CN107058229A

CN107058229A - The antitryptic recombinant cell strains of one kind expression people α 1 and its application

Info

Publication number: CN107058229A
Application number: CN201710011332.3A
Authority: CN
Inventors: 冀倩倩; 郭采平; 陆勇军; 丁玉江; 吴樱丹; 张佩; 王锦才; 张战; 黄伟荣
Original assignee: Shenzhen Weiguang Biological Products Co Ltd
Current assignee: Shenzhen Weiguang Biological Products Co Ltd
Priority date: 2017-01-06
Filing date: 2017-01-06
Publication date: 2017-08-18

Abstract

The invention belongs to biological technical field, a kind of expression people α is specifically disclosed₁Antitryptic cell line and its application.The recombinant cell is specifically by people α₁Antitryptic Gene targeting cuts off selection markers to the AAVS1 sites of No. 19 chromosomes of body cell, and acquisition has cut off selection markers and stable expression recombinant alpha₁Antitryptic body cell.People α in the recombinant cell strain₁Antitrypsin gene is pinpointed is inserted into the AAVS1 sites of No. 19 chromosomes of people, it is to avoid caused by traditional gene radom insertion the problems such as gene silencing；The cell line can express people α₁Antitrypsin, the people α of gained_1‑Antitryptic 26S Proteasome Structure and Function is more closely similar to natural α₁Antitrypsin, is more beneficial for people α₁The promotion and application of antitrypsin preparation.

Description

A kind of recombinant cell strain for expressing people's alpha1-antitrypsin and its application

Technical field

The present invention relates to biological technical field, in particular it relates to a kind of recombinant cell strain for expressing people's alpha1-antitrypsin And its application.

Background technology

People α₁- antitrypsin deficiency disease (AATD) is a kind of worldwide genetic disease, is that single gene mutation causes Autosome codominant inheritance, be mainly shown as pulmonary emphysema, hepatic sclerosis, liver cancer, minority is presented as disease of skin panniculitis etc.. The treatment of AATD patient needs to rely on i.v. intermittent people α₁- antitrypsin preparation.

At present, the people α of Clinical practice₁Main purified by human plasma of-antitrypsin preparation obtains, large quantities of which has limited its Amount production, result in people α₁Supply falls short of demand for-antitrypsin preparation, expensive, and only some patientss, which are had ready conditions, uses.Except this Outside, due to the limitation of diagnostic techniques, most AATD patients do not obtain efficient diagnosis so far, so entering with diagnostic techniques Step, people α₁The demand of-antitrypsin preparation certainly will will be further increased.However, human plasma resource provisioning is limited, blood govern Starch the people α of purified source₁The supply of-antitrypsin preparation, needs exploitation recombinant human alpha badly₁- antitrypsin product.At present, generation Medicinal recombinant human alpha is there is no in boundary₁- antitrypsin product is produced.

The content of the invention

There is provided a kind of restructuring for expressing people's alpha1-antitrypsin is thin in order to overcome the above-mentioned deficiency of prior art by the present invention Born of the same parents' strain.

It is a further object to provide a kind of application for the recombinant cell strain for expressing people's alpha1-antitrypsin.

To achieve these goals, the present invention is achieved by the following technical programs：

A kind of construction method for the recombinant cell strain for expressing people's alpha1-antitrypsin, comprises the following steps：

(1) acquisition alpha1-antitrypsin containing people gene order, riddled basins sequence, AAVS1 sites are left and right homologous The expression plasmid of arm sequence, the gene order of people's alpha1-antitrypsin described in expression plasmid, riddled basins sequence are described Between the left and right homology arm in AAVS1 sites；A LoxP sequence is inserted in the both sides of riddled basins respectively in expression plasmid Row, and the direction of the two LoxP sequences is consistent, the recombinant plasmid for the expression people's alpha1-antitrypsin transformed；

(2) recombinant plasmid for the expression people's alpha1-antitrypsin for transforming step (1) and targeting AAVS1 sites The body cell of CRISPR/Cas9 plasmid co-transfection people, screening obtains the body cell of site-directed integration；

(3) to express the body cell for the site-directed integration that the plasmid transfection step (2) of Cre enzymes is obtained, Cre/LoxP systems are passed through System excision selection markers, screening acquisition has cut off selection markers and stable expression recombinant alpha₁The strain of-antitryptic body cell.

The cell line of the present invention is realized by CRISPR/Cas9 gene editing technology combinations homologous recombination.Wherein CRISPR/Cas9 target sequence is in the genome AAVS1 sites of people, and target sequence is GGGGCCACTAGGGACAGGAT.When After CRISPR/Cas9 plasmids and improved expression vector cotransfection body cell, CRISPR/Cas9 systems are sheared at target site DNA, forms double-strand breach.In the case where there is the target gene carrier containing homology arm, double-strand breach enters using it as template Row homologous recombination repair, realizes fixed point insertion of the target gene at target spot.

In the present invention, the AAVS1 sites of human genome are located at the introne of the PPP1R12C genes of No. 19 chromosomes of people In；People's alpha1-antitrypsin has such as SEQ ID NO:Amino acid sequence shown in 1, the gene of people's alpha1-antitrypsin With such as SEQ ID NO:Nucleotide sequence shown in 2.

The gene order of alpha1-antitrypsin containing people, riddled basins sequence, AAVS1 sites are left and right described in step (1) The expression plasmid of homology arm sequence, can be built by clone technology, can also directly use commercialized product plasmid. Preferably, the gene order of alpha1-antitrypsin containing people, riddled basins sequence, AAVS1 sites are left and right same described in step (1) The expression plasmid of source arm sequence is Genome-TALER^TMArticle No. is DC-DON-SH01 AAVS1 donor clone carriers.

Preferably, the LoxP sequences such as SEQ ID NO:Shown in 4.

AAVS1 sites exist in all people's cell, so all types of people's cells can be entered by this method Row gene editing, simply expressing quantity may be different.Preferably, the body cell for the people that selection has been commercially produced is made For recipient cell, industrial production of being more convenient for, most preferably, the body cell of the people is HEK293 cells or PER.C6 cells.Especially It is HEK293 cells, and the amount of its express express target protein is especially good, in addition, people's alpha1-antitrypsin of cell line expression 26S Proteasome Structure and Function is more closely similar to natural alpha1-antitrypsin, is more beneficial for the popularization of people's alpha1-antitrypsin preparation and answers With.

Preferably, in the preparation method for the recombinant cell strain that the present invention is provided, the riddled basins in step (1) It is made up of fluorescent reporter gene and drug resistance gene.It is glimmering in the riddled basins in certain embodiments of the present invention Light reporter gene is GFP genes, and drug resistance gene is anti-puromycin gene.

In some embodiments of the invention, in the preparation method for the recombinant cell strain that the present invention is provided, institute in step (1) State people's alpha1-antitrypsin gene, riddled basins, the left and right homology arm in AAVS1 sites, LoxP arrangement mode it is specific For：The left homology arm in AAVS1 sites, the gene of expression people's alpha1-antitrypsin, LoxP, GFP gene, anti-puromycin gene, The right homology arm in LoxP, AAVS1 site is arranged in order；And the two LoxP direction of insertion is identical.

In some embodiments of the invention, step (1) concretely comprises the following steps in the preparation method that the present invention is provided：Take Genome-CRISP^TMHuman AAVS1Safe Harbor Gene Knock-in Kits (GeneCopoeia, Inc.) product Contain each 800bp's in AAVS1 target spots both sides or so in people's alpha1-antitrypsin expression plasmid in DC-DON-SH01, the plasmid Homology arm；And two include people's alpha1-antitrypsin gene with controlling element between homology arm and (express the anti-pancreas eggs of people α 1- The gene of white enzyme), the GFP genes of T2A connections and anti-puromycin gene (gene that i.e. expression screening is marked)；The plasmid is entered The following transformation of row：A LoxP sequence in the same direction is inserted in the gene both sides marked in the expression screening of above-mentioned plasmid respectively.

Preferably, in the preparation method for the recombinant cell strain that the present invention is provided, targeting AAVS1 sites in step (2) The target sequence of CRISPR/Cas9 carrier such as SEQ ID NO:Shown in 3.In some embodiments of the invention, target used To the Genome-CRISP that the CRISPR/Cas9 in AAVS1 sites carrier is plasmid, more specifically GeneCopoeia companies^TMMatter Grain.

In the other embodiment of the present invention, in the preparation method that the present invention is provided, the sieve is obtained in step (3) Screening technique used in the positive cell line of choosing mark is specially：First pass through puromycin screen 48 hours, after by green it is glimmering Light GFP screens single cell clone, eventually passes No. 19 chromosomes of the interface PCR checking Gene targetings in HEK293 cells AAVS1 sites, are produced.

In the other embodiment of the present invention, in the preparation method that the present invention is provided, the sieve is obtained in step 3 Screening technique used in the negative cell line of choosing mark is specially：The cell line for taking the selection markers positive, transfection expression Cre The plasmid of enzyme, is cloned by screening GFP negative cells, and by containing expression people's alpha1-antitrypsin in PCR checking genomes Gene and without GFP and anti-puromycin gene, that is, obtain without selection markers, stable expression people's alpha1-antitrypsin Recombinant cell strain.

The preparation for the recombinant cell strain that the present invention is provided is by CRISPR/Cas9 gene editing technology combination homologous recombinations Realize.Wherein, CRISPR/Cas9 target sequence is in the genome AAVS1 sites of people, when CRISPR/Cas9 plasmids and containing institute State the left and right homology arm of the gene, the gene of expression screening mark and the AAVS1 sites of expression people's alpha1-antitrypsin After expression vector cotransfection HEK293 cells, CRISPR/Cas9 systems shear DNA at target site, form double-strand breach；Depositing In the case of the expression vector containing homology arm, double-strand breach carries out homologous recombination repair, realizes mesh using it as template Gene at target spot fixed point insertion.Cell after transfection is screened by puromycin, obtains transgenic cell.Transgenosis is thin Born of the same parents carry out the screening of GFP positive cells monoclonal by limiting dilution.The cell monoclonal obtained is screened to examine by PCR, it is determined that Whether genetic recombination is there occurs at target site, so as to exclude random integration clone.Sieved afterwards by expressing the plasmid pair of Cre enzymes Select obtained cell line to be transfected again, screening has cut off the cell monoclonal of selection markers, that is, obtain be free of selection markers, The antitryptic cell lines of stable express alpha 1-.

The body cell for the recombined human that construction method as described above is prepared is in secreting, expressing people's alpha1-antitrypsin Using.In the recombinant cell strain prepared by the construction method of the present invention, people's alpha1-antitrypsin is gene site-directed to be inserted into people The AAVS1 sites of No. 19 chromosome, the cell line can express people's alpha1-antitrypsin, available for the anti-pancreases of Prepare restructuring people α 1- Protease.

It is highly preferred that a kind of construction method for the recombinant cell strain for expressing people's alpha1-antitrypsin, including following step Suddenly：

(1) in Genome-TALER^TMArticle No. is the riddled basins of DC-DON-SH01 AAVS1 donor clone carriers Both sides insert a LoxP sequence respectively, and the direction of the two LoxP sequences is consistent, the anti-pancreases of expression people α 1- transformed The recombinant plasmid of protease, LoxP sequences such as SEQ ID NO:Shown in 4；

(2) recombinant plasmid for transforming step (1) is with the CRISPR/Cas9 plasmid co-transfection people's in targeting AAVS1 sites Body cell, screening obtains the body cell of site-directed integration, and the CRISPR/Cas9 plasmids in targeting AAVS1 sites are public for GeneCopoeia The Genome-CRISP of department^TMPlasmid；

Preferably, the method for recombinant cell strain secreting, expressing people's alpha1-antitrypsin is to cultivate the recombinant cell Strain to cell density is 75%~95%, changes culture medium, continues to cultivate 20h~28h, collects supernatant, produce.

In some embodiments of the invention, the method that the present invention provides people's alpha1-antitrypsin, is specifically included：It incite somebody to action this The recombinant cell strain HEK293 that invention is provided is placed in the culture environment of suitable cell growth, makes the cell length to 90%, more Change serum free medium to continue to cultivate 24 hours, collect cell conditioned medium, produce.

Compared with prior art, the present invention has the advantages that：

The people α that the present invention is realized by the CRISPR/Cas9 homologous recombination techniques aided in₁- antitrypsin gene is in people Body cell genome AAVS1 sites fixed point restructuring, while eliminate selection markers, acquisition has cut off selection markers and steady Surely recombinant alpha is expressed₁- antitryptic body cell.The method can make recombinant human alpha₁- antitrypsin constitutive expression, it is to avoid The phenomenons such as gene expression decay, silence.With the body cell of people, especially HEK293 cells for host, the recombinant alpha of expression₁- anti- The 26S Proteasome Structure and Function of trypsase is more closely similar to natural α₁- antitrypsin, is more beneficial for people's alpha1-antitrypsin preparation Promotion and application.

Brief description of the drawings

Fig. 1 is schematic diagram before and after the expression plasmid vector modification with target spot homology arm, and wherein Fig. 1-A are plasmid before transformation Structure, Fig. 1-B be improved plasmid structure.

Fig. 2 is carrier digestion verification figure after transformation.

Fig. 3 is that CRISPR/Cas9 is cut after target spot formation double-strand breach, and the gene insertion principle of homologous recombination repair mediation is shown It is intended to.

Fig. 4 is interface PCR detects schematic diagrams；Wherein, 5 ' interface PCR primer length are 1.1kb；3 ' interface PCR primers are long Spend for 1.2kb.

Embodiment

The present invention is made with reference to Figure of description and specific embodiment and further being elaborated, the embodiment It is served only for explaining the present invention, is not intended to limit the scope of the present invention.Test method used in following embodiments is such as without spy Different explanation, is conventional method；Used material, reagent etc., are the reagent commercially obtained unless otherwise specified And material.

People α₁- antitrypsin gene total length 1257bp, encodes 418 amino acid, the people α₁- antitrypsin has Such as SEQ ID NO:Amino acid sequence shown in 1；Its gene has such as SEQ ID NO:Nucleotide sequence shown in 2.

Embodiment 1

A kind of recombinant HEK 293 cell strain for expressing people's alpha1-antitrypsin, specific construction method is as follows.

First, vector modification：Contain AAVS1 target sites or so homology arm, riddled basins, people's alpha1-antitrypsin base The plasmid of cause has many commercialized kinds, and the present embodiment uses Genome-CRISP^TMHuman AAVS1Safe Harbor People α in Gene Knock-in Kits (GeneCopoeia, Inc.) products DC-DON-SH01₁- antitrypsin expresses matter Grain.The homology arm of AAVS1 target spots both sides is carried on the expression plasmid, left homologous arm lengths 782bp, is the sequence close on the left of target spot Row.Right homologous arm lengths 819bp, is the sequence close on the right side of target spot, while the gene also marked on plasmid with expression screening, The structure of the plasmid is as shown in Fig. 1-A.

By digestion interconnection technique, a LoxP is inserted in the both sides of the gene marked in the expression screening of expression vector respectively Sequence, and ensure that two LoxP sequences directions are consistent, the structure of improved plasmid is as shown if figure 1-b.Comprise the following steps that：

1. by the people α in product DC-DON-SH01₁- antitrypsin expression plasmid BglII and AsiSI double digestions, are returned The fragment for receiving about 10K is used as linear carrier.

2. design anneal primer LoxP1-F/R.Sequence is as follows：

LoxP1-F:gatctATAACTTCGTATAGCATACATTATACGAAGTTATgcggccgcaaggatctgcgat

LoxP1-R:CGCAGATCCTTGCGGCCGCATAACTTCGTATAATGTATGCTATACGAAGTTATA

It is connected, converts with the linearized vector of step 1 after two primer hybridizations, then bacterium solution PCR is screened.Screening primer is LoxP1-seqF/LoxP1-R, amplifies and carrys out 176bp for positive colony, and send survey (wherein, sequencing primer LoxP1-seqF: CATCGCATTGTCTGAGTAGG), the middle interstitial granules built, labeled as HA-AAT-LoxP1, so far, introduces 5 ' LoxP Sequence.

3. the middle interstitial granules HA-AAT-LoxP1 to build uses SacII-HpaI digestions as carrier.It is with LoxP2-F/R Primer amplification initial carrier HA-AAT is fragment, and size is 571bp.Primer sequence is as follows：

LoxP2-F：GTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGC

LoxP2-R：

ATAAGCTGCAATAAACAAGTTAACATAACTTCGTATAATGTATGCTATACGAAGTTATTGATACAAAGG CATTAAAGC

By this fragment with the HA-AAT-LoxP1 linearized vectors after SacII and HpaI digestions according to 5:1 mol ratio Bacterium solution PCR screenings are carried out after connection, conversion.It is used screening primer be：LoxP2-seqF1/seqR1：

LoxP2-seqF1:TCGCCGCCGCGTTCGCCGAC

LoxP2-seqR1:CATTTGAGTCAATTCCAGAC

Positive colony is selected, and (wherein, sequencing primer LoxP2-seqR1 is sequenced:CATTTGAGTCAATTCCAGAC), obtain To the plasmid built, so far introduce 3 ' LoxP sequences, obtain final carrier construction HA-AAT-LoxP2, i.e., it is improved to contain table Intelligent α₁The expression plasmid of the left and right homology arm of-antitryptic gene, the gene of expression screening mark and AAVS1 sites, Sequence such as SEQ ID NO between the left and right homology arm of HA-AAT-LoxP2 plasmids：Shown in 5.

2nd, cell transfecting：The CRISPR/Cas9 plasmids in the targeting AAVS1 sites are Genome-CRISP^TMHuman AAVS1Safe Harbor Gene Knock-in Kits (GeneCopoeia, Inc.) product HCP-AAVS1-CG02, target spot Sequence GGGGCCACTAGGGACAGGAT.

HEK293 cells are inoculated in six orifice plates into culture, and (corresponding condition is：Hyclone containing GIBICO 10% DMEM culture mediums, 37 DEG C, 5% CO₂, cultivate 24 hours or so), treat that cell growth, to 80% or so, is transfected.Under State step operation：

1st, CRISPR/Cas9 plasmids and the improved people α containing homology arm₁- antitrypsin gene expression plasmid totally 2 Microgram is with 1:After 1 mol ratio is mixed, mixed with 250 microlitres of Opti-MEM serum free mediums, and stand 5 minutes.Meanwhile, take 10 microlitres of Lipo2000 transfection reagents and 250 microlitres of Opti-MEM serum free mediums of equivalent are mixed, and stand 5 minutes.

2nd, after 5 minutes, the two mixed liquors are fully mixed, 20 minutes are stood.

3rd, before cell transfecting with PBS once, above-mentioned mixed liquor is uniformly added drop-wise to cell surface to be transfected.

4th, after 6 hours, plus 500 microlitres of cell culture mediums containing 40% hyclone, continue to cultivate.

5th, 24 hours after transfecting, Secondary Culture is carried out.

6th, 2 μ g/mL puromycin screening 48h is added in culture medium, the positive cell line of puromycin is obtained.

7th, limiting dilution assay carries out the screening of GFP positive cells monoclonal.

CRISPR/Cas9 plasmids enter cell, and the Cas9 nucleases of coding are under guiding RNA guide, with reference in target spot In sequence, and special cut chromosome target position formation double-strand break breach.DNA double chain fracture breach triggers the DNA of cell Repair procedure.There is the people α containing homology arm₁In the case of-antitrypsin gene expression plasmid, homology arm and chromosome On homologous sequence by base pair complementarity formation heterozygosis chain, and with the people α containing homology arm₁- antitrypsin gene table It is template up to plasmid, breach is repaired, so that by people α₁- antitrypsin gene is incorporated into gap position.

Fig. 2 shows that CRISPR/Cas9 is cut after target spot formation double-strand breach, and the gene insertion principle of homologous recombination repair mediation is shown It is intended to.

3rd, routinely operate and enter line interface PCR and Western Blot identifications respectively to gained cell line.

Interface PCR is identified：Target AAVS1 CRISPR/Cas9 combinations homologous recombination mediation expression people α₁- antitrypsin Gene No. 19 chromosomes of people AAVS1 sites site-directed integration, therefore respectively with 5 ' end interface PCR primer (F： CCGGAACTCTGCCCTCTAAC；R：) and 3 ' end interface PCR primer (F CCCGTGAGTCAAACCGCTAT： AGCTCATCTGGTCTCCCTTCC；R：TCCTGGGATACCCCGAAGAG) expanded, to determine the integration of gene.Specific side Method is：Extraction cell DNA is template, is diluted to 200ng/ μ L. Max DNA Polymerase(Takara)5 μ L, template 1 μ L, 2 micromolar each 1 μ L of primer, add water and supply 10 μ L systems.Expanded using two-step method PCR：98 DEG C of pre-degenerations 20s, 55 DEG C of annealing 15s, 72 DEG C of extension 20s, 30 circulations.

Western Blot are identified：Recombinant cell strain is incubated at 75cm²In cell bottle, treat that cell length, to 80%, changes nothing Blood serum medium culture 24h.Cells and supernatant is collected, SDS-PAGE electrophoresis is carried out.With the Abcam anti-pancreas eggs of rabbit-anti people α 1- How anti-white enzyme is as primary antibody, and goat anti-rabbit igg carries out Western Blot detections as secondary antibody.

It is that positive cell clone, i.e. interface PCR two ends are the positive to select the selection result, and Western Blot are detected Show the cell clone of band.Fig. 3 shows interface PCR detects schematic diagrams；Wherein, 5 ' interface PCR primer length are 1.1kb；3’ Interface PCR primer length is 1.2kb.

4th, secondary transfection is carried out to above-mentioned cell clone：The selection result is inoculated in six holes for positive cell clone (corresponding condition can be in plate：The DMEM culture mediums of hyclone containing GIBICO 10%, 37 DEG C, 5% CO₂, cultivate 24h Left and right), treat that cell growth, to 80% or so, is transfected.It can be operated according to following step：

1st, by the μ g of Cre enzymes plasmid 2, mixed with 250 μ L Opti-MEM serum free mediums, and stand 5min.Meanwhile, take 10 μ L Lipo2000 transfection reagents and 250 μ L of equivalent Opti-MEM serum free mediums are mixed, and stand 5min.

2nd, after 5 minutes, two mixed liquors are fully mixed, 20 minutes are stood.

3rd, before cell transfecting with PBS once, above-mentioned mixed liquor is uniformly added drop-wise to cell surface.

5th, 24 hours after transfecting, Secondary Culture is carried out.

6th, limiting dilution assay carries out monoclonal screening, obtains GFP negative cells monoclonals.

7th, GFP negative cells monoclonal genomic DNAs are extracted, PCR detections are screened without GFP (primer GFP-F： GGCTACGGCTTCTACCACTTCG；GFP-R：GTGTTGCTGTGCAGCTCCTCC；Product 443bp), without puromycin (primer Puro-F:atgaccgagtacaagcccacgg；Puro-R:CGGGTCGACTCTAGAGGATCC；Product 600bp) gene band Cell clone, that is, obtain without selection markers, stable expression people α₁- antitryptic recombinant cell strain.

5th, Enzyme assay：Recombinant cell strain is incubated at 75cm²In cell bottle, treat that cell length, to 80%, changes serum-free Medium culture 24 hours.Cells and supernatant is collected, α is carried out₁- antitrypsin Enzyme activity assay.

Specific method is：With Sigma α₁- antitrypsin standard items carry out gradient dilution, and with excessive elastic egg White enzyme is incubated 20 minutes, detects the amount of residual activity elastoser (by 405 nanometers of absorbances of chemiluminescence detection, reaction Elastase substrate Suc-Ala-Ala-Ala-pNa (Sigma) decomposition substrate content).It is bent using acquired results as standard People's alpha1-antitrypsin active quantities are 0.4g/L in line, detection culture supernatant.

SEQUENCE LISTING

<110>Shenzhen Weiguang Biological Products Co., Ltd.

<120>A kind of recombinant cell strain for expressing people's alpha1-antitrypsin and its application

<130>

<160> 5

<170> PatentIn version 3.3

<210> 1

<211> 418

<212> PRT

<213>People's alpha1-antitrypsin amino acid sequence

<400> 1

Met Pro Ser Ser Val Ser Trp Gly Ile Leu Leu Leu Ala Gly Leu Cys

1 5 10 15

Cys Leu Val Pro Val Ser Leu Ala Glu Asp Pro Gln Gly Asp Ala Ala

20 25 30

Gln Lys Thr Asp Thr Ser His His Asp Gln Asp His Pro Thr Phe Asn

35 40 45

Lys Ile Thr Pro Asn Leu Ala Glu Phe Ala Phe Ser Leu Tyr Arg Gln

50 55 60

Leu Ala His Gln Ser Asn Ser Thr Asn Ile Phe Phe Ser Pro Val Ser

65 70 75 80

Ile Ala Thr Ala Phe Ala Met Leu Ser Leu Gly Thr Lys Ala Asp Thr

85 90 95

His Asp Glu Ile Leu Glu Gly Leu Asn Phe Asn Leu Thr Glu Ile Pro

100 105 110

Glu Ala Gln Ile His Glu Gly Phe Gln Glu Leu Leu Arg Thr Leu Asn

115 120 125

Gln Pro Asp Ser Gln Leu Gln Leu Thr Thr Gly Asn Gly Leu Phe Leu

130 135 140

Ser Glu Gly Leu Lys Leu Val Asp Lys Phe Leu Glu Asp Val Lys Lys

145 150 155 160

Leu Tyr His Ser Glu Ala Phe Thr Val Asn Phe Gly Asp Thr Glu Glu

165 170 175

Ala Lys Lys Gln Ile Asn Asp Tyr Val Glu Lys Gly Thr Gln Gly Lys

180 185 190

Ile Val Asp Leu Val Lys Glu Leu Asp Arg Asp Thr Val Phe Ala Leu

195 200 205

Val Asn Tyr Ile Phe Phe Lys Gly Lys Trp Glu Arg Pro Phe Glu Val

210 215 220

Lys Asp Thr Glu Glu Glu Asp Phe His Val Asp Gln Val Thr Thr Val

225 230 235 240

Lys Val Pro Met Met Lys Arg Leu Gly Met Phe Asn Ile Gln His Cys

245 250 255

Lys Lys Leu Ser Ser Trp Val Leu Leu Met Lys Tyr Leu Gly Asn Ala

260 265 270

Thr Ala Ile Phe Phe Leu Pro Asp Glu Gly Lys Leu Gln His Leu Glu

275 280 285

Asn Glu Leu Thr His Asp Ile Ile Thr Lys Phe Leu Glu Asn Glu Asp

290 295 300

Arg Arg Ser Ala Ser Leu His Leu Pro Lys Leu Ser Ile Thr Gly Thr

305 310 315 320

Tyr Asp Leu Lys Ser Val Leu Gly Gln Leu Gly Ile Thr Lys Val Phe

325 330 335

Ser Asn Gly Ala Asp Leu Ser Gly Val Thr Glu Glu Ala Pro Leu Lys

340 345 350

Leu Ser Lys Ala Val His Lys Ala Val Leu Thr Ile Asp Glu Lys Gly

355 360 365

Thr Glu Ala Ala Gly Ala Met Phe Leu Glu Ala Ile Pro Met Ser Ile

370 375 380

Pro Pro Glu Val Lys Phe Asn Lys Pro Phe Val Phe Leu Met Ile Glu

385 390 395 400

Gln Asn Thr Lys Ser Pro Leu Phe Met Gly Lys Val Val Asn Pro Thr

405 410 415

Gln Lys

<210> 2

<211> 1257

<212> DNA

<213>People's alpha1-antitrypsin gene order

<400> 2

atgccgtctt ctgtctcgtg gggcatcctc ctgctggcag gcctgtgctg cctggtccct 60

gtctccctgg ctgaggatcc ccagggagat gctgcccaga agacagatac atcccaccat 120

gatcaggatc acccaacctt caacaagatc acccccaacc tggctgagtt cgccttcagc 180

ctataccgcc agctggcaca ccagtccaac agcaccaata tcttcttctc cccagtgagc 240

atcgctacag cctttgcaat gctctccctg gggaccaagg ctgacactca cgatgaaatc 300

ctggagggcc tgaatttcaa cctcacggag attccggagg ctcagatcca tgaaggcttc 360

caggaactcc tccgtaccct caaccagcca gacagccagc tccagctgac caccggcaat 420

ggcttgttcc tcagcgaggg cctgaagcta gtggataagt ttttggagga tgttaaaaag 480

ttgtaccact cagaagcctt cactgtcaac ttcggggaca ccgaagaggc caagaaacag 540

atcaacgatt acgtggagaa gggtactcaa gggaaaattg tggatttggt caaggagctt 600

gacagagaca cagtttttgc tctggtgaat tacatcttct ttaaaggcaa atgggagaga 660

ccctttgaag tcaaggacac cgaggaagag gacttccacg tggaccaggt gaccaccgtg 720

aaggtgccta tgatgaagcg tttaggcatg tttaacatcc agcactgtaa gaagctgtcc 780

agctgggtgc tgctgatgaa atacctgggc aatgccaccg ccatcttctt cctgcctgat 840

gaggggaaac tacagcacct ggaaaatgaa ctcacccacg atatcatcac caagttcctg 900

gaaaatgaag acagaaggtc tgccagctta catttaccca aactgtccat tactggaacc 960

tatgatctga agagcgtcct gggtcaactg ggcatcacta aggtcttcag caatggggct 1020

gacctctccg gggtcacaga ggaggcaccc ctgaagctct ccaaggccgt gcataaggct 1080

gtgctgacca tcgacgagaa agggactgaa gctgctgggg ccatgttttt agaggccata 1140

cccatgtcta tcccccccga ggtcaagttc aacaaaccct ttgtcttctt aatgattgac 1200

caaaatacca agtctcccct cttcatggga aaagtggtga atcccaccca aaaataa 1257

<210> 3

<211> 20

<212> DNA

<213>Target sequence

<400> 3

ggggccacta gggacaggat 20

<210> 4

<211> 34

<212> DNA

<213>LoX-p sequences

<400> 43

ataacttcgt atagcataca ttatacgaag ttat 34

<210> 5

<211> 6622

<212> DNA

<213>Sequence between the homology arm of left and right

<400> 5

tgtatatcga ggtttattta ttaatttgaa tagatattaa gttttattat atttacactt 60

acatactaat aataaattca acaaacaatt tatttatgtt tatttattta ttaaaaaaaa 120

acaaaaactc aaaatttctt ctataaagta acaaaacttt tatgagggac agcccccccc 180

caaagccccc agggatgtaa ttacgtccct cccccgctag ggggcagcag cgagccgccc 240

ggggctccgc tccggtccgg cgctcccccc gcatccccga gccggcagcg tgcggggaca 300

gcccgggcac ggggaaggtg gcacgggatc gctttcctct gaacgcttct cgctgctctt 360

tgagcctgca gacacctggg gggatacggg gaaaaggcct ccaaggccta ctagtaacgg 420

ccgccagtgt gctggaattc gcccttggta cctgctttct ctgaccagca ttctctcccc 480

tgggcctgtg ccgctttctg tctgcagctt gtggcctggg tcacctctac ggctggccca 540

gatccttccc tgccgcctcc ttcaggttcc gtcttcctcc actccctctt ccccttgctc 600

tctgctgtgt tgctgcccaa ggatgctctt tccggagcac ttccttctcg gcgctgcacc 660

acgtgatgtc ctctgagcgg atcctccccg tgtctgggtc ctctccgggc atctctcctc 720

cctcacccaa ccccatgccg tcttcactcg ctgggttccc ttttccttct ccttctgggg 780

cctgtgccat ctctcgtttc ttaggatggc cttctccgac ggatgtctcc cttgcgtccc 840

gcctcccctt cttgtaggcc tgcatcatca ccgtttttct ggacaacccc aaagtacccc 900

gtctccctgg ctttagccac ctctccatcc tcttgctttc tttgcctgga caccccgttc 960

tcctgtggat tcgggtcacc tctcactcct ttcatttggg cagctcccct acccccctta 1020

cctctctagt ctgtgctagc tcttccagcc ccctgtcatg gcatcttcca ggggtccgag 1080

agctcagcta gtcttcttcc tccaacccgg gcccctatgt ccacttcagg acagcatgtt 1140

tgctgcctcc agggatcctg tgtccccgag ctgggaccac cttatattcc cagggccggt 1200

taatgtggct ctggttctgg gtacttttat ctgtcccctc caccccacag tggggcacgc 1260

gtaagggcga attctgcaga tatccatcac actggcggcc gctcgagcat gcatctagta 1320

ttatgcccag tacatgacct tatgggactt tcctacttgg cagtacatct acgtattagt 1380

catcgctatt accatggtga tgcggttttg gcagtacatc aatgggcgtg gatagcggtt 1440

tgactcacgg ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca 1500

ccaaaatcaa cgggactttc caaaatgtcg taacaactcc gccccattga cgcaaatggg 1560

cggtaggcgt gtacggtggg aggtctatat aagcagagct cgtttagtga accgtcagat 1620

cgcctggaga cgccatccac gctgttttga cctccataga agattctaga ttcgaagaac 1680

aagtttgtac aaaaaagcag gcttggaagg agttcgaacc atgccgtctt ctgtctcgtg 1740

gggcatcctc ctgctggcag gcctgtgctg cctggtccct gtctccctgg ctgaggatcc 1800

ccagggagat gctgcccaga agacagatac atcccaccat gatcaggatc acccaacctt 1860

caacaagatc acccccaacc tggctgagtt cgccttcagc ctataccgcc agctggcaca 1920

ccagtccaac agcaccaata tcttcttctc cccagtgagc atcgctacag cctttgcaat 1980

gctctccctg gggaccaagg ctgacactca cgatgaaatc ctggagggcc tgaatttcaa 2040

cctcacggag attccggagg ctcagatcca tgaaggcttc caggaactcc tccgtaccct 2100

caaccagcca gacagccagc tccagctgac caccggcaat ggcttgttcc tcagcgaggg 2160

cctgaagcta gtggataagt ttttggagga tgttaaaaag ttgtaccact cagaagcctt 2220

cactgtcaac ttcggggaca ccgaagaggc caagaaacag atcaacgatt acgtggagaa 2280

gggtactcaa gggaaaattg tggatttggt caaggagctt gacagagaca cagtttttgc 2340

tctggtgaat tacatcttct ttaaaggcaa atgggagaga ccctttgaag tcaaggacac 2400

cgaggaagag gacttccacg tggaccaggt gaccaccgtg aaggtgccta tgatgaagcg 2460

tttaggcatg tttaacatcc agcactgtaa gaagctgtcc agctgggtgc tgctgatgaa 2520

atacctgggc aatgccaccg ccatcttctt cctgcctgat gaggggaaac tacagcacct 2580

ggaaaatgaa ctcacccacg atatcatcac caagttcctg gaaaatgaag acagaaggtc 2640

tgccagctta catttaccca aactgtccat tactggaacc tatgatctga agagcgtcct 2700

gggtcaactg ggcatcacta aggtcttcag caatggggct gacctctccg gggtcacaga 2760

ggaggcaccc ctgaagctct ccaaggccgt gcataaggct gtgctgacca tcgacgagaa 2820

agggactgaa gctgctgggg ccatgttttt agaggccata cccatgtcta tcccccccga 2880

ggtcaagttc aacaaaccct ttgtcttctt aatgattgac caaaatacca agtctcccct 2940

cttcatggga aaagtggtga atcccaccca aaaatagctc gagtgcggcc gcaacccagc 3000

tttcttgtac aaagtggttg atcgaaatcg gatccctgtg ccttctagtt gccagccatc 3060

tgttgtttgc ccctcccccg tgccttcctt gaccctggaa ggtgccactc ccactgtcct 3120

ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt ctattctggg 3180

gggtggggtg gggcaggaca gcaaggggga ggattgggaa gacaatagca ggcatgctgg 3240

ggatgcggtg ggctctatgg agatctataa cttcgtatag catacattat acgaagttat 3300

gcggccgcaa ggatctgcga tcgctccggt gcccgtcagt gggcagagcg cacatcgccc 3360

acagtccccg agaagttggg gggaggggtc ggcaattgaa cgggtgccta gagaaggtgg 3420

cgcggggtaa actgggaaag tgatgtcgtg tactggctcc gcctttttcc cgagggtggg 3480

ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc tttttcgcaa cgggtttgcc 3540

gccagaacac agctgaagct tcgaggggct cgcatctctc cttcacgcgc ccgccgccct 3600

acctgaggcc gccatccacg ccggttgagt cgcgttctgc cgcctcccgc ctgtggtgcc 3660

tcctgaactg cgtccgccgt ctaggtaagt ttaaagctca ggtcgagacc gggcctttgt 3720

ccggcgctcc cttggagcct acctagactc agccggctct ccacgctttg cctgaccctg 3780

cttgctcaac tctacgtctt tgtttcgttt tctgttctgc gccgttacag atccaagctg 3840

tgaccggcgc ctacgctaga cgccaccatg gagagcgacg agagcggcct gcccgccatg 3900

gagatcgagt gccgcatcac cggcaccctg aacggcgtgg agttcgagct ggtgggcggc 3960

ggagagggca cccccaagca gggccgcatg accaacaaga tgaagagcac caaaggcgcc 4020

ctgaccttca gcccctacct gctgagccac gtgatgggct acggcttcta ccacttcggc 4080

acctacccca gcggctacga gaaccccttc ctgcacgcca tcaacaacgg cggctacacc 4140

aacacccgca tcgagaagta cgaggacggc ggcgtgctgc acgtgagctt cagctaccgc 4200

tacgaggccg gccgcgtgat cggcgacttc aaggtggtgg gcaccggctt ccccgaggac 4260

agcgtgatct tcaccgacaa gatcatccgc agcaacgcca ccgtggagca cctgcacccc 4320

atgggcgata acgtgctggt gggcagcttc gcccgcacct tcagcctgcg cgacggcggc 4380

tactacagct tcgtggtgga cagccacatg cacttcaaga gcgccatcca ccccagcatc 4440

ctgcagaacg ggggccccat gttcgccttc cgccgcgtgg aggagctgca cagcaacacc 4500

gagctgggca tcgtggagta ccagcacgcc ttcaagaccc ccatcgcctt cgccagatcc 4560

cgcgctcagt cgtccaattc tgccgtggac ggcaccgccg gacccggctc caccggatct 4620

cgcgagggca gaggaagtct tctaacatgc ggtgacgtgg aggagaatcc cggccctatg 4680

accgagtaca agcccacggt gcgcctcgcc acccgcgacg acgtccccag ggccgtacgc 4740

accctcgccg ccgcgttcgc cgactacccc gccacgcgcc acaccgtcga tccggaccgc 4800

cacatcgagc gggtcaccga gctgcaagaa ctcttcctca cgcgcgtcgg gctcgacatc 4860

ggcaaggtgt gggtcgcgga cgacggcgcc gcggtggcgg tctggaccac gccggagagc 4920

gtcgaagcgg gggcggtgtt cgccgagatc ggcccgcgca tggccgagtt gagcggttcc 4980

cggctggccg cgcagcaaca gatggaaggc ctcctggcgc cgcaccggcc caaggagccc 5040

gcgtggttcc tggccaccgt cggcgtctcg cccgaccacc agggcaaggg tctgggcagc 5100

gccgtcgtgc tccccggagt ggaggcggcc gagcgcgccg gggtgcccgc cttcctggag 5160

acctccgcgc cccgcaacct ccccttctac gagcggctcg gcttcaccgt caccgccgac 5220

gtcgaggtgc ccgaaggacc gcgcacctgg tgcatgaccc gcaagcccgg tgcctgaaat 5280

caacctctgg attacaaaat ttgtgaaaga ttgactggta ttcttaacta tgttgctcct 5340

tttacgctat gtggatacgc tgctttaatg cctttgtatc aataacttcg tatagcatac 5400

attatacgaa gttatgttaa cttgtttatt gcagcttata atggttacaa ataaagcaat 5460

agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg tggtttgtcc 5520

aaactcatca atgtatctta tcatgtctgg aattgactca aatgatgtca attagtctat 5580

cagaagctca tctggtctcc cttccggggg acaagacatc cctgtttaat atttaaacag 5640

cagtgttccc aaactgggtt cttatatccc ttgctctggt caaccaggtt gcagggtttc 5700

ctgtcctcac aggaacgaag tccctaaaga aacagtggca gccaggttta gccccggaat 5760

tgactggatt ccttttttag ggcccattgg tatggtgtac actactaggg acaggattgg 5820

tgacagaaaa gccccatcct taggcctcct ccttcctagt ctcctgatat tgggtctaac 5880

ccccacctcc tgttaggcag attccttatc tggtgacaca cccccatttc ctggagccat 5940

ctctctcctt gccagaacct ctaaggtttg cttacgatgg agccagagag gatcctggga 6000

gggagagctt ggcagggggt gggagggaag ggggggatgc gtgacctgcc cggttctcag 6060

tggccaccct gcgctaccct ctcccagaac ctgagctgct ctgacgcggc tgtctggtgc 6120

gtttcactga tcctggtgct gcagcttcct tacacttccc aagaggagaa gcagtttgga 6180

aaaacaaaat cagaataagt tggtcctgag ttctaacttt ggctcttcac ctttctagtc 6240

cccaatttat attgttcctc cgtgcgtcag ttttacctgt gagataaggc cagtagccag 6300

ccccgtcctg gcagggctgt ggtgaggagg ggggtgtccg tgtggaaaac tccctttgtg 6360

agaatggtgc gtcctaggtg ttcaccaggt cgtggccgcc tctactccct ttctctttct 6420

ccatccttct ttccttaaag agtccccagt gctatctggg acatattcct ccgcccagag 6480

cagggtcccg cttccctaag gccctgctct gggcttctgg gtttgagtcc ttggcaagcc 6540

caggagaggc gctcaggctt ccctgtcccc cttcctcgtc caccatctca tgcccctggc 6600

tctcctgccc cttccctaca gg 6622

Claims

1. a kind of construction method for the recombinant cell strain for expressing people's alpha1-antitrypsin, it is characterised in that including following step Suddenly：

(1) gene order of alpha1-antitrypsin containing people, riddled basins sequence, the left and right homology arm sequence in AAVS1 sites are obtained The expression plasmid of row, the gene order of people's alpha1-antitrypsin described in expression plasmid, riddled basins sequence are described Between the left and right homology arm in AAVS1 sites；A LoxP sequence is inserted respectively in the both sides of the riddled basins of expression plasmid Row, and the direction of the two LoxP sequences is consistent, the recombinant plasmid for the expression people's alpha1-antitrypsin transformed；

(2) recombinant plasmid and the body of the CRISPR/Cas9 plasmid co-transfection people in targeting AAVS1 sites transformed step (1) are thin Born of the same parents, screening obtains the body cell of site-directed integration；

(3) to express the body cell for the site-directed integration that the plasmid transfection step (2) of Cre enzymes is obtained, cut by Cre/LoxP systems Except selection markers, screening acquisition has cut off selection markers and stable expression recombinant alpha₁The strain of-antitryptic body cell.

2. construction method according to claim 1, it is characterised in that the body cell of the people be HEK293 cells or PER.C6 cells.

3. construction method according to claim 1, it is characterised in that the selection markers are GFP genes and puromycin Gene.

4. construction method according to claim 1, it is characterised in that the LoxP sequences such as SEQ ID NO:Shown in 4.

5. construction method according to claim 1, it is characterised in that step（1）The gene of alpha1-antitrypsin containing people Sequence, riddled basins sequence, the expression plasmid of the left and right homology arm sequence in AAVS1 sites are Genome-TALER article No.s For DC-DON-SH01 AAVS1 donor clone carriers.

6. construction method according to claim 1, it is characterised in that comprise the following steps：

(1) it is the riddled basins of DC-DON-SH01 AAVS1 donor clone carriers in Genome-TALER article No.s A LoxP sequence is inserted in both sides respectively, and the direction of the two LoxP sequences is consistent, the anti-pancreas eggs of expression people α 1- transformed The recombinant plasmid of white enzyme, LoxP sequences such as SEQ ID NO:Shown in 4；

(2) recombinant plasmid and the body of the CRISPR/Cas9 plasmid co-transfection people in targeting AAVS1 sites transformed step (1) are thin Born of the same parents, screening obtains the body cell of site-directed integration, and the CRISPR/Cas9 plasmids in targeting AAVS1 sites are GeneCopoeia companies Genome-CRISP plasmids；

7. the recombinant cell that a kind of any one of claim 1 to 6 construction method is prepared.

8. application of the recombinant cell in secreting, expressing people's alpha1-antitrypsin described in claim 7.

9. application according to claim 8, it is characterised in that the method for the secreting, expressing people alpha1-antitrypsin is, It is 75%~95% to cultivate the recombinant cell strain to cell density, changes culture medium, continues to cultivate 20h~28h, collects supernatant Liquid, is produced.