CN107058229A - The antitryptic recombinant cell strains of one kind expression people α 1 and its application - Google Patents
The antitryptic recombinant cell strains of one kind expression people α 1 and its application Download PDFInfo
- Publication number
- CN107058229A CN107058229A CN201710011332.3A CN201710011332A CN107058229A CN 107058229 A CN107058229 A CN 107058229A CN 201710011332 A CN201710011332 A CN 201710011332A CN 107058229 A CN107058229 A CN 107058229A
- Authority
- CN
- China
- Prior art keywords
- people
- antitrypsin
- cell
- plasmid
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/81—Protease inhibitors
- C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
- C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
- C07K14/8121—Serpins
- C07K14/8125—Alpha-1-antitrypsin
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to biological technical field, a kind of expression people α is specifically disclosed1Antitryptic cell line and its application.The recombinant cell is specifically by people α1Antitryptic Gene targeting cuts off selection markers to the AAVS1 sites of No. 19 chromosomes of body cell, and acquisition has cut off selection markers and stable expression recombinant alpha1Antitryptic body cell.People α in the recombinant cell strain1Antitrypsin gene is pinpointed is inserted into the AAVS1 sites of No. 19 chromosomes of people, it is to avoid caused by traditional gene radom insertion the problems such as gene silencing;The cell line can express people α1Antitrypsin, the people α of gained1‑Antitryptic 26S Proteasome Structure and Function is more closely similar to natural α1Antitrypsin, is more beneficial for people α1The promotion and application of antitrypsin preparation.
Description
Technical field
The present invention relates to biological technical field, in particular it relates to a kind of recombinant cell strain for expressing people's alpha1-antitrypsin
And its application.
Background technology
People α1- antitrypsin deficiency disease (AATD) is a kind of worldwide genetic disease, is that single gene mutation causes
Autosome codominant inheritance, be mainly shown as pulmonary emphysema, hepatic sclerosis, liver cancer, minority is presented as disease of skin panniculitis etc..
The treatment of AATD patient needs to rely on i.v. intermittent people α1- antitrypsin preparation.
At present, the people α of Clinical practice1Main purified by human plasma of-antitrypsin preparation obtains, large quantities of which has limited its
Amount production, result in people α1Supply falls short of demand for-antitrypsin preparation, expensive, and only some patientss, which are had ready conditions, uses.Except this
Outside, due to the limitation of diagnostic techniques, most AATD patients do not obtain efficient diagnosis so far, so entering with diagnostic techniques
Step, people α1The demand of-antitrypsin preparation certainly will will be further increased.However, human plasma resource provisioning is limited, blood govern
Starch the people α of purified source1The supply of-antitrypsin preparation, needs exploitation recombinant human alpha badly1- antitrypsin product.At present, generation
Medicinal recombinant human alpha is there is no in boundary1- antitrypsin product is produced.
The content of the invention
There is provided a kind of restructuring for expressing people's alpha1-antitrypsin is thin in order to overcome the above-mentioned deficiency of prior art by the present invention
Born of the same parents' strain.
It is a further object to provide a kind of application for the recombinant cell strain for expressing people's alpha1-antitrypsin.
To achieve these goals, the present invention is achieved by the following technical programs:
A kind of construction method for the recombinant cell strain for expressing people's alpha1-antitrypsin, comprises the following steps:
(1) acquisition alpha1-antitrypsin containing people gene order, riddled basins sequence, AAVS1 sites are left and right homologous
The expression plasmid of arm sequence, the gene order of people's alpha1-antitrypsin described in expression plasmid, riddled basins sequence are described
Between the left and right homology arm in AAVS1 sites;A LoxP sequence is inserted in the both sides of riddled basins respectively in expression plasmid
Row, and the direction of the two LoxP sequences is consistent, the recombinant plasmid for the expression people's alpha1-antitrypsin transformed;
(2) recombinant plasmid for the expression people's alpha1-antitrypsin for transforming step (1) and targeting AAVS1 sites
The body cell of CRISPR/Cas9 plasmid co-transfection people, screening obtains the body cell of site-directed integration;
(3) to express the body cell for the site-directed integration that the plasmid transfection step (2) of Cre enzymes is obtained, Cre/LoxP systems are passed through
System excision selection markers, screening acquisition has cut off selection markers and stable expression recombinant alpha1The strain of-antitryptic body cell.
The cell line of the present invention is realized by CRISPR/Cas9 gene editing technology combinations homologous recombination.Wherein
CRISPR/Cas9 target sequence is in the genome AAVS1 sites of people, and target sequence is GGGGCCACTAGGGACAGGAT.When
After CRISPR/Cas9 plasmids and improved expression vector cotransfection body cell, CRISPR/Cas9 systems are sheared at target site
DNA, forms double-strand breach.In the case where there is the target gene carrier containing homology arm, double-strand breach enters using it as template
Row homologous recombination repair, realizes fixed point insertion of the target gene at target spot.
In the present invention, the AAVS1 sites of human genome are located at the introne of the PPP1R12C genes of No. 19 chromosomes of people
In;People's alpha1-antitrypsin has such as SEQ ID NO:Amino acid sequence shown in 1, the gene of people's alpha1-antitrypsin
With such as SEQ ID NO:Nucleotide sequence shown in 2.
The gene order of alpha1-antitrypsin containing people, riddled basins sequence, AAVS1 sites are left and right described in step (1)
The expression plasmid of homology arm sequence, can be built by clone technology, can also directly use commercialized product plasmid.
Preferably, the gene order of alpha1-antitrypsin containing people, riddled basins sequence, AAVS1 sites are left and right same described in step (1)
The expression plasmid of source arm sequence is Genome-TALERTMArticle No. is DC-DON-SH01 AAVS1 donor clone carriers.
Preferably, the LoxP sequences such as SEQ ID NO:Shown in 4.
AAVS1 sites exist in all people's cell, so all types of people's cells can be entered by this method
Row gene editing, simply expressing quantity may be different.Preferably, the body cell for the people that selection has been commercially produced is made
For recipient cell, industrial production of being more convenient for, most preferably, the body cell of the people is HEK293 cells or PER.C6 cells.Especially
It is HEK293 cells, and the amount of its express express target protein is especially good, in addition, people's alpha1-antitrypsin of cell line expression
26S Proteasome Structure and Function is more closely similar to natural alpha1-antitrypsin, is more beneficial for the popularization of people's alpha1-antitrypsin preparation and answers
With.
Preferably, in the preparation method for the recombinant cell strain that the present invention is provided, the riddled basins in step (1)
It is made up of fluorescent reporter gene and drug resistance gene.It is glimmering in the riddled basins in certain embodiments of the present invention
Light reporter gene is GFP genes, and drug resistance gene is anti-puromycin gene.
In some embodiments of the invention, in the preparation method for the recombinant cell strain that the present invention is provided, institute in step (1)
State people's alpha1-antitrypsin gene, riddled basins, the left and right homology arm in AAVS1 sites, LoxP arrangement mode it is specific
For:The left homology arm in AAVS1 sites, the gene of expression people's alpha1-antitrypsin, LoxP, GFP gene, anti-puromycin gene,
The right homology arm in LoxP, AAVS1 site is arranged in order;And the two LoxP direction of insertion is identical.
In some embodiments of the invention, step (1) concretely comprises the following steps in the preparation method that the present invention is provided:Take
Genome-CRISPTMHuman AAVS1Safe Harbor Gene Knock-in Kits (GeneCopoeia, Inc.) product
Contain each 800bp's in AAVS1 target spots both sides or so in people's alpha1-antitrypsin expression plasmid in DC-DON-SH01, the plasmid
Homology arm;And two include people's alpha1-antitrypsin gene with controlling element between homology arm and (express the anti-pancreas eggs of people α 1-
The gene of white enzyme), the GFP genes of T2A connections and anti-puromycin gene (gene that i.e. expression screening is marked);The plasmid is entered
The following transformation of row:A LoxP sequence in the same direction is inserted in the gene both sides marked in the expression screening of above-mentioned plasmid respectively.
Preferably, in the preparation method for the recombinant cell strain that the present invention is provided, targeting AAVS1 sites in step (2)
The target sequence of CRISPR/Cas9 carrier such as SEQ ID NO:Shown in 3.In some embodiments of the invention, target used
To the Genome-CRISP that the CRISPR/Cas9 in AAVS1 sites carrier is plasmid, more specifically GeneCopoeia companiesTMMatter
Grain.
In the other embodiment of the present invention, in the preparation method that the present invention is provided, the sieve is obtained in step (3)
Screening technique used in the positive cell line of choosing mark is specially:First pass through puromycin screen 48 hours, after by green it is glimmering
Light GFP screens single cell clone, eventually passes No. 19 chromosomes of the interface PCR checking Gene targetings in HEK293 cells
AAVS1 sites, are produced.
In the other embodiment of the present invention, in the preparation method that the present invention is provided, the sieve is obtained in step 3
Screening technique used in the negative cell line of choosing mark is specially:The cell line for taking the selection markers positive, transfection expression Cre
The plasmid of enzyme, is cloned by screening GFP negative cells, and by containing expression people's alpha1-antitrypsin in PCR checking genomes
Gene and without GFP and anti-puromycin gene, that is, obtain without selection markers, stable expression people's alpha1-antitrypsin
Recombinant cell strain.
The preparation for the recombinant cell strain that the present invention is provided is by CRISPR/Cas9 gene editing technology combination homologous recombinations
Realize.Wherein, CRISPR/Cas9 target sequence is in the genome AAVS1 sites of people, when CRISPR/Cas9 plasmids and containing institute
State the left and right homology arm of the gene, the gene of expression screening mark and the AAVS1 sites of expression people's alpha1-antitrypsin
After expression vector cotransfection HEK293 cells, CRISPR/Cas9 systems shear DNA at target site, form double-strand breach;Depositing
In the case of the expression vector containing homology arm, double-strand breach carries out homologous recombination repair, realizes mesh using it as template
Gene at target spot fixed point insertion.Cell after transfection is screened by puromycin, obtains transgenic cell.Transgenosis is thin
Born of the same parents carry out the screening of GFP positive cells monoclonal by limiting dilution.The cell monoclonal obtained is screened to examine by PCR, it is determined that
Whether genetic recombination is there occurs at target site, so as to exclude random integration clone.Sieved afterwards by expressing the plasmid pair of Cre enzymes
Select obtained cell line to be transfected again, screening has cut off the cell monoclonal of selection markers, that is, obtain be free of selection markers,
The antitryptic cell lines of stable express alpha 1-.
The body cell for the recombined human that construction method as described above is prepared is in secreting, expressing people's alpha1-antitrypsin
Using.In the recombinant cell strain prepared by the construction method of the present invention, people's alpha1-antitrypsin is gene site-directed to be inserted into people
The AAVS1 sites of No. 19 chromosome, the cell line can express people's alpha1-antitrypsin, available for the anti-pancreases of Prepare restructuring people α 1-
Protease.
It is highly preferred that a kind of construction method for the recombinant cell strain for expressing people's alpha1-antitrypsin, including following step
Suddenly:
(1) in Genome-TALERTMArticle No. is the riddled basins of DC-DON-SH01 AAVS1 donor clone carriers
Both sides insert a LoxP sequence respectively, and the direction of the two LoxP sequences is consistent, the anti-pancreases of expression people α 1- transformed
The recombinant plasmid of protease, LoxP sequences such as SEQ ID NO:Shown in 4;
(2) recombinant plasmid for transforming step (1) is with the CRISPR/Cas9 plasmid co-transfection people's in targeting AAVS1 sites
Body cell, screening obtains the body cell of site-directed integration, and the CRISPR/Cas9 plasmids in targeting AAVS1 sites are public for GeneCopoeia
The Genome-CRISP of departmentTMPlasmid;
(3) to express the body cell for the site-directed integration that the plasmid transfection step (2) of Cre enzymes is obtained, Cre/LoxP systems are passed through
System excision selection markers, screening acquisition has cut off selection markers and stable expression recombinant alpha1The strain of-antitryptic body cell.
Preferably, the method for recombinant cell strain secreting, expressing people's alpha1-antitrypsin is to cultivate the recombinant cell
Strain to cell density is 75%~95%, changes culture medium, continues to cultivate 20h~28h, collects supernatant, produce.
In some embodiments of the invention, the method that the present invention provides people's alpha1-antitrypsin, is specifically included:It incite somebody to action this
The recombinant cell strain HEK293 that invention is provided is placed in the culture environment of suitable cell growth, makes the cell length to 90%, more
Change serum free medium to continue to cultivate 24 hours, collect cell conditioned medium, produce.
Compared with prior art, the present invention has the advantages that:
The people α that the present invention is realized by the CRISPR/Cas9 homologous recombination techniques aided in1- antitrypsin gene is in people
Body cell genome AAVS1 sites fixed point restructuring, while eliminate selection markers, acquisition has cut off selection markers and steady
Surely recombinant alpha is expressed1- antitryptic body cell.The method can make recombinant human alpha1- antitrypsin constitutive expression, it is to avoid
The phenomenons such as gene expression decay, silence.With the body cell of people, especially HEK293 cells for host, the recombinant alpha of expression1- anti-
The 26S Proteasome Structure and Function of trypsase is more closely similar to natural α1- antitrypsin, is more beneficial for people's alpha1-antitrypsin preparation
Promotion and application.
Brief description of the drawings
Fig. 1 is schematic diagram before and after the expression plasmid vector modification with target spot homology arm, and wherein Fig. 1-A are plasmid before transformation
Structure, Fig. 1-B be improved plasmid structure.
Fig. 2 is carrier digestion verification figure after transformation.
Fig. 3 is that CRISPR/Cas9 is cut after target spot formation double-strand breach, and the gene insertion principle of homologous recombination repair mediation is shown
It is intended to.
Fig. 4 is interface PCR detects schematic diagrams;Wherein, 5 ' interface PCR primer length are 1.1kb;3 ' interface PCR primers are long
Spend for 1.2kb.
Embodiment
The present invention is made with reference to Figure of description and specific embodiment and further being elaborated, the embodiment
It is served only for explaining the present invention, is not intended to limit the scope of the present invention.Test method used in following embodiments is such as without spy
Different explanation, is conventional method;Used material, reagent etc., are the reagent commercially obtained unless otherwise specified
And material.
People α1- antitrypsin gene total length 1257bp, encodes 418 amino acid, the people α1- antitrypsin has
Such as SEQ ID NO:Amino acid sequence shown in 1;Its gene has such as SEQ ID NO:Nucleotide sequence shown in 2.
Embodiment 1
A kind of recombinant HEK 293 cell strain for expressing people's alpha1-antitrypsin, specific construction method is as follows.
First, vector modification:Contain AAVS1 target sites or so homology arm, riddled basins, people's alpha1-antitrypsin base
The plasmid of cause has many commercialized kinds, and the present embodiment uses Genome-CRISPTMHuman AAVS1Safe Harbor
People α in Gene Knock-in Kits (GeneCopoeia, Inc.) products DC-DON-SH011- antitrypsin expresses matter
Grain.The homology arm of AAVS1 target spots both sides is carried on the expression plasmid, left homologous arm lengths 782bp, is the sequence close on the left of target spot
Row.Right homologous arm lengths 819bp, is the sequence close on the right side of target spot, while the gene also marked on plasmid with expression screening,
The structure of the plasmid is as shown in Fig. 1-A.
By digestion interconnection technique, a LoxP is inserted in the both sides of the gene marked in the expression screening of expression vector respectively
Sequence, and ensure that two LoxP sequences directions are consistent, the structure of improved plasmid is as shown if figure 1-b.Comprise the following steps that:
1. by the people α in product DC-DON-SH011- antitrypsin expression plasmid BglII and AsiSI double digestions, are returned
The fragment for receiving about 10K is used as linear carrier.
2. design anneal primer LoxP1-F/R.Sequence is as follows:
LoxP1-F:gatctATAACTTCGTATAGCATACATTATACGAAGTTATgcggccgcaaggatctgcgat
LoxP1-R:CGCAGATCCTTGCGGCCGCATAACTTCGTATAATGTATGCTATACGAAGTTATA
It is connected, converts with the linearized vector of step 1 after two primer hybridizations, then bacterium solution PCR is screened.Screening primer is
LoxP1-seqF/LoxP1-R, amplifies and carrys out 176bp for positive colony, and send survey (wherein, sequencing primer LoxP1-seqF:
CATCGCATTGTCTGAGTAGG), the middle interstitial granules built, labeled as HA-AAT-LoxP1, so far, introduces 5 ' LoxP
Sequence.
3. the middle interstitial granules HA-AAT-LoxP1 to build uses SacII-HpaI digestions as carrier.It is with LoxP2-F/R
Primer amplification initial carrier HA-AAT is fragment, and size is 571bp.Primer sequence is as follows:
LoxP2-F:GTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGC
LoxP2-R:
ATAAGCTGCAATAAACAAGTTAACATAACTTCGTATAATGTATGCTATACGAAGTTATTGATACAAAGG
CATTAAAGC
By this fragment with the HA-AAT-LoxP1 linearized vectors after SacII and HpaI digestions according to 5:1 mol ratio
Bacterium solution PCR screenings are carried out after connection, conversion.It is used screening primer be:LoxP2-seqF1/seqR1:
LoxP2-seqF1:TCGCCGCCGCGTTCGCCGAC
LoxP2-seqR1:CATTTGAGTCAATTCCAGAC
Positive colony is selected, and (wherein, sequencing primer LoxP2-seqR1 is sequenced:CATTTGAGTCAATTCCAGAC), obtain
To the plasmid built, so far introduce 3 ' LoxP sequences, obtain final carrier construction HA-AAT-LoxP2, i.e., it is improved to contain table
Intelligent α1The expression plasmid of the left and right homology arm of-antitryptic gene, the gene of expression screening mark and AAVS1 sites,
Sequence such as SEQ ID NO between the left and right homology arm of HA-AAT-LoxP2 plasmids:Shown in 5.
2nd, cell transfecting:The CRISPR/Cas9 plasmids in the targeting AAVS1 sites are Genome-CRISPTMHuman
AAVS1Safe Harbor Gene Knock-in Kits (GeneCopoeia, Inc.) product HCP-AAVS1-CG02, target spot
Sequence GGGGCCACTAGGGACAGGAT.
HEK293 cells are inoculated in six orifice plates into culture, and (corresponding condition is:Hyclone containing GIBICO 10%
DMEM culture mediums, 37 DEG C, 5% CO2, cultivate 24 hours or so), treat that cell growth, to 80% or so, is transfected.Under
State step operation:
1st, CRISPR/Cas9 plasmids and the improved people α containing homology arm1- antitrypsin gene expression plasmid totally 2
Microgram is with 1:After 1 mol ratio is mixed, mixed with 250 microlitres of Opti-MEM serum free mediums, and stand 5 minutes.Meanwhile, take
10 microlitres of Lipo2000 transfection reagents and 250 microlitres of Opti-MEM serum free mediums of equivalent are mixed, and stand 5 minutes.
2nd, after 5 minutes, the two mixed liquors are fully mixed, 20 minutes are stood.
3rd, before cell transfecting with PBS once, above-mentioned mixed liquor is uniformly added drop-wise to cell surface to be transfected.
4th, after 6 hours, plus 500 microlitres of cell culture mediums containing 40% hyclone, continue to cultivate.
5th, 24 hours after transfecting, Secondary Culture is carried out.
6th, 2 μ g/mL puromycin screening 48h is added in culture medium, the positive cell line of puromycin is obtained.
7th, limiting dilution assay carries out the screening of GFP positive cells monoclonal.
CRISPR/Cas9 plasmids enter cell, and the Cas9 nucleases of coding are under guiding RNA guide, with reference in target spot
In sequence, and special cut chromosome target position formation double-strand break breach.DNA double chain fracture breach triggers the DNA of cell
Repair procedure.There is the people α containing homology arm1In the case of-antitrypsin gene expression plasmid, homology arm and chromosome
On homologous sequence by base pair complementarity formation heterozygosis chain, and with the people α containing homology arm1- antitrypsin gene table
It is template up to plasmid, breach is repaired, so that by people α1- antitrypsin gene is incorporated into gap position.
Fig. 2 shows that CRISPR/Cas9 is cut after target spot formation double-strand breach, and the gene insertion principle of homologous recombination repair mediation is shown
It is intended to.
3rd, routinely operate and enter line interface PCR and Western Blot identifications respectively to gained cell line.
Interface PCR is identified:Target AAVS1 CRISPR/Cas9 combinations homologous recombination mediation expression people α1- antitrypsin
Gene No. 19 chromosomes of people AAVS1 sites site-directed integration, therefore respectively with 5 ' end interface PCR primer (F:
CCGGAACTCTGCCCTCTAAC;R:) and 3 ' end interface PCR primer (F CCCGTGAGTCAAACCGCTAT:
AGCTCATCTGGTCTCCCTTCC;R:TCCTGGGATACCCCGAAGAG) expanded, to determine the integration of gene.Specific side
Method is:Extraction cell DNA is template, is diluted to 200ng/ μ L. Max DNA Polymerase(Takara)5
μ L, template 1 μ L, 2 micromolar each 1 μ L of primer, add water and supply 10 μ L systems.Expanded using two-step method PCR:98 DEG C of pre-degenerations
20s, 55 DEG C of annealing 15s, 72 DEG C of extension 20s, 30 circulations.
Western Blot are identified:Recombinant cell strain is incubated at 75cm2In cell bottle, treat that cell length, to 80%, changes nothing
Blood serum medium culture 24h.Cells and supernatant is collected, SDS-PAGE electrophoresis is carried out.With the Abcam anti-pancreas eggs of rabbit-anti people α 1-
How anti-white enzyme is as primary antibody, and goat anti-rabbit igg carries out Western Blot detections as secondary antibody.
It is that positive cell clone, i.e. interface PCR two ends are the positive to select the selection result, and Western Blot are detected
Show the cell clone of band.Fig. 3 shows interface PCR detects schematic diagrams;Wherein, 5 ' interface PCR primer length are 1.1kb;3’
Interface PCR primer length is 1.2kb.
4th, secondary transfection is carried out to above-mentioned cell clone:The selection result is inoculated in six holes for positive cell clone
(corresponding condition can be in plate:The DMEM culture mediums of hyclone containing GIBICO 10%, 37 DEG C, 5% CO2, cultivate 24h
Left and right), treat that cell growth, to 80% or so, is transfected.It can be operated according to following step:
1st, by the μ g of Cre enzymes plasmid 2, mixed with 250 μ L Opti-MEM serum free mediums, and stand 5min.Meanwhile, take
10 μ L Lipo2000 transfection reagents and 250 μ L of equivalent Opti-MEM serum free mediums are mixed, and stand 5min.
2nd, after 5 minutes, two mixed liquors are fully mixed, 20 minutes are stood.
3rd, before cell transfecting with PBS once, above-mentioned mixed liquor is uniformly added drop-wise to cell surface.
4th, after 6 hours, plus 500 microlitres of cell culture mediums containing 40% hyclone, continue to cultivate.
5th, 24 hours after transfecting, Secondary Culture is carried out.
6th, limiting dilution assay carries out monoclonal screening, obtains GFP negative cells monoclonals.
7th, GFP negative cells monoclonal genomic DNAs are extracted, PCR detections are screened without GFP (primer GFP-F:
GGCTACGGCTTCTACCACTTCG;GFP-R:GTGTTGCTGTGCAGCTCCTCC;Product 443bp), without puromycin (primer
Puro-F:atgaccgagtacaagcccacgg;Puro-R:CGGGTCGACTCTAGAGGATCC;Product 600bp) gene band
Cell clone, that is, obtain without selection markers, stable expression people α1- antitryptic recombinant cell strain.
5th, Enzyme assay:Recombinant cell strain is incubated at 75cm2In cell bottle, treat that cell length, to 80%, changes serum-free
Medium culture 24 hours.Cells and supernatant is collected, α is carried out1- antitrypsin Enzyme activity assay.
Specific method is:With Sigma α1- antitrypsin standard items carry out gradient dilution, and with excessive elastic egg
White enzyme is incubated 20 minutes, detects the amount of residual activity elastoser (by 405 nanometers of absorbances of chemiluminescence detection, reaction
Elastase substrate Suc-Ala-Ala-Ala-pNa (Sigma) decomposition substrate content).It is bent using acquired results as standard
People's alpha1-antitrypsin active quantities are 0.4g/L in line, detection culture supernatant.
SEQUENCE LISTING
<110>Shenzhen Weiguang Biological Products Co., Ltd.
<120>A kind of recombinant cell strain for expressing people's alpha1-antitrypsin and its application
<130>
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 418
<212> PRT
<213>People's alpha1-antitrypsin amino acid sequence
<400> 1
Met Pro Ser Ser Val Ser Trp Gly Ile Leu Leu Leu Ala Gly Leu Cys
1 5 10 15
Cys Leu Val Pro Val Ser Leu Ala Glu Asp Pro Gln Gly Asp Ala Ala
20 25 30
Gln Lys Thr Asp Thr Ser His His Asp Gln Asp His Pro Thr Phe Asn
35 40 45
Lys Ile Thr Pro Asn Leu Ala Glu Phe Ala Phe Ser Leu Tyr Arg Gln
50 55 60
Leu Ala His Gln Ser Asn Ser Thr Asn Ile Phe Phe Ser Pro Val Ser
65 70 75 80
Ile Ala Thr Ala Phe Ala Met Leu Ser Leu Gly Thr Lys Ala Asp Thr
85 90 95
His Asp Glu Ile Leu Glu Gly Leu Asn Phe Asn Leu Thr Glu Ile Pro
100 105 110
Glu Ala Gln Ile His Glu Gly Phe Gln Glu Leu Leu Arg Thr Leu Asn
115 120 125
Gln Pro Asp Ser Gln Leu Gln Leu Thr Thr Gly Asn Gly Leu Phe Leu
130 135 140
Ser Glu Gly Leu Lys Leu Val Asp Lys Phe Leu Glu Asp Val Lys Lys
145 150 155 160
Leu Tyr His Ser Glu Ala Phe Thr Val Asn Phe Gly Asp Thr Glu Glu
165 170 175
Ala Lys Lys Gln Ile Asn Asp Tyr Val Glu Lys Gly Thr Gln Gly Lys
180 185 190
Ile Val Asp Leu Val Lys Glu Leu Asp Arg Asp Thr Val Phe Ala Leu
195 200 205
Val Asn Tyr Ile Phe Phe Lys Gly Lys Trp Glu Arg Pro Phe Glu Val
210 215 220
Lys Asp Thr Glu Glu Glu Asp Phe His Val Asp Gln Val Thr Thr Val
225 230 235 240
Lys Val Pro Met Met Lys Arg Leu Gly Met Phe Asn Ile Gln His Cys
245 250 255
Lys Lys Leu Ser Ser Trp Val Leu Leu Met Lys Tyr Leu Gly Asn Ala
260 265 270
Thr Ala Ile Phe Phe Leu Pro Asp Glu Gly Lys Leu Gln His Leu Glu
275 280 285
Asn Glu Leu Thr His Asp Ile Ile Thr Lys Phe Leu Glu Asn Glu Asp
290 295 300
Arg Arg Ser Ala Ser Leu His Leu Pro Lys Leu Ser Ile Thr Gly Thr
305 310 315 320
Tyr Asp Leu Lys Ser Val Leu Gly Gln Leu Gly Ile Thr Lys Val Phe
325 330 335
Ser Asn Gly Ala Asp Leu Ser Gly Val Thr Glu Glu Ala Pro Leu Lys
340 345 350
Leu Ser Lys Ala Val His Lys Ala Val Leu Thr Ile Asp Glu Lys Gly
355 360 365
Thr Glu Ala Ala Gly Ala Met Phe Leu Glu Ala Ile Pro Met Ser Ile
370 375 380
Pro Pro Glu Val Lys Phe Asn Lys Pro Phe Val Phe Leu Met Ile Glu
385 390 395 400
Gln Asn Thr Lys Ser Pro Leu Phe Met Gly Lys Val Val Asn Pro Thr
405 410 415
Gln Lys
<210> 2
<211> 1257
<212> DNA
<213>People's alpha1-antitrypsin gene order
<400> 2
atgccgtctt ctgtctcgtg gggcatcctc ctgctggcag gcctgtgctg cctggtccct 60
gtctccctgg ctgaggatcc ccagggagat gctgcccaga agacagatac atcccaccat 120
gatcaggatc acccaacctt caacaagatc acccccaacc tggctgagtt cgccttcagc 180
ctataccgcc agctggcaca ccagtccaac agcaccaata tcttcttctc cccagtgagc 240
atcgctacag cctttgcaat gctctccctg gggaccaagg ctgacactca cgatgaaatc 300
ctggagggcc tgaatttcaa cctcacggag attccggagg ctcagatcca tgaaggcttc 360
caggaactcc tccgtaccct caaccagcca gacagccagc tccagctgac caccggcaat 420
ggcttgttcc tcagcgaggg cctgaagcta gtggataagt ttttggagga tgttaaaaag 480
ttgtaccact cagaagcctt cactgtcaac ttcggggaca ccgaagaggc caagaaacag 540
atcaacgatt acgtggagaa gggtactcaa gggaaaattg tggatttggt caaggagctt 600
gacagagaca cagtttttgc tctggtgaat tacatcttct ttaaaggcaa atgggagaga 660
ccctttgaag tcaaggacac cgaggaagag gacttccacg tggaccaggt gaccaccgtg 720
aaggtgccta tgatgaagcg tttaggcatg tttaacatcc agcactgtaa gaagctgtcc 780
agctgggtgc tgctgatgaa atacctgggc aatgccaccg ccatcttctt cctgcctgat 840
gaggggaaac tacagcacct ggaaaatgaa ctcacccacg atatcatcac caagttcctg 900
gaaaatgaag acagaaggtc tgccagctta catttaccca aactgtccat tactggaacc 960
tatgatctga agagcgtcct gggtcaactg ggcatcacta aggtcttcag caatggggct 1020
gacctctccg gggtcacaga ggaggcaccc ctgaagctct ccaaggccgt gcataaggct 1080
gtgctgacca tcgacgagaa agggactgaa gctgctgggg ccatgttttt agaggccata 1140
cccatgtcta tcccccccga ggtcaagttc aacaaaccct ttgtcttctt aatgattgac 1200
caaaatacca agtctcccct cttcatggga aaagtggtga atcccaccca aaaataa 1257
<210> 3
<211> 20
<212> DNA
<213>Target sequence
<400> 3
ggggccacta gggacaggat 20
<210> 4
<211> 34
<212> DNA
<213>LoX-p sequences
<400> 43
ataacttcgt atagcataca ttatacgaag ttat 34
<210> 5
<211> 6622
<212> DNA
<213>Sequence between the homology arm of left and right
<400> 5
tgtatatcga ggtttattta ttaatttgaa tagatattaa gttttattat atttacactt 60
acatactaat aataaattca acaaacaatt tatttatgtt tatttattta ttaaaaaaaa 120
acaaaaactc aaaatttctt ctataaagta acaaaacttt tatgagggac agcccccccc 180
caaagccccc agggatgtaa ttacgtccct cccccgctag ggggcagcag cgagccgccc 240
ggggctccgc tccggtccgg cgctcccccc gcatccccga gccggcagcg tgcggggaca 300
gcccgggcac ggggaaggtg gcacgggatc gctttcctct gaacgcttct cgctgctctt 360
tgagcctgca gacacctggg gggatacggg gaaaaggcct ccaaggccta ctagtaacgg 420
ccgccagtgt gctggaattc gcccttggta cctgctttct ctgaccagca ttctctcccc 480
tgggcctgtg ccgctttctg tctgcagctt gtggcctggg tcacctctac ggctggccca 540
gatccttccc tgccgcctcc ttcaggttcc gtcttcctcc actccctctt ccccttgctc 600
tctgctgtgt tgctgcccaa ggatgctctt tccggagcac ttccttctcg gcgctgcacc 660
acgtgatgtc ctctgagcgg atcctccccg tgtctgggtc ctctccgggc atctctcctc 720
cctcacccaa ccccatgccg tcttcactcg ctgggttccc ttttccttct ccttctgggg 780
cctgtgccat ctctcgtttc ttaggatggc cttctccgac ggatgtctcc cttgcgtccc 840
gcctcccctt cttgtaggcc tgcatcatca ccgtttttct ggacaacccc aaagtacccc 900
gtctccctgg ctttagccac ctctccatcc tcttgctttc tttgcctgga caccccgttc 960
tcctgtggat tcgggtcacc tctcactcct ttcatttggg cagctcccct acccccctta 1020
cctctctagt ctgtgctagc tcttccagcc ccctgtcatg gcatcttcca ggggtccgag 1080
agctcagcta gtcttcttcc tccaacccgg gcccctatgt ccacttcagg acagcatgtt 1140
tgctgcctcc agggatcctg tgtccccgag ctgggaccac cttatattcc cagggccggt 1200
taatgtggct ctggttctgg gtacttttat ctgtcccctc caccccacag tggggcacgc 1260
gtaagggcga attctgcaga tatccatcac actggcggcc gctcgagcat gcatctagta 1320
ttatgcccag tacatgacct tatgggactt tcctacttgg cagtacatct acgtattagt 1380
catcgctatt accatggtga tgcggttttg gcagtacatc aatgggcgtg gatagcggtt 1440
tgactcacgg ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca 1500
ccaaaatcaa cgggactttc caaaatgtcg taacaactcc gccccattga cgcaaatggg 1560
cggtaggcgt gtacggtggg aggtctatat aagcagagct cgtttagtga accgtcagat 1620
cgcctggaga cgccatccac gctgttttga cctccataga agattctaga ttcgaagaac 1680
aagtttgtac aaaaaagcag gcttggaagg agttcgaacc atgccgtctt ctgtctcgtg 1740
gggcatcctc ctgctggcag gcctgtgctg cctggtccct gtctccctgg ctgaggatcc 1800
ccagggagat gctgcccaga agacagatac atcccaccat gatcaggatc acccaacctt 1860
caacaagatc acccccaacc tggctgagtt cgccttcagc ctataccgcc agctggcaca 1920
ccagtccaac agcaccaata tcttcttctc cccagtgagc atcgctacag cctttgcaat 1980
gctctccctg gggaccaagg ctgacactca cgatgaaatc ctggagggcc tgaatttcaa 2040
cctcacggag attccggagg ctcagatcca tgaaggcttc caggaactcc tccgtaccct 2100
caaccagcca gacagccagc tccagctgac caccggcaat ggcttgttcc tcagcgaggg 2160
cctgaagcta gtggataagt ttttggagga tgttaaaaag ttgtaccact cagaagcctt 2220
cactgtcaac ttcggggaca ccgaagaggc caagaaacag atcaacgatt acgtggagaa 2280
gggtactcaa gggaaaattg tggatttggt caaggagctt gacagagaca cagtttttgc 2340
tctggtgaat tacatcttct ttaaaggcaa atgggagaga ccctttgaag tcaaggacac 2400
cgaggaagag gacttccacg tggaccaggt gaccaccgtg aaggtgccta tgatgaagcg 2460
tttaggcatg tttaacatcc agcactgtaa gaagctgtcc agctgggtgc tgctgatgaa 2520
atacctgggc aatgccaccg ccatcttctt cctgcctgat gaggggaaac tacagcacct 2580
ggaaaatgaa ctcacccacg atatcatcac caagttcctg gaaaatgaag acagaaggtc 2640
tgccagctta catttaccca aactgtccat tactggaacc tatgatctga agagcgtcct 2700
gggtcaactg ggcatcacta aggtcttcag caatggggct gacctctccg gggtcacaga 2760
ggaggcaccc ctgaagctct ccaaggccgt gcataaggct gtgctgacca tcgacgagaa 2820
agggactgaa gctgctgggg ccatgttttt agaggccata cccatgtcta tcccccccga 2880
ggtcaagttc aacaaaccct ttgtcttctt aatgattgac caaaatacca agtctcccct 2940
cttcatggga aaagtggtga atcccaccca aaaatagctc gagtgcggcc gcaacccagc 3000
tttcttgtac aaagtggttg atcgaaatcg gatccctgtg ccttctagtt gccagccatc 3060
tgttgtttgc ccctcccccg tgccttcctt gaccctggaa ggtgccactc ccactgtcct 3120
ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt ctattctggg 3180
gggtggggtg gggcaggaca gcaaggggga ggattgggaa gacaatagca ggcatgctgg 3240
ggatgcggtg ggctctatgg agatctataa cttcgtatag catacattat acgaagttat 3300
gcggccgcaa ggatctgcga tcgctccggt gcccgtcagt gggcagagcg cacatcgccc 3360
acagtccccg agaagttggg gggaggggtc ggcaattgaa cgggtgccta gagaaggtgg 3420
cgcggggtaa actgggaaag tgatgtcgtg tactggctcc gcctttttcc cgagggtggg 3480
ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc tttttcgcaa cgggtttgcc 3540
gccagaacac agctgaagct tcgaggggct cgcatctctc cttcacgcgc ccgccgccct 3600
acctgaggcc gccatccacg ccggttgagt cgcgttctgc cgcctcccgc ctgtggtgcc 3660
tcctgaactg cgtccgccgt ctaggtaagt ttaaagctca ggtcgagacc gggcctttgt 3720
ccggcgctcc cttggagcct acctagactc agccggctct ccacgctttg cctgaccctg 3780
cttgctcaac tctacgtctt tgtttcgttt tctgttctgc gccgttacag atccaagctg 3840
tgaccggcgc ctacgctaga cgccaccatg gagagcgacg agagcggcct gcccgccatg 3900
gagatcgagt gccgcatcac cggcaccctg aacggcgtgg agttcgagct ggtgggcggc 3960
ggagagggca cccccaagca gggccgcatg accaacaaga tgaagagcac caaaggcgcc 4020
ctgaccttca gcccctacct gctgagccac gtgatgggct acggcttcta ccacttcggc 4080
acctacccca gcggctacga gaaccccttc ctgcacgcca tcaacaacgg cggctacacc 4140
aacacccgca tcgagaagta cgaggacggc ggcgtgctgc acgtgagctt cagctaccgc 4200
tacgaggccg gccgcgtgat cggcgacttc aaggtggtgg gcaccggctt ccccgaggac 4260
agcgtgatct tcaccgacaa gatcatccgc agcaacgcca ccgtggagca cctgcacccc 4320
atgggcgata acgtgctggt gggcagcttc gcccgcacct tcagcctgcg cgacggcggc 4380
tactacagct tcgtggtgga cagccacatg cacttcaaga gcgccatcca ccccagcatc 4440
ctgcagaacg ggggccccat gttcgccttc cgccgcgtgg aggagctgca cagcaacacc 4500
gagctgggca tcgtggagta ccagcacgcc ttcaagaccc ccatcgcctt cgccagatcc 4560
cgcgctcagt cgtccaattc tgccgtggac ggcaccgccg gacccggctc caccggatct 4620
cgcgagggca gaggaagtct tctaacatgc ggtgacgtgg aggagaatcc cggccctatg 4680
accgagtaca agcccacggt gcgcctcgcc acccgcgacg acgtccccag ggccgtacgc 4740
accctcgccg ccgcgttcgc cgactacccc gccacgcgcc acaccgtcga tccggaccgc 4800
cacatcgagc gggtcaccga gctgcaagaa ctcttcctca cgcgcgtcgg gctcgacatc 4860
ggcaaggtgt gggtcgcgga cgacggcgcc gcggtggcgg tctggaccac gccggagagc 4920
gtcgaagcgg gggcggtgtt cgccgagatc ggcccgcgca tggccgagtt gagcggttcc 4980
cggctggccg cgcagcaaca gatggaaggc ctcctggcgc cgcaccggcc caaggagccc 5040
gcgtggttcc tggccaccgt cggcgtctcg cccgaccacc agggcaaggg tctgggcagc 5100
gccgtcgtgc tccccggagt ggaggcggcc gagcgcgccg gggtgcccgc cttcctggag 5160
acctccgcgc cccgcaacct ccccttctac gagcggctcg gcttcaccgt caccgccgac 5220
gtcgaggtgc ccgaaggacc gcgcacctgg tgcatgaccc gcaagcccgg tgcctgaaat 5280
caacctctgg attacaaaat ttgtgaaaga ttgactggta ttcttaacta tgttgctcct 5340
tttacgctat gtggatacgc tgctttaatg cctttgtatc aataacttcg tatagcatac 5400
attatacgaa gttatgttaa cttgtttatt gcagcttata atggttacaa ataaagcaat 5460
agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg tggtttgtcc 5520
aaactcatca atgtatctta tcatgtctgg aattgactca aatgatgtca attagtctat 5580
cagaagctca tctggtctcc cttccggggg acaagacatc cctgtttaat atttaaacag 5640
cagtgttccc aaactgggtt cttatatccc ttgctctggt caaccaggtt gcagggtttc 5700
ctgtcctcac aggaacgaag tccctaaaga aacagtggca gccaggttta gccccggaat 5760
tgactggatt ccttttttag ggcccattgg tatggtgtac actactaggg acaggattgg 5820
tgacagaaaa gccccatcct taggcctcct ccttcctagt ctcctgatat tgggtctaac 5880
ccccacctcc tgttaggcag attccttatc tggtgacaca cccccatttc ctggagccat 5940
ctctctcctt gccagaacct ctaaggtttg cttacgatgg agccagagag gatcctggga 6000
gggagagctt ggcagggggt gggagggaag ggggggatgc gtgacctgcc cggttctcag 6060
tggccaccct gcgctaccct ctcccagaac ctgagctgct ctgacgcggc tgtctggtgc 6120
gtttcactga tcctggtgct gcagcttcct tacacttccc aagaggagaa gcagtttgga 6180
aaaacaaaat cagaataagt tggtcctgag ttctaacttt ggctcttcac ctttctagtc 6240
cccaatttat attgttcctc cgtgcgtcag ttttacctgt gagataaggc cagtagccag 6300
ccccgtcctg gcagggctgt ggtgaggagg ggggtgtccg tgtggaaaac tccctttgtg 6360
agaatggtgc gtcctaggtg ttcaccaggt cgtggccgcc tctactccct ttctctttct 6420
ccatccttct ttccttaaag agtccccagt gctatctggg acatattcct ccgcccagag 6480
cagggtcccg cttccctaag gccctgctct gggcttctgg gtttgagtcc ttggcaagcc 6540
caggagaggc gctcaggctt ccctgtcccc cttcctcgtc caccatctca tgcccctggc 6600
tctcctgccc cttccctaca gg 6622
Claims (9)
1. a kind of construction method for the recombinant cell strain for expressing people's alpha1-antitrypsin, it is characterised in that including following step
Suddenly:
(1) gene order of alpha1-antitrypsin containing people, riddled basins sequence, the left and right homology arm sequence in AAVS1 sites are obtained
The expression plasmid of row, the gene order of people's alpha1-antitrypsin described in expression plasmid, riddled basins sequence are described
Between the left and right homology arm in AAVS1 sites;A LoxP sequence is inserted respectively in the both sides of the riddled basins of expression plasmid
Row, and the direction of the two LoxP sequences is consistent, the recombinant plasmid for the expression people's alpha1-antitrypsin transformed;
(2) recombinant plasmid and the body of the CRISPR/Cas9 plasmid co-transfection people in targeting AAVS1 sites transformed step (1) are thin
Born of the same parents, screening obtains the body cell of site-directed integration;
(3) to express the body cell for the site-directed integration that the plasmid transfection step (2) of Cre enzymes is obtained, cut by Cre/LoxP systems
Except selection markers, screening acquisition has cut off selection markers and stable expression recombinant alpha1The strain of-antitryptic body cell.
2. construction method according to claim 1, it is characterised in that the body cell of the people be HEK293 cells or
PER.C6 cells.
3. construction method according to claim 1, it is characterised in that the selection markers are GFP genes and puromycin
Gene.
4. construction method according to claim 1, it is characterised in that the LoxP sequences such as SEQ ID NO:Shown in 4.
5. construction method according to claim 1, it is characterised in that step(1)The gene of alpha1-antitrypsin containing people
Sequence, riddled basins sequence, the expression plasmid of the left and right homology arm sequence in AAVS1 sites are Genome-TALER article No.s
For DC-DON-SH01 AAVS1 donor clone carriers.
6. construction method according to claim 1, it is characterised in that comprise the following steps:
(1) it is the riddled basins of DC-DON-SH01 AAVS1 donor clone carriers in Genome-TALER article No.s
A LoxP sequence is inserted in both sides respectively, and the direction of the two LoxP sequences is consistent, the anti-pancreas eggs of expression people α 1- transformed
The recombinant plasmid of white enzyme, LoxP sequences such as SEQ ID NO:Shown in 4;
(2) recombinant plasmid and the body of the CRISPR/Cas9 plasmid co-transfection people in targeting AAVS1 sites transformed step (1) are thin
Born of the same parents, screening obtains the body cell of site-directed integration, and the CRISPR/Cas9 plasmids in targeting AAVS1 sites are GeneCopoeia companies
Genome-CRISP plasmids;
(3) to express the body cell for the site-directed integration that the plasmid transfection step (2) of Cre enzymes is obtained, cut by Cre/LoxP systems
Except selection markers, screening acquisition has cut off selection markers and stable expression recombinant alpha1The strain of-antitryptic body cell.
7. the recombinant cell that a kind of any one of claim 1 to 6 construction method is prepared.
8. application of the recombinant cell in secreting, expressing people's alpha1-antitrypsin described in claim 7.
9. application according to claim 8, it is characterised in that the method for the secreting, expressing people alpha1-antitrypsin is,
It is 75%~95% to cultivate the recombinant cell strain to cell density, changes culture medium, continues to cultivate 20h~28h, collects supernatant
Liquid, is produced.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710011332.3A CN107058229A (en) | 2017-01-06 | 2017-01-06 | The antitryptic recombinant cell strains of one kind expression people α 1 and its application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710011332.3A CN107058229A (en) | 2017-01-06 | 2017-01-06 | The antitryptic recombinant cell strains of one kind expression people α 1 and its application |
Publications (1)
Publication Number | Publication Date |
---|---|
CN107058229A true CN107058229A (en) | 2017-08-18 |
Family
ID=59623354
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710011332.3A Pending CN107058229A (en) | 2017-01-06 | 2017-01-06 | The antitryptic recombinant cell strains of one kind expression people α 1 and its application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107058229A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114214268A (en) * | 2021-12-13 | 2022-03-22 | 广东省农业科学院动物卫生研究所 | African green monkey kidney cell line for stably expressing SLAM protein and construction method and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101760473A (en) * | 2008-12-25 | 2010-06-30 | 北京济普霖生物技术有限公司 | Method for deleting exogenous gene in transgenic cell at fixed point |
WO2014121005A1 (en) * | 2013-02-01 | 2014-08-07 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Retroviral vector packaging cell lines and methods of purifying and producing retroviral particles |
-
2017
- 2017-01-06 CN CN201710011332.3A patent/CN107058229A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101760473A (en) * | 2008-12-25 | 2010-06-30 | 北京济普霖生物技术有限公司 | Method for deleting exogenous gene in transgenic cell at fixed point |
WO2014121005A1 (en) * | 2013-02-01 | 2014-08-07 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Retroviral vector packaging cell lines and methods of purifying and producing retroviral particles |
Non-Patent Citations (4)
Title |
---|
GENECOPOEIA: "Genome-TALER™ & Genome-CRISPR™ Human AAVS1 Safe Harbor Gene Knock-in Kit User Manual", 《GENECOPOEIA》 * |
YUEJUN CHEN等: "Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9", 《CELL PRESS》 * |
王志蕊等: "Cre-LoxP 重组系统删除内源性选择标记基因的效能评价", 《中国生物化学与分子生物学报》 * |
黄立军等: "人A1抗胰蛋白酶基因的克隆及在COS-7细胞中的表达", 《现代肿瘤医学》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114214268A (en) * | 2021-12-13 | 2022-03-22 | 广东省农业科学院动物卫生研究所 | African green monkey kidney cell line for stably expressing SLAM protein and construction method and application thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2022204199A1 (en) | Gene editing of deep intronic mutations | |
CA2915842C (en) | Delivery and use of the crispr-cas systems, vectors and compositions for hepatic targeting and therapy | |
EP3494997B1 (en) | Inducible dna binding proteins and genome perturbation tools and applications thereof | |
ES2564823T3 (en) | Gene vector comprising miRNA | |
KR20210056329A (en) | New CAS12B enzyme and system | |
ES2891087T3 (en) | DNA vectors, transposons and transposases for the modification of the eukaryotic genome | |
JP2024121000A (en) | Programmable DNA base editing by Nme2Cas9-deaminase fusion proteins | |
JP2024099582A (en) | Compositions and methods for transgene expression from the albumin locus | |
WO2016061073A1 (en) | Composition and method for in vivo engineering of chromosomal rearrangements | |
US11492614B2 (en) | Stem loop RNA mediated transport of mitochondria genome editing molecules (endonucleases) into the mitochondria | |
CN108130342A (en) | Plant Genome fixed point edit methods based on Cpf1 | |
KR102409077B1 (en) | Programmable anti-cancer antivirus system and its application | |
Nilsson et al. | T‐antigen expression by polyoma mutants with modified RNA splicing. | |
KR20200135225A (en) | Single base editing proteins and composition comprising the same | |
KR20230127221A (en) | RNA targeting compositions and methods for treating CAG repeat disease | |
KR20230129162A (en) | RNA targeting composition and method for treating type 1 myotonic dystrophy | |
CN107058229A (en) | The antitryptic recombinant cell strains of one kind expression people α 1 and its application | |
CN102154288A (en) | Skeletal muscle specific CAPN3 promoter and use thereof | |
WO2023051734A1 (en) | Engineered crispr-cas13f system and uses thereof | |
US20240209357A1 (en) | Dna constructs comprising alternative promoters | |
CN102127545A (en) | Skeletal muscle specificity CKM (Creatine Kinase Muscle) promoter and applications thereof | |
Liu et al. | In vivo exon replacement in the mouse Atp7b gene by the Cas9 system | |
WO2022119919A1 (en) | Compositions and methods for cleaving viral genomes | |
CN101935674A (en) | Adenovirus vector for gene therapy on hemophilia B and application thereof | |
KR20210075126A (en) | Methods of Treating Disease Using Nucleic Acid Vectors Encoding Highly Compact Multi-Input Logic Gates |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170818 |