CN107058200B - Method for preparing L-ascorbic acid-2-glucoside - Google Patents
Method for preparing L-ascorbic acid-2-glucoside Download PDFInfo
- Publication number
- CN107058200B CN107058200B CN201610985353.0A CN201610985353A CN107058200B CN 107058200 B CN107058200 B CN 107058200B CN 201610985353 A CN201610985353 A CN 201610985353A CN 107058200 B CN107058200 B CN 107058200B
- Authority
- CN
- China
- Prior art keywords
- sucrose phosphorylase
- fermentation
- sucrose
- ascorbic acid
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/44—Preparation of O-glycosides, e.g. glucosides
- C12P19/60—Preparation of O-glycosides, e.g. glucosides having an oxygen of the saccharide radical directly bound to a non-saccharide heterocyclic ring or a condensed ring system containing a non-saccharide heterocyclic ring, e.g. coumermycin, novobiocin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/01007—Sucrose phosphorylase (2.4.1.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
Abstract
The invention relates to a method for preparing L-ascorbic acid-2-glucoside by an engineering strain of recombinant sucrose phosphorylase. The preservation number of the engineering strain of the recombinant sucrose phosphorylase is as follows: CCTCC M2016496, wherein the preservation address is Wuhan, Wuhan university, and the postcode 430072. The invention adopts gene recombination and site-directed mutagenesis technology to construct an engineering strain for recombining sucrose phosphorylase. And (3) preparing AA-2G by taking the thallus cells obtained by fermentation as a biocatalyst and taking sucrose and L-ascorbic acid as raw materials in a trisodium citrate buffer solution system. The invention directly adopts sucrose as glycosyl donor, and the raw material is easy to dissolve in water, and is cheap and easy to obtain. Meanwhile, the product is single, the reaction product is mainly AA-2G, the yield is up to 65 percent, no additional saccharifying enzyme is needed for treatment, and the production cost is low.
Description
(I) technical field
The invention relates to the technical field of preparation of L-ascorbic acid-2-glucoside by using a biocatalyst, and particularly relates to a method for preparing L-ascorbic acid-2-glucoside.
(II) background of the invention
L-ascorbic acid-2-glucoside, i.e., 2-O-alpha-D-glucopyranosyl-L-ascorbic acid (2-O-alpha-D-glucopyranosyl-L-ascorbyl acid, AA-2G), is a glucoside derivative of L-ascorbic acid (i.e., vitamin C) which was commonly found by the Japan Biochemical research institute and the university of Ongshan, department of medicine (J. biochem. 107, 222-227 (1990); Agric. biol. chem., 54 (7),1697-1703 (1990); US5084563 (1992)). The L-ascorbic acid has the physiological activity of ascorbic acid, and meanwhile, as the hydroxyl on the 2-position C of the L-ascorbic acid is connected with glucose by alpha-1, 4 glycosidic bonds to form stable glycosidic bonds, the reducibility of the L-ascorbic acid is obviously reduced, and the stability is greatly improved. At present, AA-2G is mainly applied to the cosmetic industry and has the effects of resisting UV, inhibiting melanin and the like and whitening.
The Japanese researchers found AA-2G at the earliest, using alpha-Glucosidase (EC 3.2.1.20, alpha-Glucosidase) from Rhizopus or Mucor as catalyst, but with extremely low AA-2G product concentration, later found that using Cyclomaltodextrin Glucanotransferase (EC 2.4.1.19, Cyclomaltodextrine Glucanotransferase, CGTase for short) from Bacillus stearothermophilus as catalyst, AA-2G was prepared from cyclodextrin and L-ascorbic acid with conversion rate increased to 45% (Agric. biol. chem., 55 (7), 1751-1756, 1991). Later, some other glycosyltransferases were reported to be capable of synthesizing AA-2G in a biocatalytic manner by using corresponding glycosyl donors (such as maltose, oligomeric dextrin, starch and the like) and L-ascorbic acid and sodium salt as raw materials. Thus, the AA-2G biocatalytic enzymes reported so far are mainly alpha-Glucosidase (EC 3.2.1.20, alpha-Glucosidase) (US 3763009 (1973)), Cyclomaltodextrin Glucanotransferase (EC 2.4.1.19, Cyclomaltodextrine Glucanotransferase, CGTase for short) (US 5084563 (1992), US5137723 (1992), and US5407812 (1995), US9265781B2 (2016)), alpha-Amylase (EC 3.2.1.1, alpha-Amylase), Sucrose phosphorylase (EC 2.4.1.7, Sucrose phosphorylase) (Biotech Lett 29: 611-35615, 2007), Dextransucrase (EC 2.4.1.5, dextran sucrase) (Microbiological Research 165: 384: 391, 2010-391), alpha-glycosyltransferase (US 2010-1018792), CN 1018792, etc.).
At present, CGTase is adopted as a biocatalyst in AA-2G industrial production, but the adopted route has the following defects:
firstly, the CGTase enzyme used for production is a commercial enzyme preparation, instead of adopting the most direct CGTase fermentation liquor or a thallus cell containing the CGTase enzyme, and the reasons for the commercial enzyme preparation are that the activity of the CGTase fermentation enzyme is generally low at present, and the activity of the CGTase fermentation enzyme is low and cannot meet the requirement of enzyme activity for preparing AA-2G; in addition, if CGTase fermentation liquor or thalli are used as a catalyst, the enzyme activity requirement for preparing AA-2G is met through the operation steps of thalli crushing, concentration and the like.
Secondly, besides the target product AA-2G, a series of polysaccharide-based derivatives such as disaccharide, trisaccharide, tetrasaccharide and pentasaccharide can be generated, and a-saccharifying enzyme is additionally added to hydrolyze the polysaccharide-based derivatives and convert the polysaccharide-based derivatives into the target product AA-2G, so that the process steps are increased.
Thirdly, glycosyl donor cyclodextrin has the defects of poor water solubility, high price and the like, is not beneficial to conversion and has high raw material cost.
Fourthly, about 10 percent of mixed by-products of AA-5G (5-O-alpha-D-glucopyranosyl-L-ascorbic acid) and AA-6G (6-O-alpha-D-glucopyranosyl-L-ascorbic acid) are generated (US 5272136 (1993), US5468850 (1995)), which are not beneficial to subsequent separation and purification. Although later U.S. patents US20060216792 (2006) and US8759030 (2014) reported the preparation of AA-2G using α -isomaltosylglucosaccharide-derived enzyme derived from Arthrobacter globiformis a19 as a catalyst in order to avoid the formation of AA-5G and AA-6G by-products in CGTase catalyzed reactions, the enzyme source was not readily available.
Based on the above disadvantages, we used sucrose phosphatase as a biocatalyst for the preparation of AA-2G, because of the following potential advantages of using sucrose phosphatase as a catalyst:
the sucrose phosphorylase (SPase) is widely distributed, exists in most of microorganisms such as bacteria and the like, has high fermentation enzyme activity, does not need to adopt commercial enzyme preparations or cell wall breaking and concentration treatment, and can directly use fermentation liquor or cells as a biocatalyst.
Secondly, the sucrose phosphorylase adopts sucrose as a glycosyl donor, and the raw material is easy to dissolve in water, cheap and easy to obtain.
Thirdly, the product is single, the reaction products are mainly AA-2G and fructose, and no saccharifying enzyme is required to be added for treatment.
Fourthly, the reaction condition is mild, the reaction temperature is 30-37 ℃, and the heat energy consumption is low.
Disclosure of the invention
Based on the defects existing in the current AA-2G industrial production and the immature condition of adopting sucrose phosphorylase to prepare AA-2G reported at present, the invention provides a method for preparing L-ascorbic acid-2-glucoside, which adopts the site-specific mutagenesis technology to construct a novel sucrose phosphorylase high-yield engineering strain, adopts the recombinant engineering strain to prepare AA-2G by biological catalysis, has single product, high yield, does not need to additionally add saccharifying enzyme for treatment and has low production cost.
The invention is realized by the following technical scheme:
an engineering strain of recombinant sucrose phosphorylase, which is characterized in that: the preservation number of the engineering strain of the recombinant sucrose phosphorylase is as follows: CCTCC M2016496, wherein the preservation address is Wuhan, Wuhan university, and the postcode 430072.
Sucrose phosphorylase DNA artificial sequence:
TAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGGCAGCAGCCATCA 50
TCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGCTA 100
GCATGACTGGTGGACAGCAAATGGGTCGCGGATCCATGAAAAACAAAGT 150
GCAGCTCATCACATACGCCGATCGTCTCGGCGATGGCACTCTTAGCTCGA 200
TGACCGACATCCTGCGCACCCGCTTCGACGGCGTGTATGACGGCGTGCAT 250
ATCCTGCCGTTCTTCACTCCGTTCGATGGTGCGGATGCAGGCTTCGACCC 300
GATCGACCATACCAAAGTCGACGAACGTCTCGGCAGCTGGGACGACGTC 350
GCCGAACTCTCCAAGACCCACAACATCATGGTCGACGCCATCGTCAACCA 400
CATGAGTTGGGAATCCAAGCAGTTCCAAGACGTGCTTGAAAAAGGTGAG 450
GAATCCGAGTATTACCCGATGTTCCTGACCATGAGCTCCGTCTTCCCGAA 500
CGGCGCCACCGAAGAAGACCTGGCCGGCATCTACCGCCCGCGCCCGGGC 550
CTGCCGTTCACCCACTACAAGTTCGCCGGCAAGACGCGCTTGGTCTGGGT 600
GAGCTTCACCCCGCAGCAGGTGGACATCGACACTGATTCCGCCAAGGGTT 650
GGGAATACCTGATGTCGATCTTCGATCAGATGGCCGCCAGCCACGTGCGC 700
TACATCCGTCTCGACGCCGTGGGCTACGGCGCCAAGGAAGCCGGCACCA 750
GCTGCTTCATGACCCCCAAGACCTTTAAGCTCATCTCCCGTCTGCGCGAG 800
GAGGGCGTCAAGCGCGGCCTTGAAATCCTCATCGAGGTTCACAGCTACTA 850
CAAGAAGCAGGTGGAAATCGCCTCCAAGGTGGACCGCGTCTACGATTTC 900
GCCCTGCCGCCGCTGCTTCTGCACTCGCTGTTCACCGGTCACGTCGAACC 950
CGTGGCCCACTGGACCGAGATCCGCCCGAACAACGCCGTCACCGTGCTC 1000
GATACGCACGATGGCATCGGCGTGATCGACATCGGCTCCGACCAGCTCG 1050
ACCGCTCCCTCAAGGGCCTCGTGCCCGACGAGGACGTCGACAACCTGGTC 1100
AACACCATCCATGCCAACACCCACGGCGAATCCCAGGCCGCCACCGGTG 1150
CCGCCGCGTCCAACCTCGACCTCTACCAGGTCAACTCCACGTACTACTCG 1200
GCCCTCGGCTGCAACGACCAGCACTACTTGGCCGCCCGCGCCGTGCAGTT 1250
CTTCCTGCCGGGCGTGCCGCAGGTCTACTACGTGGGCGCGCTCGCCGGCC 1300
GCAACGACATGGAACTGCTGCGCCGCACCAACAACGGCCGCGACATCAA 1350
CCGCCACTACTACTCCACCGCCGAAATCGATGAAAACCTCGAACGCCCG 1400
GTGGTCAAGGCCCTGAACGCCCTGGCCAAGTTCCGCAACGAACTGCCTGC 1450
ATTCGATGGCGAGTTCAGCTACGAGGTCGATGGCGACACGTCCATCACCT 1500
TCCGCTGGACCGCCGCCGACGGCACGTCCACGGCCGCCCTCACCTTCGAG 1550
CCCGGACGCGGCCTCGGCACAGACAACGCCACCCCGGTTGCCAGCCTTGC 1600
CTGGAGCGATGCCGCCGGCGACCACGAAACCCGCGATCTGCTCGCCAACC 1650
CGCCGATTGCCGATATCGACAAGCTTGCGGCCGCACTCGAGCACCACCAC 1700
CACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAA 1738。
sucrose phosphorylase PRT sequence:
MKNKVQLITY ADRLGDGTLS SMTDILRTRF DGVYDGVHIL PFFTPFDGAD AGFDPIDHTK VDERLGSWDD VAELSKTHNI MVDAIVNHMS WESKQFQDVL 100
EKGEESEYYP MFLTMSSVFP NGATEEDLAG IYRPRPGLPF THYKFAGKTR LVWVSFTPQQ VDIDTDSAKG WEYLMSIFDQ MAASHVRYIR LDAVGYGAKE 200
AGTSCFMTPK TFKLISRLRE EGVKRGLEIL IEVHSYYKKQ VEIASKVDRV YDFALPPLLL HSLFTGHVEP VAHWTEIRPN NAVTVLDTHD GIGVIDIGSD 300
QLDRSLKGLV PDEDVDNLVN TIHANTHGES QAATGAAASN LDLYQVNSTY YSALGCNDQH YLAARAVQFF LPGVPQVYYV GALAGRNDME LLRRTNNGRD 400
INRHYYSTAE IDENLERPVV KALNALAKFR NELPAFDGEF SYEVDGDTSI TFRWTAADGT STAALTFEPG RGLGTDNATP VASLAWSDAA GDHETRDLLA 500
NPPIADID 508。
a method for preparing L-ascorbic acid glucoside (AA-2G) by a coliform strain engineering strain of recombinant sucrose phosphorylase comprises the following steps:
A. cloning and expressing a sucrose phosphorylase coding gene derived from bifidobacterium longum to construct an escherichia coli engineering strain of recombinant sucrose phosphorylase, and is characterized by comprising the following steps of:
a1, constructing a sucrose phosphorylase clone strain, comprising the following steps:
a1.1, carrying out resuscitation culture and passage 2 times on the frozen bifidobacterium longum, designing a pair of primers by taking the bacterial liquid as a DNA template and taking a sucrose phosphorylase gene sequence of the bifidobacterium longum on NCBI as a template, and then carrying out PCR and agar gel separation, purification and recovery to obtain a target gene DNA fragment.
A1.2, constructing a double enzyme digestion reaction system by the obtained target gene DNA fragment and pet28a (+) plasmid, carrying out double enzyme digestion by BamH I and Hind III, then carrying out gel recovery, and finally constructing a recombinant plasmid by DNA connection.
And A1.3, transforming the constructed recombinant plasmid into an escherichia coli Trans5 alpha competent cell to form a transformed clone strain pet28a (+) -spase, and then obtaining the target recombinant plasmid through verification.
A2, constructing a sucrose phosphorylase expression strain, comprising the following steps:
a2.1, culturing the positive clone bacterial strain containing the target recombinant plasmid in an LB culture medium, and extracting to obtain the target recombinant plasmid.
A2.2, transforming the extracted target recombinant plasmid and a competent escherichia coli BL21(DE3) expression vector, obtaining a clone colony through plate separation, and obtaining a target sucrose phosphorylase expression strain pet28a (+) -spase-BL21(DE3) through PCR verification,
a3, adopting PCR site-directed mutagenesis technology, comprising the steps of designing mutation primers of mutation site amino acids, constructing a mutation plasmid clone strain, constructing a mutation plasmid expression strain, and obtaining a site-directed mutation positive expression strain through PCR verification, wherein the strain is preserved in China center for type culture collection in 2016, 9, 18, with the preservation number of CCTCC M2016496, the preservation address of Wuhan, university of Wuhan, zip code 430072, the names of Escherichia coli pct28a (+) -spase, and Escherichia coli pet28a (+) -spase.
B. Carrying out biocatalysis on sucrose phosphorylase which is obtained by fermenting and producing escherichia coli engineering strains adopting recombinant sucrose phosphorylase and is used as a biocatalyst, sucrose is used as a glycosyl donor, L-ascorbic acid is used as a glycosyl acceptor, and AA-2G is prepared by adopting the following steps:
and B1, inoculating the engineering strain of escherichia coli for obtaining the recombinant sucrose phosphorylase into a seed culture medium for culture, and then inoculating into an induction culture medium for sucrose phosphorylase fermentation production to obtain the catalyst containing the recombinant sucrose phosphorylase.
And B2, mixing the catalyst containing the recombinant sucrose phosphorylase with a buffer solution, adding sucrose and L-ascorbic acid raw materials, adjusting the pH value of a reaction system, and finally carrying out biocatalytic synthesis on AA-2G at a certain conversion temperature.
Further:
step a1 sucrose phosphorylase clone strain construction:
carrying out resuscitation culture and passage n times on the cryopreserved bifidobacterium longum, and designing a pair of primers by using the bacterial liquid as a DNA template and using a sucrose phosphorylase gene sequence of the bifidobacterium longum on NCBI as a template:
forward primer (spase-bam-F):
5’ CGCGGATCCATGAAAAACAAAGTGCAGCTCATC 3’
reverse primer (spas-hind-R):
5’ CCCAAGCTTGTCGATATCGGCAATCGG 3’
then, PCR reaction is carried out under the following reaction conditions: pre-denaturation at 92-98 deg.C for 0.5-2min, performing 20-40 cycles (5-15S at 92-98 deg.C, 10-15S at 49-64 deg.C, 18-25S at 68-75 deg.C), and re-extension at 68-75 deg.C for 3-7 min;
after the PCR reaction is finished, performing gel recovery, verification and purification on a product obtained after the PCR reaction and a DNA solution of pet28a (+) plasmid to form a BamHI and HindIII double enzyme digestion reaction system for enzyme digestion modification, wherein the enzyme digestion condition is that the enzyme digestion reaction is performed for 2-7min at the temperature of 32-42 ℃, then recovering the enzyme digestion product, uniformly mixing the enzyme digestion product with a solution containing DNA ligase, and reacting in a circulating water bath at the temperature of 10-20 ℃ for overnight;
after the DNA is connected overnight, adding 10 μ l of the connection product into 45-55 μ l of the just melted Escherichia coli Trans5 alpha competent cells, mixing uniformly, and placing on ice for 20-50 min; then quickly transferring the mixture into a constant-temperature water bath kettle, and thermally shocking for 80-95sec at 35-45 ℃; then taking out the transformation mixture and placing on ice for 1-3min, adding 480-; respectively and uniformly coating 80-120 mul of recovered bacterial liquid on two culture plates of LB solid culture medium with kanamycin resistance, and culturing at the constant temperature of 32-42 ℃ for 10-24 h; respectively picking monoclonal colonies on the two transformed plates, shaking the colonies in 1ml of kanamycin-resistant LB liquid culture medium at the constant temperature of 32-42 ℃ and at the constant temperature of 100-300rpm for 5-12h, carrying out PCR verification by taking the bacterial liquid as a PCR template, and carrying out verification positive cloning to obtain a sucrose phosphorylase clone strain pet28a (+) -spase;
step A2 construction of sucrose phosphorylase expression strain pet28a (+) -spase-BL21(DE3),
selecting positive clone bacterial liquid, inoculating the positive clone bacterial liquid in 5ml of kanamycin-resistant LB liquid culture medium, shaking the bacteria at the constant temperature of 100-300rpm for 8-20h, extracting recombinant plasmids, then respectively taking 0.5-1.5 mu l of recombinant plasmids and 0.5-1.5 mu l of pet28a (+) plasmids, adding the recombinant plasmids and the pet28 (+) plasmids into two tubes of 50 mu l of freshly melted competent cells (purchased from Baijie biological company) of escherichia coli BL21(DE3), uniformly mixing, and placing the mixture on ice for 10-25 min; then quickly transferring the mixture into a constant temperature water bath kettle, thermally shocking for 10-30S at 38-45 ℃, taking out the transformation mixture from the constant temperature water bath kettle, placing the transformation mixture on ice for 1-3min, respectively adding 480-; taking 180 and 220 mul of recovered bacterial liquid to evenly coat on an LB solid medium culture plate containing 90-110 mu g/ml kanamycin, culturing for 8-20h in a constant temperature incubator at 32-42 ℃, observing the colony conditions of the culture plates of an experimental group and a control group, if the colony growth condition on the plate transformed by pet28a (+) plasmid is good, the experimental operation is free from error, picking n single clone colonies on the plate of the experimental group into n 1ml kanamycin-resistant LB liquid culture media, shaking the bacteria at the constant temperature of 100 and 300rpm at 32-42 ℃ for 8-20h, and carrying out bacterial liquid PCR verification to obtain a positive expression strain pet28a (+) -spase-BL21(DE 3).
Step B1 recombinant strain is subjected to shake flask fermentation to produce sucrose phosphorylase
Inoculating slant thallus of pet28a (+) -spase-BL21(DE3) expression strain into 500ml triangular flask filled with 50ml seed culture medium, wherein the seed culture medium comprises yeast extract powder 1-3%, peptone 0.2-0.7%, sodium chloride 0.05-0.15%, magnesium sulfate heptahydrate 0.002-0.007%, potassium dihydrogen phosphate 0.02-0.07%, disodium hydrogen phosphate 0.10-0.20%, sucrose 0.18-0.32%, calcium chloride 0.001-0.003%, zinc sulfate 7-0.0005-0.0015%, and ferrous sulfate heptahydrate 0.001-0.003%. Then carrying out shake culture for 14-25 hours at the temperature of 28-36 ℃ and the rotation speed of 150-. The fermentation medium comprises yeast extract powder 2.0-4.0%, peptone 0.20-0.30%, sodium chloride 0.4-0.6%, magnesium sulfate heptahydrate 0.005-0.015%, potassium dihydrogen phosphate 0.20-0.30%, disodium hydrogen phosphate 0.48-0.60%, calcium chloride 0.005-0.015%, sucrose 0.28-0.41%, glycerol 0.20-0.30%, and lactose 0.10-0.20%. Culturing under shaking at 28-36 deg.C and rotation speed of 150-.
Step B1 recombinant strain is fermented in 10L tank to produce sucrose phosphorylase
Inoculating the slant thalli of the pet28a (+) -spase-BL21(DE3) expression strain into a 2000ml triangular flask filled with 300ml of seed culture medium, then carrying out shake culture for 15-35 hours under the conditions of the temperature of 28-36 ℃ and the rotation speed of 150-300rpm until the bacterial liquid OD600nm reaches 20-25, and then inoculating into a 10L tank filled with 6L of the fermentation medium mentioned in example 3 according to the inoculation ratio of 4-6% for carrying out amplification fermentation to produce the sucrose phosphorylase. Culturing under the conditions of the fermentation temperature of 28-36 ℃, the rotation speed of 400-600rpm, the tank pressure of 0.03-0.06MPa and the ventilation volume of 7-8.5L/(min.L) for 18-28 hours by aeration and stirring, wherein the OD600nm of the fermentation liquid reaches 35-45, then feeding 1200ml of a feed medium which comprises 4.0-6.0% of yeast extract powder, 0.5-1.5% of peptone, 7-13% of glycerol, 1.8-3.1% of lactose, 45-55% of sucrose, 0.3-0.7% of potassium dihydrogen phosphate, 0.1-0.3% of calcium chloride, feeding at the speed of 75-85ml/min, continuously feeding for 10-20 hours, and adjusting the pH of the fermentation liquid to 4-7.0. After the feeding is finished, the fermentation culture is continued for 24 to 35 hours, and then the fermentation is stopped. Then centrifugating and collecting thalli slurry containing sucrose phosphorylase by a centrifugal machine 4000 for 5-20min, wherein the slurry can be used as a biocatalyst.
In the step B2, the buffer system is trisodium citrate buffer system, wherein the concentration of trisodium citrate is 20-60 mM, the pH value is 4.0-6.5, the concentration of sucrose is 60-120 g/L, and the concentration of L-ascorbic acid is 15-30 g/L.
The invention has the beneficial effects that: the invention adopts gene recombination and site-directed mutagenesis technology to introduce sucrose phosphorylase coding gene from bifidobacterium longum into escherichia coli BL21(DE3) through pet28a (+) plasmid to construct an engineering strain (the preservation number: CCTCC M2016496) of recombinant sucrose phosphorylase. And (3) preparing AA-2G by taking the thallus cells obtained by fermentation as a biocatalyst and taking sucrose and L-ascorbic acid as raw materials in a trisodium citrate buffer solution system. The invention directly adopts sucrose as glycosyl donor, and the raw material is easy to dissolve in water, and is cheap and easy to obtain. Meanwhile, the product is single, the reaction product is mainly AA-2G, the yield is up to 65 percent, no additional saccharifying enzyme is needed for treatment, and the production cost is low.
(IV) detailed description of the preferred embodiments
In the following examples, unless otherwise specified, all methods used are conventional and all reagents used are commercially available.
Example 1 construction of sucrose phosphorylase clone Strain pet28a (+) -spase
And (3) performing recovery culture and passage 2 times on the frozen bifidobacterium longum, and taking the bacterial liquid as a DNA template. A pair of primers is designed by taking a sucrose phosphorylase gene sequence of bifidobacterium longum on NCBI as a template:
forward primer (spase-bam-F): 5 'CGCGGATCCATGAAAAACAAAGTGCAGCTCATC 3'
Reverse primer (spase-hind-R): 5 'CCCAAGCTTGTCGATATCGGCAATCGG 3'
Then, PCR reaction is carried out, and the reaction conditions are as follows: pre-denaturation at 95 ℃ for 1min, followed by 30 cycles (95 ℃ 10S, 49-64 ℃ 12S, 72 ℃ 22S), and re-extension at 72 ℃ for 5 min.
The site-directed mutagenesis experiment of sucrose phosphorylase adopts different design mutation primers and carries out the PCR reaction.
After the PCR reaction is finished, performing gel recovery, verification and purification on a product obtained after the PCR reaction and a DNA solution of pet28a (+) plasmid to form a BamHI and Hind III (purchased from Takara Biotechnology Co., Ltd.) double enzyme digestion reaction system for enzyme digestion modification, wherein the enzyme digestion condition is that the enzyme digestion reaction is performed for 5min at the temperature of 37 ℃, then recovering the enzyme digestion product, uniformly mixing the enzyme digestion product with a solution containing DNA ligase, and reacting in a circulating water bath at the temperature of 16 ℃ overnight.
After the DNA was ligated overnight, 10. mu.l of the ligation product was added to 50. mu.l of freshly thawed E.coli Trans 5. alpha. competent cells (purchased from Baijie Bio Inc.), mixed and placed on ice for 30 min; then quickly transferring the mixture into a constant-temperature water bath kettle, and thermally shocking for 90sec at 42 ℃; then taking out the transformation mixture, placing the transformation mixture on ice for 2min, adding 500 mul of sterile non-antibiotic LB culture medium into a super clean bench, and putting the mixture into a constant temperature shaking table with the temperature of 37 ℃ and the rpm of 200 for resuscitation for 1 hour; respectively and uniformly coating 100 mu l of recovered bacterial liquid on two culture plates of LB solid culture medium with kanamycin resistance, and culturing at the constant temperature of 37 ℃ for 16 h; and (3) respectively selecting monoclonal colonies on the two transformed plates, putting the monoclonal colonies into 1ml of kanamycin-resistant LB liquid culture medium, shaking at the constant temperature of 37 ℃ and 200rpm for 8h, carrying out PCR verification by taking the bacterial liquid as a PCR template, and carrying out positive clone verification to obtain a sucrose phosphorylase clone strain pet28a (+) -spase.
Example 2 construction of sucrose phosphorylase clone Strain pet28a (+) -spase
And (3) performing recovery culture and passage 2 times on the frozen bifidobacterium longum, and taking the bacterial liquid as a DNA template. A pair of primers is designed by taking a sucrose phosphorylase gene sequence of bifidobacterium longum on NCBI as a template:
forward primer (spase-bam-F): 5 'CGCGGATCCATGAAAAACAAAGTGCAGCTCATC 3'
Reverse primer (spase-hind-R): 5 'CCCAAGCTTGTCGATATCGGCAATCGG 3'
Then, PCR reaction is carried out, and the reaction conditions are as follows: pre-denaturation at 92 ℃ for 2min, followed by 40 cycles (92 ℃ 10S, 49-64 ℃ 10S, 68 ℃ 25S), and re-extension at 68 ℃ for 7 min.
The site-directed mutagenesis experiment of sucrose phosphorylase adopts different design mutation primers and carries out the PCR reaction.
After the PCR reaction is finished, performing gel recovery, verification and purification on a product obtained after the PCR reaction and a DNA solution of pet28a (+) plasmid to form a BamHI and Hind III (purchased from Takara Biotechnology Co., Ltd.) double enzyme digestion reaction system for enzyme digestion modification, wherein the enzyme digestion condition is that the enzyme digestion reaction is performed for 7min at the temperature of 32 ℃, then recovering the enzyme digestion product, uniformly mixing the enzyme digestion product with a solution containing DNA ligase, and reacting in a circulating water bath at the temperature of 10 ℃ overnight.
After the DNA was ligated overnight, 10. mu.l of the ligation product was added to 45. mu.l of freshly thawed E.coli Trans 5. alpha. competent cells (purchased from Baijie Bio Inc.), mixed and placed on ice for 50 min; then quickly transferring the mixture into a constant-temperature water bath kettle, and thermally shocking for 80sec at 35 ℃; then taking out the transformation mixture, placing the transformation mixture on ice for 3min, adding 480 mul of sterile non-antibiotic LB culture medium into a super clean bench, and putting the mixture into a constant temperature shaking table with the temperature of 32 ℃ and the rpm of 300 for resuscitation for 2 hours; respectively and uniformly coating 80 mu l of recovered bacterial liquid on two culture plates of LB solid culture medium with kanamycin resistance, and culturing at the constant temperature of 32 ℃ for 24 h; and (3) respectively selecting monoclonal colonies on the two transformed plates, putting the monoclonal colonies into 1ml of kanamycin-resistant LB liquid culture medium, shaking at the constant temperature of 32 ℃ and 300rpm for 12h, carrying out PCR verification by taking the bacterial liquid as a PCR template, and carrying out positive clone verification to obtain a sucrose phosphorylase clone strain pet28a (+) -spase.
Example 3 construction of sucrose phosphorylase clone Strain pet28a (+) -spase
And (3) performing recovery culture and passage 2 times on the frozen bifidobacterium longum, and taking the bacterial liquid as a DNA template. A pair of primers is designed by taking a sucrose phosphorylase gene sequence of bifidobacterium longum on NCBI as a template:
forward primer (spase-bam-F): 5 'CGCGGATCCATGAAAAACAAAGTGCAGCTCATC 3'
Reverse primer (spase-hind-R): 5 'CCCAAGCTTGTCGATATCGGCAATCGG 3'
Then, PCR reaction is carried out, and the reaction conditions are as follows: pre-denaturation at 98 ℃ for 0.5min, followed by 20 cycles (98 ℃ 15S, 49-64 ℃ 15S, 75 ℃ 18S), and extension at 75 ℃ for 3 min.
The site-directed mutagenesis experiment of sucrose phosphorylase adopts different design mutation primers and carries out the PCR reaction.
After the PCR reaction is finished, performing gel recovery, verification and purification on a product obtained after the PCR reaction and a DNA solution of pet28a (+) plasmid to form a BamHI and Hind III (purchased from Takara Biotechnology Co., Ltd.) double enzyme digestion reaction system for enzyme digestion modification, wherein the enzyme digestion condition is that the enzyme digestion reaction is performed for 2min at the temperature of 42 ℃, then recovering the enzyme digestion product, uniformly mixing the enzyme digestion product with a solution containing DNA ligase, and reacting in a circulating water bath at the temperature of 20 ℃ overnight.
After the DNA was ligated overnight, 10. mu.l of the ligation product was added to 55. mu.l of freshly thawed E.coli Trans 5. alpha. competent cells (purchased from Baijie Bio Inc.), mixed and placed on ice for 20 min; then quickly transferring the mixture into a constant-temperature water bath kettle, and thermally shocking for 95sec at 45 ℃; then taking out the transformation mixture, placing the transformation mixture on ice for 1min, adding 520 μ l of sterile LB-free culture medium into a super clean bench, and putting the mixture into a constant temperature shaking table with the temperature of 42 ℃ and the rpm of 100 for resuscitation for 0.5 hour; respectively and uniformly coating 120 mu l of recovered bacterial liquid on two culture plates of LB solid culture medium with kanamycin resistance, and culturing at the constant temperature of 42 ℃ for 10 h; and respectively picking monoclonal colonies on the two transformed plates, shaking the colonies into 1ml of kanamycin-resistant LB liquid culture medium at the constant temperature of 42 ℃ and 100rpm for 5 hours, carrying out PCR verification by taking the bacterial liquid as a PCR template, and carrying out positive clone verification to obtain a sucrose phosphorylase clone strain pet28a (+) -spase.
Example 4 construction of sucrose phosphorylase-expressing Strain pet28a (+) -spase-BL21(DE3)
And selecting positive clone bacterial liquid, inoculating the positive clone bacterial liquid into 5ml of LB liquid culture medium with kanamycin resistance, shaking the bacteria at the constant temperature of 37 ℃ and 200rpm for 14h, and extracting the recombinant plasmid. Then adding 1. mu.l of recombinant plasmid and 1. mu.l of pet28a (+) plasmid into two tubes of 50. mu.l of freshly thawed competent cells of Escherichia coli BL21(DE3) (purchased from Baijie biosciences), mixing, and placing on ice bath for 15 min; then quickly transferring the mixture into a constant-temperature water bath kettle, thermally shocking for 20 seconds at 42 ℃, taking out the transformation mixture from the constant-temperature water bath kettle, placing the transformation mixture on ice for 2 minutes, respectively adding 500 mu l of sterile non-resistant LB culture medium into a super clean bench, and placing the mixture into a constant-temperature shaking table at 37 ℃ and 200rpm for resuscitation for 45 minutes; 200. mu.l of the recovered bacterial suspension was applied evenly on LB solid medium plate containing 100. mu.g/ml kanamycin, and cultured in a 37 ℃ incubator for 12 hours. Observing the colony condition of the culture plates of the experimental group and the control group, if the colony growth condition on the plate transformed by the pet28a (+) plasmid is good, the experimental operation is free from error. 12 monoclonal colonies on the experimental group plate were picked to 12 LB liquid media with 1ml kanamycin resistance, and PCR was performed on the bacterial liquid after shaking the bacteria at 37 ℃ and 200rpm for 14 hours to obtain a positive expression strain pet28a (+) -spase-BL21(DE 3).
The amino acid sequence of the positively expressed enzyme protein was determined and is shown in appendix 1.
Example 5 construction of sucrose phosphorylase expressing Strain pet28a (+) -spase-BL21(DE3)
And selecting positive clone bacterial liquid, inoculating the positive clone bacterial liquid into 5ml of LB liquid culture medium with kanamycin resistance, shaking the bacteria at the constant temperature of 32 ℃ and 300rpm for 20 hours, and extracting the recombinant plasmid. Then 0.5. mu.l of recombinant plasmid and 0.5. mu.l of pet28a (+) plasmid were added to two tubes of 50. mu.l of freshly thawed competent cells of Escherichia coli BL21(DE3) (from Baijie Bio Inc.), mixed and placed on ice for 10 min; then quickly transferring the mixture into a constant-temperature water bath kettle, thermally shocking for 30S at 38 ℃, taking out the transformation mixture from the constant-temperature water bath kettle, placing the transformation mixture on ice for 3min, respectively adding 520 mu l of sterile non-antibiotic LB culture medium into a super clean bench, and placing the mixture into a constant-temperature shaking table at 32 ℃ and 300rpm for resuscitation for 60 min; 180 μ l of the recovered bacterial liquid was evenly spread on an LB solid medium plate containing 90 μ g/ml kanamycin, and cultured in a 32 ℃ incubator for 20 hours. Observing the colony condition of the culture plates of the experimental group and the control group, if the colony growth condition on the plate transformed by the pet28a (+) plasmid is good, the experimental operation is free from error. 12 monoclonal colonies on the experimental group plate were picked to 12 LB liquid media with 1ml kanamycin resistance, and PCR was performed on the bacterial liquid after shaking the bacteria at a constant temperature of 300rpm at 32 ℃ for 20 hours to obtain a positive expression strain pet28a (+) -spase-BL21(DE 3).
The amino acid sequence of the positively expressed enzyme protein was determined and is shown in appendix 1.
Example 6 construction of sucrose phosphorylase-expressing Strain pet28a (+) -spase-BL21(DE3)
And selecting positive clone bacterial liquid, inoculating the positive clone bacterial liquid into 5ml of LB liquid culture medium with kanamycin resistance, shaking the bacteria at the constant temperature of 42 ℃ and 100rpm for 8 hours, and extracting the recombinant plasmids. Then adding 1.5. mu.l of recombinant plasmid and 1.5. mu.l of pet28a (+) plasmid into two tubes of 50. mu.l of freshly thawed competent cells of Escherichia coli BL21(DE3) (from Baijie Bio Inc.), mixing, and placing on ice bath for 25 min; then quickly transferring the mixture into a constant-temperature water bath kettle, thermally shocking for 10 seconds at 45 ℃, taking out the transformation mixture from the constant-temperature water bath kettle, placing the transformation mixture on ice for 1min, respectively adding 480 mu l of sterile non-antibiotic LB culture medium into a super clean bench, and placing the mixture into a constant-temperature shaking table at 42 ℃ and 100rpm for resuscitation for 30 min; 220 ul of the recovered bacterial liquid was evenly spread on an LB solid medium plate containing 110 ug/ml kanamycin, and cultured in a 42 ℃ incubator for 8 hours. Observing the colony condition of the culture plates of the experimental group and the control group, if the colony growth condition on the plate transformed by the pet28a (+) plasmid is good, the experimental operation is free from error. 12 monoclonal colonies on the experimental group plate were picked to 12 LB liquid media with 1ml kanamycin resistance, and PCR was performed on the bacterial liquid after shaking the bacteria at 42 ℃ and 100rpm for 14 hours to obtain a positive expression strain pet28a (+) -spase-BL21(DE 3).
The amino acid sequence of the positively expressed enzyme protein was determined and is shown in appendix 1.
Example 7 production of sucrose phosphorylase by recombinant Strain in Shake flask fermentation
The slant thallus of pet28a (+) -spase-BL21(DE3) expression strain is inoculated into a 500ml triangular flask filled with 50ml of seed culture medium, and the seed culture medium comprises 2.0% of yeast extract powder, 0.5% of peptone, 0.1% of sodium chloride, 0.005% of magnesium sulfate heptahydrate, 0.05% of potassium dihydrogen phosphate, 0.15% of disodium hydrogen phosphate, 0.25% of sucrose, 0.002% of calcium chloride, 0.001% of zinc sulfate 7 hydrate and 0.002% of ferrous sulfate heptahydrate. Then, the culture is performed for 20 hours under the conditions of 32 ℃ and 220rpm of rotation speed until the bacterial liquid OD600nm reaches 20-25, and then the bacterial liquid is inoculated into a 500ml triangular flask filled with 100ml of fermentation medium according to the inoculation ratio of 1% for fermentation to produce the sucrose phosphorylase. The fermentation medium comprises 3.0% of yeast extract powder, 0.25% of peptone, 0.5% of sodium chloride, 0.01% of magnesium sulfate heptahydrate, 0.25% of potassium dihydrogen phosphate, 0.54% of disodium hydrogen phosphate, 0.01% of calcium chloride, 0.35% of sucrose, 0.25% of glycerol and 0.15% of lactose. Culturing under shaking at 32 deg.C and 220rpm for 48 hr, centrifuging at 4000 rpm for 10min by a centrifuge, and collecting thallus slurry containing sucrose phosphorylase as biocatalyst.
Example 8 production of sucrose phosphorylase by recombinant Strain in Shake flask fermentation
The slant thallus of pet28a (+) -spase-BL21(DE3) expression strain is inoculated into a 500ml triangular flask filled with 50ml of seed culture medium, the seed culture medium comprises 1.0% of yeast extract powder, 0.7% of peptone, 0.05% of sodium chloride, 0.007% of magnesium sulfate heptahydrate, 0.02% of potassium dihydrogen phosphate, 0.20% of disodium hydrogen phosphate, 0.18% of sucrose, 0.003% of calcium chloride, 0.0005% of zinc sulfate 7 hydrate and 0.003% of ferrous sulfate heptahydrate. Then carrying out shake culture for 14 hours at the temperature of 28 ℃ and the rotating speed of 300rpm until the bacterial liquid OD600nm reaches 20-25, and then inoculating the bacterial liquid into a 500ml triangular flask filled with 100ml of fermentation medium according to the inoculation ratio of 0.8% for fermentation to produce the sucrose phosphorylase. The fermentation medium comprises yeast extract powder 2.0%, peptone 0.30%, sodium chloride 0.4%, magnesium sulfate heptahydrate 0.015%, potassium dihydrogen phosphate 0.20%, disodium hydrogen phosphate 0.60%, calcium chloride 0.005%, sucrose 0.41%, glycerol 0.20%, and lactose 0.20%. Culturing under shaking at 28 deg.C and 300rpm for 36 hr, centrifuging at 4000 rpm for 20min by a centrifuge, and collecting thallus slurry containing sucrose phosphorylase as biocatalyst.
Example 9 production of sucrose phosphorylase by recombinant Strain fermentation in Shake flask
The slant thallus of pet28a (+) -spase-BL21(DE3) expression strain is inoculated into a 500ml triangular flask filled with 50ml of seed culture medium, and the seed culture medium comprises 3.0% of yeast extract powder, 0.2% of peptone, 0.15% of sodium chloride, 0.002% of magnesium sulfate heptahydrate, 0.07% of potassium dihydrogen phosphate, 0.10% of disodium hydrogen phosphate, 0.32% of sucrose, 0.001% of calcium chloride, 0.0015% of 7% of zinc sulfate hydrate and 0.001% of ferrous sulfate heptahydrate. Then carrying out shake culture for 25 hours at the temperature of 36 ℃ and the rotating speed of 150rpm until the bacterial liquid OD600nm reaches 20-25, and then inoculating the bacterial liquid into a 500ml triangular flask filled with 100ml of fermentation medium according to the inoculation ratio of 1.2% for fermentation to produce the sucrose phosphorylase. The fermentation medium comprises yeast extract powder 4.0%, peptone 0.20%, sodium chloride 0.6%, magnesium sulfate heptahydrate 0.005%, potassium dihydrogen phosphate 0.30%, disodium hydrogen phosphate 0.48%, calcium chloride 0.015%, sucrose 0.28%, glycerol 0.30%, and lactose 0.10%. Culturing under shaking at 36 deg.C and 150rpm for 52 hr, centrifuging at 4000 rpm for 5min by a centrifuge, and collecting thallus slurry containing sucrose phosphorylase as biocatalyst.
Example 10 production of sucrose phosphorylase by fermentation of recombinant Strain in 10L jar
The slant thalli of pet28a (+) -spase-BL21(DE3) expression strain is inoculated into a 2000ml triangular flask filled with 300ml of the seed culture medium mentioned in example 7, then the strain is cultured under the conditions of 32 ℃ and 220rpm for 20 hours by shaking until the bacterial liquid OD600nm reaches 20-25, and then the strain is inoculated into a 10L tank filled with 6L of the fermentation culture medium mentioned in example 7 according to the inoculation ratio of 5 percent for carrying out amplification fermentation to produce the sucrose phosphorylase. And (3) ventilating and stirring for culturing for 24 hours under the conditions that the fermentation temperature is 32 ℃, the rotation speed is 500rpm, the tank pressure is 0.05MPa and the ventilation volume is 7.5L/(min.L), wherein the OD600nm of the fermentation liquid reaches 35-45, then 1200ml of fed-batch culture medium is fed-batch, the fed-batch culture medium comprises 5.0% of yeast extract powder, 1.0% of peptone, 10% of glycerol, 2.5% of lactose, 50% of sucrose, 0.5% of potassium dihydrogen phosphate and 0.2% of calcium chloride, the feeding-batch speed is 80ml/min, the feeding-batch is carried out for 15 hours, and the pH of the fermentation liquid is adjusted to 6.5 by 20% of ammonia water in the. After the feeding is finished, the fermentation is continued for 30 hours, and then the fermentation is stopped. Then centrifugating and collecting thalli slurry containing sucrose phosphorylase by a centrifugal machine 4000 for 10min, wherein the slurry can be used as a biocatalyst.
Example 11 production of sucrose phosphorylase by fermentation of recombinant Strain in 10L jar
The slant thalli of pet28a (+) -spase-BL21(DE3) expression strain is inoculated into a 2000ml triangular flask filled with 300ml of the seed culture medium mentioned in example 7, then the strain is cultured under the conditions of 28 ℃ and 150rpm for 15 hours by shaking until the bacterial liquid OD600nm reaches 20-25, and then the strain is inoculated into a 10L tank filled with 6L of the fermentation culture medium mentioned in example 7 according to the inoculation ratio of 4% for carrying out amplification fermentation to produce the sucrose phosphorylase. The fermentation solution OD600nm reaches 35-45 after being aerated and stirred for 18 hours under the conditions that the fermentation temperature is 28 ℃, the rotation speed is 400rpm, the tank pressure is 0.03MPa and the ventilation volume is 8.5L/(min.L), then 1200ml of fed-batch culture medium is fed-batch, the fed-batch culture medium comprises 4.0% of yeast extract powder, 1.5% of peptone, 7% of glycerol, 3.1% of lactose, 45% of sucrose, 0.7% of potassium dihydrogen phosphate and 0.1% of calcium chloride, the feeding-batch speed is 85ml/min, the feeding-batch is continuously fed-batch for 20 hours, and the pH of the fermentation solution is adjusted to 4.5 by 20% of ammonia water in the feeding-batch. After the feeding is finished, the fermentation is continued for 35 hours, and then the fermentation is stopped. Then centrifugating and collecting thalli slurry containing sucrose phosphorylase by a centrifugal machine 4000 for 5min, wherein the slurry can be used as a biocatalyst.
Example 12 production of sucrose phosphorylase by fermentation of recombinant Strain in 10L jar
The slant thalli of pet28a (+) -spase-BL21(DE3) expression strain is inoculated into a 2000ml triangular flask filled with 300ml of the seed culture medium mentioned in example 7, then the strain is cultured under the conditions of 36 ℃ and 150rpm for 35 hours by shaking until the bacterial liquid OD600nm reaches 20-25, and then the strain is inoculated into a 10L tank filled with 6L of the fermentation culture medium mentioned in example 7 according to the inoculation ratio of 6% for carrying out amplification fermentation to produce the sucrose phosphorylase. Ventilating and stirring for culturing for 18 hours under the conditions that the fermentation temperature is 36 ℃, the rotation speed is 400rpm, the tank pressure is 0.06MPa and the ventilation volume is 7L/(min.L), wherein the OD600nm of the fermentation liquid reaches 35-45, then 1200ml of fed-batch culture medium is fed-batch, the fed-batch culture medium comprises 6.0% of yeast extract powder, 0.5% of peptone, 13% of glycerol, 1.8% of lactose, 55% of sucrose, 0.3% of potassium dihydrogen phosphate and 0.3% of calcium chloride, the feeding-batch speed is 75ml/min, the feeding-batch is continuously fed-batch for 10 hours, and the pH value of the fermentation liquid is adjusted to 7 by 20% of ammonia water in the feeding. After the feeding is finished, the fermentation is continued for 24 hours, and then the fermentation is stopped. Then centrifugating and collecting thalli slurry containing sucrose phosphorylase by a centrifugal machine 4000 for 20min, wherein the slurry can be used as a biocatalyst.
Example 13 production of sucrose phosphorylase by fermentation of recombinant Strain in 10L jar
The slant thalli of pet28a (+) -spase-BL21(DE3) expression strain is inoculated into a 2000ml triangular flask filled with 300ml of the seed culture medium mentioned in example 8, then the strain is cultured under the conditions of 32 ℃ and 220rpm for 20 hours by shaking until the bacterial liquid OD600nm reaches 20-25, and then the strain is inoculated into a 10L tank filled with 6L of the fermentation culture medium mentioned in example 8 according to the inoculation ratio of 5% for carrying out amplification fermentation to produce the sucrose phosphorylase. The rest is the same as in example 10.
Example 14 production of sucrose phosphorylase by fermentation of recombinant Strain in 10L jar
The slant thalli of pet28a (+) -spase-BL21(DE3) expression strain is inoculated into a 2000ml triangular flask filled with 300ml of the seed culture medium mentioned in example 8, then the slant thalli are cultured under the conditions of 28 ℃ and 150rpm for 15 hours under the condition of shaking until the bacterial liquid OD600nm reaches 20-25, and then the slant thalli are inoculated into a 10L tank filled with 6L of the fermentation culture medium mentioned in example 8 according to the inoculation ratio of 4% for carrying out amplification fermentation to produce the sucrose phosphorylase. The rest is the same as in example 11.
Example 15 production of sucrose phosphorylase by fermentation of recombinant Strain in 10L jar
The slant thalli of pet28a (+) -spase-BL21(DE3) expression strain is inoculated into a 2000ml triangular flask filled with 300ml of the seed culture medium mentioned in example 8, then the slant thalli are subjected to shaking culture for 35 hours under the conditions of the temperature of 36 ℃ and the rotating speed of 150rpm until the bacterial liquid OD600nm reaches 20-25, and then the slant thalli are inoculated into a 10L tank filled with 6L of the fermentation culture medium mentioned in example 8 according to the inoculation ratio of 6% for carrying out amplification fermentation to produce the sucrose phosphorylase. The rest is the same as in example 12.
Example 16 production of sucrose phosphorylase by fermentation of recombinant Strain in 10L jar
The slant thalli of pet28a (+) -spase-BL21(DE3) expression strain is inoculated into a 2000ml triangular flask filled with 300ml of the seed culture medium mentioned in example 9, then the strain is cultured under the conditions of 32 ℃ and 220rpm for 20 hours by shaking until the bacterial liquid OD600nm reaches 20-25, and then the strain is inoculated into a 10L tank filled with 6L of the fermentation culture medium mentioned in example 9 according to the inoculation ratio of 5 percent for carrying out amplification fermentation to produce the sucrose phosphorylase. The rest is the same as in example 10.
Example 17 production of sucrose phosphorylase by fermentation of recombinant Strain in 10L jar
The slant thalli of pet28a (+) -spase-BL21(DE3) expression strain is inoculated into a 2000ml triangular flask filled with 300ml of the seed culture medium mentioned in example 9, then the slant thalli are cultured under the conditions of 28 ℃ and 150rpm for 15 hours under the condition of shaking until the bacterial liquid OD600nm reaches 20-25, and then the slant thalli are inoculated into a 10L tank filled with 6L of the fermentation culture medium mentioned in example 9 according to the inoculation ratio of 4 percent for carrying out amplification fermentation to produce the sucrose phosphorylase. The rest is the same as in example 11.
Example 18 production of sucrose phosphorylase by fermentation of recombinant Strain in 10L jar
The slant thalli of pet28a (+) -spase-BL21(DE3) expression strain is inoculated into a 2000ml triangular flask filled with 300ml of the seed culture medium mentioned in example 9, then the slant thalli are subjected to shaking culture for 35 hours under the conditions of the temperature of 36 ℃ and the rotating speed of 150rpm until the bacterial liquid OD600nm reaches 20-25, and then the slant thalli are inoculated into a 10L tank filled with 6L of the fermentation culture medium mentioned in example 9 according to the inoculation ratio of 6% for carrying out amplification fermentation to produce the sucrose phosphorylase. The rest is the same as in example 12.
Example 19 biocatalytic Synthesis of AA-2G
Weighing 10G of the thallus slurry collected in the example 7, adding 80ml of 50mM trisodium citrate solution to re-disperse the thallus slurry to prepare a thallus suspension, then sequentially adding 7.5G of cane sugar and 2G of L-ascorbic acid, stirring while adding to completely dissolve the raw materials, then using 50mM trisodium citrate solution to fix the volume to 100ml, using 0.5M hydrochloric acid to adjust the pH value to 5.5, then transferring to a 250ml triangular flask, sealing with three layers of cellophane, placing in an oscillator to react at the reaction temperature of 35 ℃ and the rotation speed of 120rpm for 24h, sampling and determining that the concentration of AA-2G in the conversion solution is 22.3G/L and the conversion rate is 58%. The AA-2G is measured by an HPLC method under the following measurement conditions:
mobile phase: 50mM potassium dihydrogen phosphate solution (pH 3.0, adjusted with trifluoroacetic acid): methanol = 95: 5; flow rate: 0.4 ml/min; a chromatographic column: kromasil 100-5C18 (250X 4.6 mm); wavelength: 238 nm; column temperature: at 25 ℃.
Example 20 biocatalytic Synthesis of AA-2G
Weighing 10G of the thallus slurry collected in the example 7, adding 80ml of 20mM trisodium citrate solution to re-disperse the thallus slurry to prepare a thallus suspension, then sequentially adding 6.0G of cane sugar and 1.5G of L-ascorbic acid, stirring while adding to completely dissolve the raw materials, then adding 20mM trisodium citrate solution to a constant volume of 100ml, adjusting the pH value to 6.5 by using 0.5M hydrochloric acid, then transferring to a 250ml triangular flask, sealing by using three layers of cellophane, placing in an oscillator to react at the reaction temperature of 28 ℃, the rotating speed of 220rpm for 30 hours, sampling and measuring AA-2G in the conversion solution, wherein the conversion rate is 56%. The AA-2G is measured by an HPLC method under the following measurement conditions:
mobile phase: 50mM potassium dihydrogen phosphate solution (pH 3.0, adjusted with trifluoroacetic acid): methanol = 95: 5; flow rate: 0.4 ml/min; a chromatographic column: kromasil 100-5C18 (250X 4.6 mm); wavelength: 238 nm; column temperature: at 25 ℃.
Example 21 biocatalytic Synthesis of AA-2G
Weighing 10G of the thallus slurry collected in the example 7, adding 80ml of 60mM trisodium citrate solution to re-disperse the thallus slurry to prepare a thallus suspension, then sequentially adding 12.0G of cane sugar and 3G of L-ascorbic acid, stirring while adding to completely dissolve the raw materials, then using 60mM trisodium citrate solution to fix the volume to 100ml, using 0.5M hydrochloric acid to adjust the pH value to 4.0, then transferring to a 250ml triangular flask, sealing with three layers of cellophane, placing in an oscillator to react at the reaction temperature of 42 ℃ and the rotation speed of 200rpm for 15h, sampling and determining the AA-2G conversion rate of 64% in the conversion solution. The AA-2G is measured by an HPLC method under the following measurement conditions:
mobile phase: 50mM potassium dihydrogen phosphate solution (pH 3.0, adjusted with trifluoroacetic acid): methanol = 95: 5; flow rate: 0.4 ml/min; a chromatographic column: kromasil 100-5C18 (250X 4.6 mm); wavelength: 238 nm; column temperature: at 25 ℃.
Example 22 biocatalytic Synthesis of AA-2G
10g of the bacterial cell slurry collected in example 8 was weighed out, and the procedure was otherwise the same as in example 20.
Example 23 biocatalytic Synthesis of AA-2G
10g of the bacterial cell slurry collected in example 9 was weighed out, and the procedure was otherwise the same as in example 21.
Example 24 biocatalytic Synthesis of AA-2G
Weighing 300G of the thallus slurry collected in the example 10, adding 2L of 50mM trisodium citrate solution to re-disperse the thallus slurry to prepare a thallus suspension, then sequentially adding 300G of sucrose and 75G of L-ascorbic acid, stirring while adding to completely dissolve the raw materials, then adding 50mM trisodium citrate solution to a constant volume of 3L, adjusting the pH value to 5.5 by using 0.5M hydrochloric acid, and then transferring to a 5L biocatalytic reaction kettle, wherein the reaction temperature is 35 ℃ and the rotating speed is 120rpm, and biocatalytic preparation of AA-2G is carried out. The conversion process was adjusted with 0.5M hydrochloric acid or 0.5M sodium hydroxide solution in order to maintain the reaction system pH at 5.5. If the pH value of the conversion system is higher than 5.5, adjusting by using a 0.5M hydrochloric acid solution; if the concentration is less than 5.5M, a 0.5M sodium hydroxide solution is used for adjustment. When the conversion is carried out for 24 hours, samples are taken to determine that the concentration of AA-2G in the conversion solution is 31.2G/L, and the conversion rate is about 65 percent.
Example 25 biocatalytic Synthesis of AA-2G
Weighing 300G of the thallus slurry collected in the example 10, adding 2L of 20mM trisodium citrate solution to re-disperse the thallus slurry to prepare a thallus suspension, then sequentially adding 180G of sucrose and 45G of L-ascorbic acid, stirring while adding to completely dissolve the raw materials, then adding 20mM trisodium citrate solution to a constant volume of 3L, adjusting the pH value to 6.5 by using 0.5M hydrochloric acid, and then transferring to a 5L biocatalytic reaction kettle, wherein the reaction temperature is 28 ℃ and the rotating speed is 100rpm, and performing biocatalysis to prepare AA-2G. The conversion process was adjusted with 0.5M hydrochloric acid or 0.5M sodium hydroxide solution in order to maintain the reaction system pH at 6.5. If the pH value of the conversion system is higher than 6.5, adjusting by using a 0.5M hydrochloric acid solution; if the concentration is less than 6.5, 0.5M sodium hydroxide solution is used for adjustment. When the conversion time is 30 hours, samples are taken to determine that the conversion rate of AA-2 in the conversion solution is about 64 percent.
Example 26 biocatalytic Synthesis of AA-2G
Weighing 300G of the thallus slurry collected in the example 10, adding 2L of 60mM trisodium citrate solution to re-disperse the thallus slurry to prepare a thallus suspension, then sequentially adding 360G of sucrose and 90G of L-ascorbic acid, stirring while adding to completely dissolve the raw materials, then adding 60mM trisodium citrate solution to a constant volume of 3L, adjusting the pH value to 4.0 by using 0.5M hydrochloric acid, and then transferring into a 5L biocatalytic reaction kettle, wherein the reaction temperature is 41 ℃ and the rotating speed is 200rpm, and biocatalytic preparation of AA-2G is carried out. The conversion process was adjusted with 0.5M hydrochloric acid or 0.5M sodium hydroxide solution in order to maintain the pH of the reaction system at 4.0. If the pH value of the conversion system is higher than 4.0, adjusting by using a 0.5M hydrochloric acid solution; if the concentration is less than 4.0, the concentration is adjusted by using 0.5M sodium hydroxide solution. When the conversion time is 15 hours, samples are taken to determine that the conversion rate of AA-2G in the conversion solution is about 71 percent.
Example 27 biocatalytic Synthesis of AA-2G
300g of the bacterial cell slurry collected in example 11 was weighed out, and the procedure was otherwise the same as in example 25.
Example 28 biocatalytic Synthesis of AA-2G
300g of the bacterial cell slurry collected in example 12 was weighed out, and the procedure was otherwise the same as in example 26.
Example 29 biocatalytic Synthesis of AA-2G
300g of the bacterial cell slurry collected in example 13 was weighed out, and the procedure was otherwise the same as in example 24.
Example 30 biocatalytic Synthesis of AA-2G
300g of the bacterial cell slurry collected in example 14 was weighed out, and the procedure was otherwise the same as in example 25.
Example 31 biocatalytic Synthesis of AA-2G
300g of the bacterial cell slurry collected in example 15 was weighed out, and the procedure was otherwise the same as in example 26.
Example 32 biocatalytic Synthesis of AA-2G
300g of the bacterial cell slurry collected in example 16 was weighed out, and the procedure was otherwise the same as in example 24.
Example 30 biocatalytic Synthesis of AA-2G
300g of the bacterial cell slurry collected in example 17 was weighed out, and the procedure was otherwise the same as in example 25.
Example 31 biocatalytic Synthesis of AA-2G
300g of the bacterial cell slurry collected in example 18 was weighed out, and the procedure was otherwise the same as in example 26.
SEQUENCE LISTING
<110> Shandongde Biotechnology Ltd
<120> Process for producing L-ascorbic acid-2-glucoside
<130> 1
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 1727
<212> DNA
<213> Artificial sequence
<400> 1
taattttgtt taactttaag aaggagatat accatgggca gcagccatca tcatcatcat 60
cacagcagcg gcctggtgcc gcgcggcagc catatggcta gcatgactgg tggacagcaa 120
atgggtcgcg gatccatgaa aaacaaagtg cagctcatca catacgccga tcgtctcggc 180
gatggcactc ttagctcgat gaccgacatc ctgcgcaccc gcttcgacgg cgtgtatgac 240
ggcgtgcata tcctgccgtt cttcactccg ttcgatggtg cggatgcagg cttcgacccg 300
atcgaccata ccaaagtcga cgaacgtctc ggcagctggg acgacgtcgc cgaactctcc 360
aagacccaca acatcatggt cgacgccatc gtcaaccaca tgagttggga atccaagcag 420
ttccaagacg tgcttgaaaa aggtgaggaa tccgagtatt acccgatgtt cctgaccatg 480
agctccgtct tcccgaacgg cgccaccgaa gaagacctgg ccggcatcta ccgcccgcgc 540
ccgggcctgc cgttcaccca ctacaagttc gccggcaaga cgcgcttggt ctgggtgagc 600
ttcaccccgc agcaggtgga catcgacact gattccgcca agggttggga atacctgatg 660
tcgatcttcg atcagatggc cgccagccac gtgcgctaca tccgtctcga cgccgtgggc 720
tacggcgcca aggaagccgg caccagctgc ttcatgaccc ccaagacctt taagctcatc 780
tcccgtctgc gcgaggaggg cgtcaagcgc ggccttgaaa tcctcatcga ggttcacagc 840
tactacaaga agcaggtgga aatcgcctcc aaggtggacc gcgtctacga tttcgccctg 900
ccgccgctgc ttctgcactc gctgttcacc ggtcacgtcg aacccgtggc ccactggacc 960
gagatccgcc cgaacaacgc cgtcaccgtg ctcgatacgc acgatggcat cggcgtgatc 1020
gacatcggct ccgaccagct cgaccgctcc ctcaagggcc tcgtgcccga cgaggacgtc 1080
gacaacctgg tcaacaccat ccatgccaac acccacggcg aatcccaggc cgccaccggt 1140
gccgccgcgt ccaacctcga cctctaccag gtcaactcca cgtactactc ggccctcggc 1200
tgcaacgacc agcactactt ggccgcccgc gccgtgcagt tcttcctgcc gggcgtgccg 1260
caggtctact acgtgggcgc gctcgccggc cgcaacgaca tggaactgct gcgccgcacc 1320
aacaacggcc gcgacatcaa ccgccactac tactccaccg ccgaaatcga tgaaaacctc 1380
gaacgcccgg tggtcaaggc cctgaacgcc ctggccaagt tccgcaacga actgcctgca 1440
ttcgatggcg agttcagcta cgaggtcgat ggcgacacgt ccatcacctt ccgctggacc 1500
gccgccgacg gcacgtccac ggccgccctc accttcgagc ccggacgcgg cctcggcaca 1560
gacaacgcca ccccggttgc cagccttgcc tggagcgatg ccgccggcga ccacgaaacc 1620
cgcgatctgc tcgccaaccc gccgattgcc gatatcgaca agcttgcggc cgcactcgag 1680
caccaccacc accaccactg agatccggct gctaacaaag cccgaaa 1727
SEQUENCE LISTING
<110> Shandongde Biotechnology Ltd
<120> method for preparing L-ascorbic acid-2-glucoside by engineering strain of recombinant sucrose phosphorylase
<130> 1
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 508
<212> PRT
<213> Artificial sequence
<400> 1
Met Lys Asn Lys Val Gln Leu Ile Thr Tyr Ala Asp Arg Leu Gly Asp
1 5 10 15
Gly Thr Leu Ser Ser Met Thr Asp Ile Leu Arg Thr Arg Phe Asp Gly
20 25 30
Val Tyr Asp Gly Val His Ile Leu Pro Phe Phe Thr Pro Phe Asp Gly
35 40 45
Ala Asp Ala Gly Phe Asp Pro Ile Asp His Thr Lys Val Asp Glu Arg
50 55 60
Leu Gly Ser Trp Asp Asp Val Ala Glu Leu Ser Lys Thr His Asn Ile
65 70 75 80
Met Val Asp Ala Ile Val Asn His Met Ser Trp Glu Ser Lys Gln Phe
85 90 95
Gln Asp Val Leu Glu Lys Gly Glu Glu Ser Glu Tyr Tyr Pro Met Phe
100 105 110
Leu Thr Met Ser Ser Val Phe Pro Asn Gly Ala Thr Glu Glu Asp Leu
115 120 125
Ala Gly Ile Tyr Arg Pro Arg Pro Gly Leu Pro Phe Thr His Tyr Lys
130 135 140
Phe Ala Gly Lys Thr Arg Leu Val Trp Val Ser Phe Thr Pro Gln Gln
145 150 155 160
Val Asp Ile Asp Thr Asp Ser Ala Lys Gly Trp Glu Tyr Leu Met Ser
165 170 175
Ile Phe Asp Gln Met Ala Ala Ser His Val Arg Tyr Ile Arg Leu Asp
180 185 190
Ala Val Gly Tyr Gly Ala Lys Glu Ala Gly Thr Ser Cys Phe Met Thr
195 200 205
Pro Lys Thr Phe Lys Leu Ile Ser Arg Leu Arg Glu Glu Gly Val Lys
210 215 220
Arg Gly Leu Glu Ile Leu Ile Glu Val His Ser Tyr Tyr Lys Lys Gln
225 230 235 240
Val Glu Ile Ala Ser Lys Val Asp Arg Val Tyr Asp Phe Ala Leu Pro
245 250 255
Pro Leu Leu Leu His Ser Leu Phe Thr Gly His Val Glu Pro Val Ala
260 265 270
His Trp Thr Glu Ile Arg Pro Asn Asn Ala Val Thr Val Leu Asp Thr
275 280 285
His Asp Gly Ile Gly Val Ile Asp Ile Gly Ser Asp Gln Leu Asp Arg
290 295 300
Ser Leu Lys Gly Leu Val Pro Asp Glu Asp Val Asp Asn Leu Val Asn
305 310 315 320
Thr Ile His Ala Asn Thr His Gly Glu Ser Gln Ala Ala Thr Gly Ala
325 330 335
Ala Ala Ser Asn Leu Asp Leu Tyr Gln Val Asn Ser Thr Tyr Tyr Ser
340 345 350
Ala Leu Gly Cys Asn Asp Gln His Tyr Leu Ala Ala Arg Ala Val Gln
355 360 365
Phe Phe Leu Pro Gly Val Pro Gln Val Tyr Tyr Val Gly Ala Leu Ala
370 375 380
Gly Arg Asn Asp Met Glu Leu Leu Arg Arg Thr Asn Asn Gly Arg Asp
385 390 395 400
Ile Asn Arg His Tyr Tyr Ser Thr Ala Glu Ile Asp Glu Asn Leu Glu
405 410 415
Arg Pro Val Val Lys Ala Leu Asn Ala Leu Ala Lys Phe Arg Asn Glu
420 425 430
Leu Pro Ala Phe Asp Gly Glu Phe Ser Tyr Glu Val Asp Gly Asp Thr
435 440 445
Ser Ile Thr Phe Arg Trp Thr Ala Ala Asp Gly Thr Ser Thr Ala Ala
450 455 460
Leu Thr Phe Glu Pro Gly Arg Gly Leu Gly Thr Asp Asn Ala Thr Pro
465 470 475 480
Val Ala Ser Leu Ala Trp Ser Asp Ala Ala Gly Asp His Glu Thr Arg
485 490 495
Asp Leu Leu Ala Asn Pro Pro Ile Ala Asp Ile Asp
500 505
Claims (1)
1. A preparation method of L-ascorbic acid-2-glucoside is characterized in that: taking an engineering strain of the recombinant sucrose phosphorylase as a biocatalyst;
the preservation number of the engineering strain of the recombinant sucrose phosphorylase is as follows: CCTCC M2016496, wherein the preservation address is Wuhan, Wuhan university, postcode 430072;
the preparation method of the L-ascorbic acid-2-glucoside comprises the following steps:
weighing 300G of thallus slurry, adding 2L of 60mM trisodium citrate solution to re-disperse the thallus slurry to prepare thallus suspension, then sequentially adding 360G of sucrose and 90G of L-ascorbic acid, stirring while adding to completely dissolve the raw materials, then adding 60mM trisodium citrate solution to a constant volume of 3L, adjusting the pH value to 4.0 by using 0.5M hydrochloric acid, and then transferring into a 5L biocatalytic reaction kettle, wherein the reaction temperature is 41 ℃, and the rotation speed is 200rpm, and biocatalysis is carried out to prepare AA-2G; the conversion process is adjusted by 0.5M hydrochloric acid or 0.5M sodium hydroxide solution in order to keep the pH of the reaction system to be 4.0; if the pH value of the conversion system is higher than 4.0, adjusting by using a 0.5M hydrochloric acid solution; if the concentration is lower than 4.0, adjusting by using 0.5M sodium hydroxide solution; the conversion was carried out for 15 h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610985353.0A CN107058200B (en) | 2016-11-09 | 2016-11-09 | Method for preparing L-ascorbic acid-2-glucoside |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610985353.0A CN107058200B (en) | 2016-11-09 | 2016-11-09 | Method for preparing L-ascorbic acid-2-glucoside |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107058200A CN107058200A (en) | 2017-08-18 |
| CN107058200B true CN107058200B (en) | 2021-04-09 |
Family
ID=59618463
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610985353.0A Active CN107058200B (en) | 2016-11-09 | 2016-11-09 | Method for preparing L-ascorbic acid-2-glucoside |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107058200B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108018252B (en) * | 2017-12-12 | 2021-07-30 | 山东格得生物科技有限公司 | Preparation method of intermediate 2' -deoxyguanosine |
| CN108913641B (en) * | 2018-06-29 | 2021-02-02 | 浙江工业大学 | Recombinant escherichia coli and application thereof |
| CN109988778B (en) * | 2019-05-14 | 2020-10-27 | 南京工业大学 | Sucrose phosphorylase gene and application thereof |
| CN111172128A (en) * | 2020-01-21 | 2020-05-19 | 浙江工业大学 | application of sucrose phosphorylase in preparation of 2-O- α -D-glucosyl-L-ascorbic acid |
| CN112695021B (en) * | 2020-12-02 | 2023-02-28 | 南京工业大学 | Alpha-glycosidase gene mutant and application thereof in preparation of 2-O-alpha-D-glucosyl-L-ascorbic acid |
| CN113956999B (en) * | 2021-08-06 | 2023-02-03 | 广西科技师范学院 | Bacillus belgii for producing sucrose phosphorylase and application thereof |
-
2016
- 2016-11-09 CN CN201610985353.0A patent/CN107058200B/en active Active
Non-Patent Citations (7)
| Title |
|---|
| Kwon T et al..Transglucosylation of ascorbic acid to ascorbic acid 2-glucoside by a recombinant sucrose phosphorylase from Bifidobacterium longum.《Biotechnol Lett》.2007,第29卷(第4期),第611-615页. * |
| Transglucosylation of ascorbic acid to ascorbic acid 2-glucoside by a recombinant sucrose phosphorylase from Bifidobacterium longum;Kwon T et al.;《Biotechnol Lett》;20070110;第29卷(第4期);第612页左栏最后一段-右栏最后一段，第613页左栏第2-3段 * |
| 维生素C葡萄糖苷的研究现状及发展前景;王冰 等;《生物加工过程》;20080731;第6卷(第4期);第1-6页 * |
| 自诱导系统在酶促合成2’-脱氧胞苷中的应用;王玺等;《生物技术通报》;20141106(第11期);第225-232页 * |
| 蔗糖磷酸化酶在大肠杆菌中的表达及优化;叶慧 等;《食品科技》;20150420;第40卷(第04期);第23页右栏最后一段-第24页左栏第1段 * |
| 重组大肠杆菌产蔗糖磷酸化酶的酶学性质及其催化合成α-熊果苷;万月佳 等;《生物工程学报》;20121225;第28卷(第12期);第1450-1459页 * |
| 长双歧杆菌蔗糖磷酸化酶定点突变及其催化机理的研究;于丽;《中国优秀硕士学位论文全文数据库 基础科学辑》;20140105(第01期);正文第14页第1段-第18页第3段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107058200A (en) | 2017-08-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107058200B (en) | Method for preparing L-ascorbic acid-2-glucoside | |
| CN111712570B (en) | Engineering strain for producing psicose and derivatives thereof, construction method and application thereof | |
| CN112322565B (en) | Method for improving yield of 2' -fucosyllactose in recombinant escherichia coli | |
| CN108913641B (en) | Recombinant escherichia coli and application thereof | |
| CN113528480B (en) | Alpha-1, 2-fucosyltransferase mutant and construction method and application thereof | |
| CN113717910B (en) | Tri-enzyme co-expression recombinant bacterium and application thereof in (S) -citronellol synthesis | |
| CN114874964B (en) | Construction method and application of recombinant escherichia coli for high yield of 2' -fucosyllactose | |
| CN114480465B (en) | Bacillus subtilis for producing 2' -fucosyllactose and application thereof | |
| CN113337495B (en) | Method for improving sialic acid yield and application | |
| CN111394328B (en) | Cyclodextrin glucosyltransferase with improved product specificity and preparation method thereof | |
| CN113073074A (en) | Genetically engineered bacterium for efficiently synthesizing riboflavin and application thereof | |
| CN113322219A (en) | Method for synthesizing curcumin glucoside compound by biological method catalysis | |
| CN105969713B (en) | Genetic engineering bacterium for high yield of maltooligosyl trehalose hydrolase and application thereof | |
| CN113699087B (en) | Lactobacillus plantarum engineering strain for converting lactose to generate lactulose, construction method and application thereof | |
| CN114806991A (en) | Engineering escherichia coli for improving yield of fucosyllactose and production method | |
| CN111534498B (en) | Cyclodextrin glucosyltransferase mutant with improved disproportionation specific activity and AA-2G yield | |
| CN114107244A (en) | Cyclodextrin glycosyltransferase mutant, coding gene and application thereof | |
| CN108103046B (en) | Maltooligosyl trehalose hydrolase mutant and application thereof | |
| CN115404226A (en) | Sucrose synthase and application thereof in catalytic glycosylation reaction | |
| CN114395542B (en) | Sucrose phosphorylase and application thereof | |
| CN114250207B (en) | High-activity sucrose phosphorylase and application thereof | |
| CN114317476B (en) | Biocatalysis production process of glucosyl glycerine and sucrose phosphorylase thereof | |
| CN114231509B (en) | Sucrose phosphorylase and glucosyl glycerol production process | |
| CN113881737B (en) | Method for producing CMP-sialic acid on large scale by coupling fermentation of genetically engineered bacteria and yeast | |
| CN114164192B (en) | Sucrose phosphorylase and application thereof in preparation of glucose-1-phosphate |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |