CN107056922A - A kind of preparation method of the PACAP polypeptide analogs with hypoglycemic effect - Google Patents
A kind of preparation method of the PACAP polypeptide analogs with hypoglycemic effect Download PDFInfo
- Publication number
- CN107056922A CN107056922A CN201611209998.1A CN201611209998A CN107056922A CN 107056922 A CN107056922 A CN 107056922A CN 201611209998 A CN201611209998 A CN 201611209998A CN 107056922 A CN107056922 A CN 107056922A
- Authority
- CN
- China
- Prior art keywords
- pacap
- polypeptide analogs
- prokaryotic expression
- pacap polypeptide
- analogs
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/34—Vector systems having a special element relevant for transcription being a transcription initiation element
Abstract
The invention discloses a kind of preparation method of the PACAP polypeptide analogs with hypoglycemic effect.It is to solve the problem of existing PACAP natural structures stability is poor.It is before this according to PACAP genes and the analysis to important site in gene, designing both has hypoglycemic activity, the PACAP analogs of half-life period can be extended again, the gene of this kind of analog is obtained using fully synthetic method, expression vector is cloned into by amplification again and carries out prokaryotic expression, PACAP polypeptide analogs are obtained.The present invention obtains the prokaryotic expression product of PACAP polypeptide analogs using the method for prokaryotic expression, and its is cheap, it is easy to operate, and reduces production cost；The PACAP polypeptide analogs stability obtained is good, while having blood sugar reducing function, available for later product processing and utilization.
Description
Technical field
The invention belongs to gene engineering technology field, more particularly to a kind of PACAP polypeptides with hypoglycemic effect are similar
The preparation method of thing.
Background technology
Diabetes are endocrine system diseases caused by human nutrition dysbolism, basic biochemical special using persistent high blood sugar as it
Levy, because insulin can not bring into normal play physiological action in target cell, and insulin supply is not enough, make protein, fat and
Monose conversion imbalance, causes the water of patient, electrolyte to write the systemic disease of disorder.It is divided into IDDM and II type glycosuria
Disease.Type II diabetes is a most common class, is mainly in adult.At present, completely using the list of drug therapy before being different from
One mode, 2015, one times, 2015 is added for 2012 using diabetic's number ratio of medicine and health care combination therapy
Diabetes mellitus in China health-product market added than 2012 more than 3 times.
Pituitary adenylate cyclase activating peptide（Pitui tary Adenylate Cyclase Activiting Poly-
peptide PACAP）It is that Miy ata are equal to the nerve found when finding new hypothalamus trophic hormone from sheep hypothalamus for 1989
Peptide, because it is to rat pituitary cell adenyl cyclase（AC）High activation and gain the name, including PACAP38 and PACAP27
Two kinds, it is made up of respectively 38 and 27 amino acid, the amino acid sequence of the latter and 1~27 amino acid of PACAP38 N-terminal are residual
Base is identical.This two kinds of polypeptides be distributed widely in the hypothalamuses of many animals, central nervous system, peripheral nervous system and
In non-nervous tissue in the tissue such as liver, kidney, pancreas, respiratory system and digestive system or system, wherein adrenal gland content is most
Height, and with multiple biological activities.Pituitary adenylate cyclase activating peptide（PACAP）And its acceptor is in these tissues or system
In, pass through Ca2+、Na+, the effect path such as adenyl cyclase or phosphoinositide, PACAP plays neurotransmitter/quenched, more plays
The biological functions such as neurotrophic factor.PACAP is not only a kind of new hypothalamic hypophysiotropic hormone, or a kind of new god
Through mediator and neuromodulator, PACAP is caused in ancestral cell by acting on PACAP acceptors, activated adenyl cyclase
CAMP levels increase.In addition, it also plays a role in the paracrine and Autocrine regulation of some cell types.Have in recent years
Research shows that PACAP can stimulate beta Cell of islet hyperplasia, prevent islet beta-cell apoptosis, suppress by promoting insulin secretion
Release, suppression gastrointestinal peristalsis and the gastric secretion of hyperglycemic factor, delay gastric emptying, generation feeling of repletion and loss of appetite etc. are multiple
Approach controls blood glucose.But, PACAP self stabilities are poor, cause Half-life in vivo short.
The content of the invention
In order to overcome the shortcomings of that the Half-life in vivo that existing PACAP natural structures stability difference is present is short, the present invention is provided
A kind of preparation method of reasonable, the easily operated PACAP polypeptide analogs with hypoglycemic effect of step, this method passes through point
Mutation obtains a kind of PACAP analogs, to reach the auxiliary hyperglycemic function similar with PACAP.
The technical solution adopted for the present invention to solve the technical problems is：A kind of PACAP polypeptides with hypoglycemic effect
The preparation method of analog, it is characterised in that：It passes through following process steps：
（1）, gene design with synthesis
PACAP analogue genes after fully synthetic point mutation, total length is 84bp；Its two ends introduces BamH I and the digestions of EcoR I respectively
Site；Wherein,
Above-mentioned analogue gene sequence is as follows：
5’-cactcagacgctgttttcactgacaactacactcgactccgaaagcagatggcagtaaagaagtacctca
actcaatcctaaac-3’；
（2）, digestion
By step（1）PACAP analogue genes and BamH I is respectively adopted for PGEX-6P-1 carriers and EcoR I enters that middle synthesis is obtained
Row double digestion, digestion temperature is 37 DEG C, acts on 2~4h；
（3）, connection
By step（2）In after obtained endonuclease bamhi reclaimed with carrier using the QIAquick Gel Extraction Kit of PROMEG companies, 16 DEG C of connections are stayed overnight；
（4）, conversion
By step（3）Obtained connection product conversion Escherichia coli XL1-Blue, picking monoclonal is simultaneously sequenced；
（5）, prokaryotic expression
By step（4）In the obtained correct Cloning Transformation e. coli bl21 of sequencing（DE3）, picking colony, being inoculated with volume is
10ml LB fluid nutrient mediums, 37 DEG C of 8~12h of shaken cultivation；10ml bacterium solutions are added in 500ml LB fluid nutrient mediums, 37
DEG C 8~12h of shaken cultivation；500ml bacterium solutions are seeded in 50~80L fermentation tanks, thalli growth index is tracked, treats OD600 ≈
0.4~0.6, IPTG to final concentration of 0.2~0.4mM is added thereto, continues shaken cultivation 6h；Can opening takes bacterium solution, 12000g
Centrifuge 30~60s；Again with fermentating liquid volume 10%~20%, concentration be resuspended for 1% SDS solution, mix, on ice ultrasound
Broken, 12000g centrifuges 30~60s, takes supernatant, produces the prokaryotic expression crude product of PACAP polypeptide analogs；
（6）, gel filtration
By step（5）In the obtained prokaryotic expression crude product of PACAP polypeptide analogs carry out gel permeation chromatography, collect egg
In vain, the prokaryotic expression product of PACAP polypeptide analogs is produced.
The present invention is before this according to PACAP genes and the analysis to important site in gene, and designing both there is hypoglycemic to live
Property, the PACAP analogs of half-life period can be extended again, the gene of this kind of analog is obtained using fully synthetic method, pass through amplification
It is cloned into expression vector and carries out prokaryotic expression, obtains PACAP polypeptide analogs.The present invention is exempted from using the method for gene chemical synthesis
The possibility of gene mutation has been gone, premise is provided for subsequent step；It employs PGEX-6P-1 carriers, because pGEX is carried
Body can be used as induced expression, go for any Escherichia coli, can use gentle elution bar with a tac promoter
Part is eluted from affinity media, and the damage to resistant activity is reduced to greatest extent；It uses BL21 strains, for efficient
Expression cloning.The present invention obtains the prokaryotic expression product of PACAP polypeptide analogs using the method for prokaryotic expression, because of prokaryotic expression
Technology maturation, it is cheap, it is easy to operate, reduce production cost.The PACAP polypeptide analogs stability that the present invention is obtained is good,
Also there is blood sugar reducing function simultaneously, utilized available for post-production, it has wide market prospects.
Embodiment
With reference to embodiment, the invention will be further described.
Embodiment 1
A kind of preparation method of the PACAP polypeptide analogs with hypoglycemic effect, it passes through following process steps：
（1）, gene design with synthesis
PACAP analogue genes after fully synthetic point mutation, total length is 84bp；Its two ends introduces BamH I and the digestions of EcoR I respectively
Site；Wherein,
Above-mentioned analogue gene sequence is as follows：
5’-cactcagacgctgttttcactgacaactacactcgactccgaaagcagatggcagtaaagaagtacctca
actcaatcctaaac-3’；
（2）, digestion
By step（1）PACAP analogue genes and BamH I is respectively adopted for PGEX-6P-1 carriers and EcoR I enters that middle synthesis is obtained
Row double digestion, digestion temperature is 37 DEG C, acts on 3h；
（3）, connection
By step（2）In after obtained endonuclease bamhi reclaimed with carrier using the QIAquick Gel Extraction Kit of PROMEG companies, 16 DEG C of connections
Overnight；
（4）, conversion
By step（3）Obtained connection product conversion Escherichia coli XL1-Blue, picking monoclonal is simultaneously sequenced；
（5）, prokaryotic expression
By step（4）In the obtained correct Cloning Transformation e. coli bl21 of sequencing（DE3）, picking colony, being inoculated with volume is
10ml LB fluid nutrient mediums, 37 DEG C of shaken cultivation 10h；10ml bacterium solutions are added in 500ml LB fluid nutrient mediums, 37 DEG C are shaken
Swing culture 10h；500ml bacterium solutions are seeded in 60L fermentation tanks, thalli growth index is tracked, treats OD600 ≈ 0.5, are added thereto
Enter IPTG to final concentration of 0.3mM, continue shaken cultivation 6h；Can opening takes bacterium solution, 12000g centrifugations 45s；Fermentating liquid volume is used again
15%, concentration be resuspended for 1% SDS solution, mix, ultrasonication on ice, 12000g centrifuges 45s, takes supernatant, produces
The prokaryotic expression crude product of PACAP polypeptide analogs；
（6）, gel filtration
By step（5）In the obtained prokaryotic expression crude product of PACAP polypeptide analogs carry out gel permeation chromatography, collect egg
In vain, the prokaryotic expression product of PACAP polypeptide analogs is produced.
The present embodiment obtains the prokaryotic expression product of PACAP polypeptide analogs using the method for prokaryotic expression, because of protokaryon table
It is cheap up to technology maturation, it is easy to operate, reduce production cost.The PACAP polypeptide analog stability that the present invention is obtained
It is good, while also having blood sugar reducing function, utilized available for post-production, it has wide market prospects.
Embodiment 2
A kind of preparation method of the PACAP polypeptide analogs with hypoglycemic effect, it is characterised in that：It is walked by following process
Suddenly：
（1）, gene design with synthesis
PACAP analogue genes after fully synthetic point mutation, total length is 84bp；Its two ends introduces BamH I and the digestions of EcoR I respectively
Site；Wherein,
Above-mentioned analogue gene sequence is as follows：
5’-cactcagacgctgttttcactgacaactacactcgactccgaaagcagatggcagtaaagaagtacctca
actcaatcctaaac-3’；
（2）, digestion
By step（1）PACAP analogue genes and BamH I is respectively adopted for PGEX-6P-1 carriers and EcoR I enters that middle synthesis is obtained
Row double digestion, digestion temperature is 37 DEG C, acts on 4h；
（3）, connection
By step（2）In after obtained endonuclease bamhi reclaimed with carrier using the QIAquick Gel Extraction Kit of PROMEG companies, 16 DEG C of connections
Overnight；
（4）, conversion
By step（3）Obtained connection product conversion Escherichia coli XL1-Blue, picking monoclonal is simultaneously sequenced；
（5）, prokaryotic expression
By step（4）In the obtained correct Cloning Transformation e. coli bl21 of sequencing（DE3）, picking colony, being inoculated with volume is
10ml LB fluid nutrient mediums, 37 DEG C of shaken cultivation 12h；10ml bacterium solutions are added in 500ml LB fluid nutrient mediums, 37 DEG C are shaken
Swing culture 12h；500ml bacterium solutions are seeded in 80L fermentation tanks, thalli growth index is tracked, treats OD600 ≈ 0.6, are added thereto
Enter IPTG to final concentration of 0.4mM, continue shaken cultivation 6h；Can opening takes bacterium solution, 12000g centrifugations 60s；Fermentating liquid volume is used again
20%, concentration be resuspended for 1% SDS solution, mix, ultrasonication on ice, 12000g centrifuges 60s, takes supernatant, produces
The prokaryotic expression crude product of PACAP polypeptide analogs；
（6）, gel filtration
By step（5）In the obtained prokaryotic expression crude product of PACAP polypeptide analogs carry out gel permeation chromatography, collect egg
In vain, the prokaryotic expression product of PACAP polypeptide analogs is produced.
This implementation obtains the prokaryotic expression product of PACAP polypeptide analogs, technology maturation, valency using the method for prokaryotic expression
Lattice are cheap, it is easy to operate, and reduce production cost.The PACAP polypeptide analogs stability that the present invention is obtained is good, while also having drop
Sugar effect.
Embodiment 3
A kind of preparation method of the PACAP polypeptide analogs with hypoglycemic effect, it is characterised in that：It is walked by following process
Suddenly：
（1）, gene design with synthesis
PACAP analogue genes after fully synthetic point mutation, total length is 84bp；Its two ends introduces BamH I and the digestions of EcoR I respectively
Site；Wherein,
Above-mentioned analogue gene sequence is as follows：
5’-cactcagacgctgttttcactgacaactacactcgactccgaaagcagatggcagtaaagaagtacctca
actcaatcctaaac-3’；
（2）, digestion
By step（1）PACAP analogue genes and BamH I is respectively adopted for PGEX-6P-1 carriers and EcoR I enters that middle synthesis is obtained
Row double digestion, digestion temperature is 37 DEG C, acts on 2h；
（3）, connection
By step（2）In after obtained endonuclease bamhi reclaimed with carrier using the QIAquick Gel Extraction Kit of PROMEG companies, 16 DEG C of connections
Overnight；
（4）, conversion
By step（3）Obtained connection product conversion Escherichia coli XL1-Blue, picking monoclonal is simultaneously sequenced；
（5）, prokaryotic expression
By step（4）In the obtained correct Cloning Transformation e. coli bl21 of sequencing（DE3）, picking colony, being inoculated with volume is
10ml LB fluid nutrient mediums, 37 DEG C of shaken cultivation 8h；10ml bacterium solutions are added in 500ml LB fluid nutrient mediums, 37 DEG C are shaken
Swing culture 8h；500ml bacterium solutions are seeded in 50L fermentation tanks, thalli growth index is tracked, treats OD600 ≈ 0.4, are added thereto
Enter IPTG to final concentration of 0.2mM, continue shaken cultivation 6h；Can opening takes bacterium solution, 12000g centrifugations 30s；Fermentating liquid volume is used again
10%, concentration be resuspended for 1% SDS solution, mix, ultrasonication on ice, 12000g centrifuges 30s, takes supernatant, produces
The prokaryotic expression crude product of PACAP polypeptide analogs；
（6）, gel filtration
By step（5）In the obtained prokaryotic expression crude product of PACAP polypeptide analogs carry out gel permeation chromatography, collect egg
In vain, the prokaryotic expression product of PACAP polypeptide analogs is produced.
This implementation obtains the prokaryotic expression product of PACAP polypeptide analogs using the method for prokaryotic expression, because of prokaryotic expression
Technology maturation, it is cheap, it is easy to operate, reduce production cost.The PACAP polypeptide analogs stability that the present invention is obtained is good,
Also there is blood sugar reducing function simultaneously.
The PACAP polypeptide analogs that the present invention is obtained using embodiment 1 are carried out to the influence of blood glucose in diabetic mice
Determine, its concrete outcome is as follows：
| Group | N | Before experiment | After experiment |
| Normal group | 10 | 3.72±1.21 | 3.69±0.90 |
| Diabetic controls group | 10 | 25.72±5.11 | 23.25±3.32 |
| Experimental group | 10 | 25.44±5.61 | 18.05±3.27# |
Result of the test shows that present invention gained polypeptide analog has significant blood sugar reducing function to tissue of experimental diabetic mice.#With
P is compared before experiment<0.01.
Claims (1)
1. a kind of preparation method of the PACAP polypeptide analogs with hypoglycemic effect, it is characterised in that：It passes through following process
Step：
（1）, gene design with synthesis
PACAP analogue genes after fully synthetic point mutation, total length is 84bp；Its two ends introduces BamH I and the digestions of EcoR I respectively
Site；Wherein,
Above-mentioned analogue gene sequence is as follows：
5’-cactcagacgctgttttcactgacaactacactcgactccgaaagcagatggcagtaaagaagtacctca
actcaatcctaaac-3’；
（2）, digestion
By step（1）PACAP analogue genes and BamH I is respectively adopted for PGEX-6P-1 carriers and EcoR I enters that middle synthesis is obtained
Row double digestion, digestion temperature is 37 DEG C, acts on 2~4h；
（3）, connection
By step（2）In after obtained endonuclease bamhi reclaimed with carrier using the QIAquick Gel Extraction Kit of PROMEG companies, 16 DEG C of connections
Overnight；
（4）, conversion
By step（3）Obtained connection product conversion Escherichia coli XL1-Blue, picking monoclonal is simultaneously sequenced；
（5）, prokaryotic expression
By step（4）In the obtained correct Cloning Transformation e. coli bl21 of sequencing（DE3）, picking colony, being inoculated with volume is
10ml LB fluid nutrient mediums, 37 DEG C of 8~12h of shaken cultivation；10ml bacterium solutions are added in 500ml LB fluid nutrient mediums, 37
DEG C 8~12h of shaken cultivation；500ml bacterium solutions are seeded in 50~80L fermentation tanks, thalli growth index is tracked, treats OD600 ≈
0.4~0.6, IPTG to final concentration of 0.2~0.4mM is added thereto, continues shaken cultivation 6h；Can opening takes bacterium solution, 12000g
Centrifuge 30~60s；Again with fermentating liquid volume 10%~20%, concentration be resuspended for 1% SDS solution, mix, on ice ultrasound
Broken, 12000g centrifuges 30~60s, takes supernatant, produces the prokaryotic expression crude product of PACAP polypeptide analogs；
（6）, gel filtration
By step（5）In the obtained prokaryotic expression crude product of PACAP polypeptide analogs carry out gel permeation chromatography, collect egg
In vain, the prokaryotic expression product of PACAP polypeptide analogs is produced.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611209998.1A CN107056922A (en) | 2016-12-24 | 2016-12-24 | A kind of preparation method of the PACAP polypeptide analogs with hypoglycemic effect |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611209998.1A CN107056922A (en) | 2016-12-24 | 2016-12-24 | A kind of preparation method of the PACAP polypeptide analogs with hypoglycemic effect |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107056922A true CN107056922A (en) | 2017-08-18 |
Family
ID=59624055
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611209998.1A Pending CN107056922A (en) | 2016-12-24 | 2016-12-24 | A kind of preparation method of the PACAP polypeptide analogs with hypoglycemic effect |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107056922A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1996034958A1 (en) * | 1995-05-03 | 1996-11-07 | Biostar Inc. | Vasoactive intestinal peptide |
| WO1998040477A1 (en) * | 1997-03-14 | 1998-09-17 | The Regents Of The University Of California | Fluorescent protein sensors for detection of analytes |
| CN102596217A (en) * | 2009-08-14 | 2012-07-18 | 费斯生物制药公司 | Modified vasoactive intestinal peptides |
-
2016
- 2016-12-24 CN CN201611209998.1A patent/CN107056922A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1996034958A1 (en) * | 1995-05-03 | 1996-11-07 | Biostar Inc. | Vasoactive intestinal peptide |
| WO1998040477A1 (en) * | 1997-03-14 | 1998-09-17 | The Regents Of The University Of California | Fluorescent protein sensors for detection of analytes |
| CN102596217A (en) * | 2009-08-14 | 2012-07-18 | 费斯生物制药公司 | Modified vasoactive intestinal peptides |
Non-Patent Citations (7)
| Title |
|---|
| TAKESHI TENNO，ET AL.: "High-throughput construction method for expression vector of peptides for NMR study suited for isotopic labeling", 《PROTEIN ENGINEERING，DESIGN&SELECTION》 * |
| ZHANGZHI WANG ET AL.: "High Level Expression Purification and Characterization of the Recombinant Grass Carp Pituitary Adenylate Cyclase Activating Polypeptide", 《BIOSCIENCE, BIOTECHNOLOGY, AND BIOCHEMISTRY》 * |
| 余兰兰 等: "《现代生化分离技术及应用研究》", 31 December 2011, 吉林大学出版社 * |
| 吴建祥等: "《分子生物学实验》", 31 July 2014, 浙江大学出版社 * |
| 王自正: "《现代医学标记免疫学》", 31 August 2000, 人民军医出版社 * |
| 石耀华 等: "《水产养殖专业 生物学基础课程实验》", 31 August 2011, 海军出版社 * |
| 韩乾坤等: "《生物化学》", 31 August 2015, 第四军医大学出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100540565C (en) | The Exendins and the application thereof of modifying | |
| CN108191981B (en) | Preparation method of liraglutide intermediate polypeptide | |
| CN102816244A (en) | Fusion protein of exendin-4 peptide and human serum albumin (HSA) and preparation method thereof | |
| CN104024273A (en) | Dual function proteins for treating metabolic disorders | |
| CN102363633A (en) | Glucagon like peptide-1 mutant polypeptide and preparation method, medicinal composition and use thereof | |
| CN103403019A (en) | Engineered polypeptides having enhanced duration of action | |
| Aluwong et al. | Volatile fatty acids production in ruminants and the role of monocarboxylate transporters: a review | |
| CN102766204A (en) | Glucagon-like peptide-1 mutant polypeptide, its preparation method and application thereof | |
| WO2022012020A1 (en) | Preparation method for glp-1 analogue polypeptide and use thereof in type ii diabetes | |
| CN113265007B (en) | Fusion protein for treating metabolic diseases and preparation method and application thereof | |
| TW201323439A (en) | Human insulin analogues and acidylated derivatives thereof | |
| CN102153652A (en) | Expression method and application of fusion protein | |
| CN111778224A (en) | Uricase or homologous enzyme thereof and application thereof | |
| CN102942626A (en) | Glucagon-like peptide-2 analogue, its preparation method and application | |
| CN106554404B (en) | Exenatide modifier and application thereof | |
| CN106390100B (en) | Application of polypeptide compound as GLP-1 drug carrier, method and fusion protein compound thereof | |
| CN100392070C (en) | High efficiency experssino human glicentin-1 gene engineering bacteria and its construction method and use | |
| CN107056922A (en) | A kind of preparation method of the PACAP polypeptide analogs with hypoglycemic effect | |
| CN105985425A (en) | Polyethylene glycol-modified exendin analog, and preparation method and application thereof | |
| CN105884901B (en) | Tool persistently controls recombination human serum albumin/glicentin class peptide fusion protein of blood-sugar content function | |
| CN110092825A (en) | A method of Liraglutide intermediate polypeptide is prepared using genetic recombination | |
| CN107188953A (en) | Glucagon-like peptide 1 analog and application thereof | |
| CN114075296A (en) | Multifunctional variant protein and fusion protein thereof | |
| CN103613657B (en) | Shorten Exendin4 and the genetically engineered application thereof of peptide chain | |
| CN103193881A (en) | Hypoglycemic polypeptide derivative for oral medication and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170818 |