of 8.0, 0.2ml of EDTA with the concentration of 0.5M and the pH value of 8.0, and the volume is fixed to 100ml of solution;
the lysis solution is a mixed solution consisting of Tris-HCl, EDTA, naCl, proteinase K and sodium dodecyl sulfate SDS, wherein the concentration of Tris-HCl is 50mM, the pH value is 8.0, the concentration of EDTA is 25mM, the concentration of NaCl is 100mM, the concentration of proteinase K is 20 mu g/mu L, and the mass fraction of sodium dodecyl sulfate SDS is 10%;
step (3) amplification of RPA
And oscillating and uniformly mixing the RPA amplification reaction system, and then carrying out RPA amplification to obtain an amplification product.
The RPA amplification reaction system, namely the RPA gel detection system, is composed of 50 mu L of 0.2ml twist Amp Basic reaction tube containing freeze-dried enzyme powder, and is added with 29.5 mu L of Rehydration Buffer (Rehydration Buffer), 11 mu L of deionized water, 6 mu L (10 mu mol/L) of mixed primer, 1 mu L of extracted sample genome DNA and 2.5 mu L (280 mmol/L) of magnesium acetate solution.
Oscillating and uniformly mixing an RPA amplification reaction system, and then putting the mixture into a constant-temperature metal bath at 37 ℃ for reaction for 25min to obtain an amplification product;
step (4) electrophoresis detection of amplification product
After the reaction is finished, 2-3 mu L of the amplification product is taken and subjected to electrophoresis on 2.0% agarose gel, and a corresponding electrophoresis strip judgment result is obtained according to imaging of a gel imaging system. The results showed that there were specific bands at 253bp and 534bp, indicating the presence of Shigella sonnei, tetracycline resistance gene (tetM) in this sample.
Example 6.
Step (1) sample pretreatment
Taking 25g of shrimp sample, adding 225mL of sterilized distilled water, and homogenizing for 1min by using a tissue homogenizer to obtain a tissue homogenate sample.
Step (2) extraction of sample DNA
Taking 50mg of the tissue homogenate sample treated in the step (1), adding 200 mu l of TE buffer solution with the pH value of 8.0, and uniformly mixing by vortex; adding 400 μ l of lysis solution, mixing, adding 600 μ l of phenol-chloroform-isoamyl alcohol mixed solvent, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform-isoamylol mixed solvent with the same volume as the supernatant, violently shaking, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform with the same volume as the supernatant, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding isopropanol with the volume of 0.8 times of that of the supernatant, and centrifuging for 10min at 12000 g; collecting precipitate, washing with 70 vol% ethanol for 1 time, air drying at room temperature or 50 deg.C for 20min, and dissolving in 80 μ l TE buffer solution with pH of 8.0 to obtain DNA extract; the DNA extract is template DNA; determining the concentration and purity of the template DNA of the DNA extract by a nucleic acid protein detector;
the phenol-chloroform-isoamyl alcohol mixed solvent is formed by mixing phenol, chloroform and isoamyl alcohol according to the volume ratio of 25:24: 1;
the chloroform-isoamyl alcohol mixed solvent is formed by mixing chloroform and isoamyl alcohol according to the volume ratio of 24: 1;
the TE buffer solution is 1ml of Tris-Cl with the concentration of 1M and the pH value of 8.0, 0.2ml of EDTA with the concentration of 0.5M and the pH value of 8.0, and the volume is fixed to 100ml of solution;
the lysis solution is a mixed solution consisting of Tris-HCl, EDTA, naCl, proteinase K and sodium dodecyl sulfate SDS, wherein the concentration of Tris-HCl is 50mM, the pH value is 8.0, the concentration of EDTA is 25mM, the concentration of NaCl is 100mM, the concentration of proteinase K is 20 mu g/mu L, and the mass fraction of sodium dodecyl sulfate SDS is 10%;
step (3). Amplification of RPA
And oscillating and uniformly mixing the RPA amplification reaction system, and performing RPA amplification to obtain an amplification product.
The RPA amplification reaction system, namely the RPA gel detection system, is composed of 50 mu L of 0.2ml twist Amp Basic reaction tube containing freeze-dried enzyme powder, and is added with 29.5 mu L of Rehydration Buffer (Rehydration Buffer), 11 mu L of deionized water, 6 mu L (10 mu mol/L) of mixed primer, 1 mu L of extracted sample genome DNA and 2.5 mu L (280 mmol/L) of magnesium acetate solution.
Oscillating and uniformly mixing an RPA amplification reaction system, and then putting the mixture into a constant-temperature metal bath at 37 ℃ for reaction for 25min to obtain an amplification product;
step (4) electrophoresis detection of amplification product
After the reaction is finished, 2-3 mu L of the amplification product is taken, electrophoresis is carried out on 2.0% agarose gel, and a corresponding electrophoresis strip judgment result is obtained according to imaging of a gel imaging system. The results showed that there were specific bands at 186bp,253bp and 534bp, indicating the presence of Shigella foecalitis, shigella sonnei and tetracycline resistance gene (tetM) in the sample.
Example 7.
Step (1) sample pretreatment
Taking 25g of shrimp sample, adding 225mL of sterilized distilled water, and homogenizing for 1min by using a tissue homogenizer to obtain a tissue homogenate sample.
Step (2) sample DNA extraction
Taking 50mg of the tissue homogenate sample treated in the step (1), adding 200 mu l of TE buffer solution with the pH value of 8.0, and uniformly mixing by vortex; adding 400 μ l of lysate, mixing, adding 600 μ l of phenol-chloroform-isoamyl alcohol mixed solvent, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform-isoamylol mixed solvent with the same volume as the supernatant, violently shaking, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform with the same volume as the supernatant, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding isopropanol with the volume of 0.8 times of that of the supernatant, and centrifuging for 10min at 12000 g; collecting precipitate, washing with 70 vol% ethanol for 1 time, air drying at room temperature or 50 deg.C for 20min, and dissolving in 80 μ l TE buffer solution with pH of 8.0 to obtain DNA extract; the DNA extract is template DNA; determining the concentration and purity of the DNA extract by a nucleic acid protein detector;
the phenol-chloroform-isoamylol mixed solvent is formed by mixing phenol, chloroform and isoamylol according to the volume ratio of 25:24: 1;
the chloroform-isoamylol mixed solvent is formed by mixing chloroform and isoamylol according to the volume ratio of 24: 1;
the TE buffer solution is 1ml of Tris-Cl with the concentration of 1M and the pH value of 8.0, 0.2ml of EDTA with the concentration of 0.5M and the pH value of 8.0, and the volume is fixed to 100ml of solution;
the lysis solution is a mixed solution consisting of Tris-HCl, EDTA, naCl, proteinase K and sodium dodecyl sulfate SDS, wherein the concentration of Tris-HCl is 50mM, the pH value is 8.0, the concentration of EDTA is 25mM, the concentration of NaCl is 100mM, the concentration of proteinase K is 20 mu g/mu L, and the mass fraction of sodium dodecyl sulfate SDS is 10%;
step (3) amplification of RPA
And oscillating and uniformly mixing the RPA amplification reaction system, and performing RPA amplification to obtain an amplification product.
The RPA amplification reaction system, namely the RPA gel detection system, is 50 mu L, and consists of a 0.2ml twist Amp Basic reaction tube containing freeze-dried enzyme powder, and added with 29.5 mu L of Rehydration Buffer solution (Rehydration Buffer), 11 mu L of deionized water, 6 mu L (10 mu mol/L) of mixed primers, 1 mu L of extracted sample genome DNA and 2.5 mu L (280 mmol/L) of magnesium acetate solution.
Oscillating and uniformly mixing an RPA amplification reaction system, and then putting the mixture into a constant-temperature metal bath at 37 ℃ for reaction for 25min to obtain an amplification product;
step (4) electrophoresis detection of amplification product
After the reaction is finished, 2-3 mu L of the amplification product is taken and subjected to electrophoresis on 2.0% agarose gel, and a corresponding electrophoresis strip judgment result is obtained according to imaging of a gel imaging system. The result shows that no specific band indicates that the sample is free of Shigella foenbergii, shigella sonnei and tetracycline-resistant gene (tetM).
Example 8.
Step (1) sample pretreatment
A shrimp sample (25 g) was taken, and then, 225mL of sterilized distilled water was added thereto, followed by homogenization in a tissue homogenizer for 1min to obtain a tissue homogenate sample.
Step (2) extraction of sample DNA
Taking 50mg of the tissue homogenate sample treated in the step (1), adding 200 mu l of TE buffer solution with the pH value of 8.0, and uniformly mixing by vortex; adding 400 μ l of lysate, mixing, adding 600 μ l of phenol-chloroform-isoamyl alcohol mixed solvent, shaking vigorously, and centrifuging at 12000g for 10min; taking supernatant, adding chloroform-isoamyl alcohol mixed solvent with the same volume as the supernatant, violently shaking, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform with the same volume as the supernatant, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding isopropanol with the volume of 0.8 times of that of the supernatant, and centrifuging for 10min at 12000 g; collecting precipitate, cleaning with 70 vol% ethanol for 1 time, air drying at room temperature or 50 deg.C for 20min, and dissolving in 80 μ l TE buffer solution with pH of 8.0 to obtain DNA extract; the DNA extract is template DNA; determining the concentration and purity of the template DNA of the DNA extract by a nucleic acid protein detector;
the phenol-chloroform-isoamyl alcohol mixed solvent is formed by mixing phenol, chloroform and isoamyl alcohol according to the volume ratio of 25:24: 1;
the chloroform-isoamylol mixed solvent is formed by mixing chloroform and isoamylol according to the volume ratio of 24: 1;
the TE buffer solution is 1ml of Tris-Cl with the concentration of 1M and the pH value of 8.0, 0.2ml of EDTA with the concentration of 0.5M and the pH value of 8.0, and the volume is fixed to 100ml of solution;
the lysis solution is a mixed solution consisting of Tris-HCl, EDTA, naCl, proteinase K and sodium dodecyl sulfate SDS, wherein the concentration of Tris-HCl is 50mM, the pH value is 8.0, the concentration of EDTA is 25mM, the concentration of NaCl is 100mM, the concentration of proteinase K is 20 mu g/mu L, and the mass fraction of sodium dodecyl sulfate SDS is 10%;
step (3). Amplification of RPA
And oscillating and uniformly mixing the RPA amplification reaction system, and performing RPA amplification to obtain an amplification product.
The RPA amplification reaction system, namely the RPA gel detection system, is 50 mu L, and consists of a 0.2ml twist Amp Basic reaction tube containing freeze-dried enzyme powder, and added with 29.5 mu L of Rehydration Buffer solution (Rehydration Buffer), 11 mu L of deionized water, 6 mu L (10 mu mol/L) of mixed primers, 1 mu L of extracted sample genome DNA and 2.5 mu L (280 mmol/L) of magnesium acetate solution.
Oscillating and uniformly mixing an RPA amplification reaction system, and then putting the mixture into a constant-temperature metal bath at 37 ℃ for reaction for 25min to obtain an amplification product;
step (4) electrophoresis detection of amplification product
After the reaction is finished, 2-3 mu L of the amplification product is taken, electrophoresis is carried out on 2.0% agarose gel, and a corresponding electrophoresis strip judgment result is obtained according to imaging of a gel imaging system. The result shows that specific bands are positioned at 186bp and 253bp, which indicates that Shigella foenbergii and Shigella sonnei exist in the sample.
Claims (4)
1. For shigella bacteria (Shigella Castellani) And a primer for rapidly detecting the RPA of the tetracycline drug-resistant gene, which is characterized by comprising two pairs of specific primers, specifically comprising:
F1: 5’- GACAGGGATATATTATCTGGCGCCAGTTTATT -3’；
R1: 5’- GATTAGCGACCAAAAAGGAGCCTTAAGAAAGA -3’；
F2: 5’- GAGGACGGATAATACGCTTTTAGAACGTCAGA -3’；
R2: 5’- CCGTGATAAACAGGGAACAGGGAACAATTATG -3’。
2. the primer for rapid RPA detection of Shigella and tetracycline resistance genes of claim 1, wherein the target fragments after amplification have different lengths and sizes, shigella fokinsonii (f: (f))Shigella flexneri) Expanding deviceThe size of the product after the increase is 186bp, shigella sonnei: (Shigella sonnei) The size of the product after amplification is 253bp, and the size of the product after amplification of the tetracycline drug-resistant gene tetM is 534bp, and the products can be separated and distinguished through electrophoresis.
3. The primer for rapid RPA detection of Shigella and tetracycline-resistant genes as claimed in claim 2, wherein the primer for detection of Shigella foiensis, shigella sonnei and tetracycline-resistant gene tetM comprises the following steps:
step (1) sample pretreatment
Sampling 25g, adding 225mL of sterilized distilled water, and homogenizing for 1min by using a tissue homogenizer to obtain a tissue homogenate sample;
step (2) sample DNA extraction
Taking 50mg of the tissue homogenate sample treated in the step (1), adding 200 mul of TE buffer solution with the pH value of 8.0, and uniformly mixing by vortex; adding 400 mul of lysate, uniformly mixing, adding 600 mul of phenol-chloroform-isoamyl alcohol mixed solvent, violently oscillating, and centrifuging at 12000g for 10min; taking supernatant, adding chloroform-isoamyl alcohol mixed solvent with the same volume as the supernatant, violently shaking, and centrifuging at 12000g for 10min; taking the supernatant, adding chloroform with the same volume as the supernatant, shaking vigorously, and centrifuging at 12000g for 10min; taking the supernatant, adding isopropanol with the volume of 0.8 times of that of the supernatant, and centrifuging for l 0min at 12000 g; taking the precipitate, washing the precipitate for 1 time by using ethanol with the volume content of 70%, then airing the precipitate for 20min at normal temperature or 50 ℃, and then adding 80 mul of TE buffer solution with the pH value of 8.0 to dissolve the precipitate to obtain a DNA extract; the DNA extract is template DNA; determining the concentration and purity of the template DNA of the DNA extract by a nucleic acid protein detector;
the phenol-chloroform-isoamyl alcohol mixed solvent is prepared from phenol, chloroform and isoamyl alcohol according to the volume ratio of 25:24:1, mixing;
the chloroform-isoamyl alcohol mixed solvent is prepared from chloroform and isoamyl alcohol according to the volume ratio of 24:1, mixing;
the TE buffer solution is 1ml of Tris-Cl with the concentration of 1M and the pH value of 8.0, 0.2ml of EDTA with the concentration of 0.5M and the pH value of 8.0, and the volume is fixed to 100 ml;
the lysis solution is a mixed solution consisting of Tris-HCl, EDTA, naCl, proteinase K and sodium dodecyl sulfate SDS, wherein the concentration of the Tris-HCl is 50mM, the pH value is 8.0, the concentration of the EDTA is 25mM, the concentration of the NaCl is 100mM, the concentration of the proteinase K is 20 mug/mug L, and the mass fraction of the sodium dodecyl sulfate SDS is 10%;
step (3) amplification of RPA
Oscillating and uniformly mixing an RPA amplification reaction system, and performing RPA amplification to obtain an amplification product;
the RPA amplification reaction system, namely the RPA gel detection system is 50 mu L and consists of a Rehydration Buffer solution (Rehydration Buffer) 29.5 mu L, deionized water 11 mu L, a mixed primer 6 mu L (10 mu mol/L), extracted sample genome DNA 1 mu L and an extracted magnesium acetate solution 2.5 mu L (280 mmol/L) which are added into a 0.2ml TwistAmp Basic reaction tube containing freeze-dried enzyme powder;
oscillating and uniformly mixing an RPA amplification reaction system, and then putting the mixture into a constant-temperature metal bath at 37 ℃ for reaction for 25min to obtain an amplification product;
the added mixed primers are mixed primers of 2 pairs of specific primers, wherein the concentration ratio of the 2 pairs of specific primers is F1: R1: F2: R2= 2;
step (4) electrophoresis detection of amplification product
After the reaction is finished, 2-3 mu L of the amplification product is taken and subjected to electrophoresis on 2.0% agarose gel, and a corresponding electrophoresis strip judgment result is obtained according to imaging of a gel imaging system.
4. The primers for rapid detection of RPA of Shigella and tetracycline resistant genes of claim 3, wherein the sample is pork or chicken.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710126445.8A CN107058514B (en) | 2017-02-23 | 2017-02-23 | Primer for rapid detection of RPA of Shigella and tetracycline drug-resistant gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710126445.8A CN107058514B (en) | 2017-02-23 | 2017-02-23 | Primer for rapid detection of RPA of Shigella and tetracycline drug-resistant gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107058514A CN107058514A (en) | 2017-08-18 |
| CN107058514B true CN107058514B (en) | 2022-11-11 |
Family
ID=59622037
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710126445.8A Active CN107058514B (en) | 2017-02-23 | 2017-02-23 | Primer for rapid detection of RPA of Shigella and tetracycline drug-resistant gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107058514B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115786549A (en) * | 2022-10-31 | 2023-03-14 | 宁波大学 | Primer and probe sequence for detecting tigecycline drug-resistant gene tet (X) RPA and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845493A (en) * | 2010-01-29 | 2010-09-29 | 华南农业大学 | Primer for detection of shigella and detection method |
| CN103451307A (en) * | 2013-09-17 | 2013-12-18 | 北京卓诚惠生生物科技有限公司 | Shigella flora/serotype multiplex-PCR (polymerase chain reaction) detection primer set and kit |
| WO2016040595A1 (en) * | 2014-09-11 | 2016-03-17 | Agrofresh Inc. | Methods for pathogen detection and disease management on meats, plants, or plant parts |
-
2017
- 2017-02-23 CN CN201710126445.8A patent/CN107058514B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845493A (en) * | 2010-01-29 | 2010-09-29 | 华南农业大学 | Primer for detection of shigella and detection method |
| CN103451307A (en) * | 2013-09-17 | 2013-12-18 | 北京卓诚惠生生物科技有限公司 | Shigella flora/serotype multiplex-PCR (polymerase chain reaction) detection primer set and kit |
| WO2016040595A1 (en) * | 2014-09-11 | 2016-03-17 | Agrofresh Inc. | Methods for pathogen detection and disease management on meats, plants, or plant parts |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107058514A (en) | 2017-08-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JAMSHIDI et al. | Identification of Salmonella spp. and Salmonella typhimurium by a multiplex PCR-based assay from poultry carcasses in Mashhad-Iran | |
| Huang et al. | Development of a rapid Salmonella detection method via phage-conjugated magnetic bead separation coupled with real-time PCR quantification | |
| Yang et al. | Robustness of Salmonella loop‐mediated isothermal amplification assays for food applications | |
| Wei et al. | Development and application of a multiplex PCR assay for rapid detection of 4 major bacterial pathogens in ducks | |
| Marfell et al. | Global gene expression profiling of monocyte-derived macrophages from red deer (Cervus elaphus) genotypically resistant or susceptible to Mycobacterium avium subspecies paratuberculosis infection | |
| CN101613745B (en) | Staphylococcus aureus multiple PCR-MIX rapid detection kit and detection method thereof | |
| Davis et al. | Evaluation of Fourier transform infrared (FT-IR) spectroscopy and chemometrics as a rapid approach for sub-typing Escherichia coli O157: H7 isolates | |
| Chahorm et al. | Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods | |
| CN107058514B (en) | Primer for rapid detection of RPA of Shigella and tetracycline drug-resistant gene | |
| Tsai et al. | Development of a multiplex polymerase chain reaction to detect five common Gram‐negative bacteria of aquatic animals | |
| CN106893779B (en) | Primer for rapid detection of salmonella RPA carrying sulfonamide resistance gene and application thereof | |
| CN108950029A (en) | The multiple PCR detection primer and detection method of Escherichia coli O 157 | |
| Adi et al. | Multiplex quantification of Escherichia coli, Salmonella typhi and Vibrio cholera with three DNA targets in single reaction assay | |
| CN108893526A (en) | A kind of Cryptosporidum parvum fluorescence LAMP detection method | |
| JP2003164282A (en) | Method for detecting microorganism and primer set for detecting the same | |
| Pannuch et al. | Quantification of enteropathogenic Escherichia coli from retailed meats. | |
| Seel et al. | Molecular detection and characterization of Salmonella spp. isolated from fresh fishes sold in selected upazila markets of Bangladesh. | |
| CN104372078A (en) | HDA primers of clostridium perfringens in food and application method thereof | |
| CN104152555B (en) | The heavy PCR reaction kit of milk cow pathogenic bacterium five | |
| Oslan et al. | Rapid and sensitive detection of Salmonella in agro-Food and environmental samples: A review of advances in rapid tests and biosensors | |
| Chac et al. | Proteomic changes in bacteria caused by exposure to environmental conditions can be detected by Matrix-Assisted Laser Desorption/Ionization–Time of Flight (MALDI-ToF) Mass Spectrometry | |
| Chowdhury et al. | Purification, extraction and visualization of lipopolysaccharide of Escherichia coli from urine samples of patients with urinary tract infection | |
| CN103014024B (en) | Target gene for detecting citrobacter freundii and detection kit | |
| Martinez et al. | Characterization of Shiga toxigenic Escherichia coli isolated from foods | |
| Sun et al. | Rapid Detection of Diarrheagenic Escherichia coli by a New Multiplex Real-Time Quantitative PCR Assay |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |