CN107043714B

CN107043714B - Probiotics and preparation method thereof

Info

Publication number: CN107043714B
Application number: CN201611146623.5A
Authority: CN
Inventors: 彭永正; 伍菲凡; 郭先凤; 易江丰
Original assignee: Guangzhou Comzea Medical Science & Technology Co ltd; Southern Medical University Zhujiang Hospital
Current assignee: Guangzhou Comzea Medical Science & Technology Co ltd; Southern Medical University Zhujiang Hospital
Priority date: 2016-12-13
Filing date: 2016-12-13
Publication date: 2021-03-12
Anticipated expiration: 2036-12-13
Also published as: CN107043714A

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to probiotics and a preparation method thereof. The invention provides probiotics, wherein the preservation number of the probiotics is as follows: GDMCC 60085. The invention also provides a preparation method of the probiotic, which comprises the following steps: step one, preparing bacterial liquid; step two, PCR amplification: and step three, culturing and purifying bacterial colonies. The invention also provides a probiotic solid koji which is prepared from the probiotic. According to the technical scheme provided by the invention, through a whole gene sequencing experiment, the prepared strain can participate in carbohydrate metabolism and fat metabolism, and simultaneously can generate vitamins and short-chain fatty acid acetic acid, so that the probiotic is a probiotic with good potential. Meanwhile, the preparation method provided by the invention is simple and easy to operate, and is suitable for large-scale popularization and application. Solves the technical defects of single probiotic species and complex separation in the prior art.

Description

Probiotics and preparation method thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to probiotics and a preparation method thereof.

Background

Probiotics is a kind of active microorganisms beneficial to a host, and is a general term for active beneficial microorganisms which are planted in the intestinal tract and the reproductive system of a human body and can produce exact health efficacy so as to improve the microbial ecological balance of the host and play a beneficial role. Probiotics play an important role in host health, and mainly comprise the following aspects: firstly, helping the host digest and absorb nutrients; secondly, important substances such as vitamins, short-chain fatty acids, antioxidants and the like are generated; thirdly, the host is helped to resist bacterial and viral infection by inhibiting the growth of harmful bacteria and removing toxins produced by the harmful bacteria, and the resistance of the host is improved.

Currently, probiotics found in humans can be broadly divided into three categories: lactobacilli, bifidobacteria and gram-positive cocci. With the increasingly deep understanding of the intestinal flora, most researches show that different bacteria play different roles in different disease people, and the market demand that various probiotics need to be separated and cultured is provided. In 2004, Akkermansia is the first bacterium Akkermansia of the genus Akkermansia isolated by Muriel Derrien et al, and the function study of Akkermansia muciniphila by researchers finds that the bacterium has the effects of improving the metabolic condition of obesity and type II diabetes patients and reducing weight and blood sugar. In the prior art, the isolated Akkermansia bacteria are only Akkermansia muciniphila, and the isolation method of the bacteria is relatively complex, so that the further popularization and application of probiotics are limited.

Therefore, the development of a probiotic and a preparation method thereof for solving the technical defects of single probiotic species and complicated separation in the prior art becomes a problem to be solved by those skilled in the art.

Disclosure of Invention

In view of the above, the invention provides a probiotic and a preparation method thereof, which are used for solving the technical defects of single probiotic species and complex separation in the prior art.

The invention provides probiotics, wherein the preservation number of the probiotics is as follows: GDMCC 60085.

The invention also provides a preparation method of the probiotic, which comprises the following steps:

step one, preparing bacterial liquid: uniformly mixing excrement and normal saline, diluting to obtain a diluent, inoculating the diluent into a mucin liquid culture medium, and culturing to obtain a bacterial liquid;

step two, PCR amplification: performing PCR by using the bacterial liquid as a template and a primer aiming at Akkermansia, selecting the bacterial liquid in a PCR reaction positive tube, inoculating the bacterial liquid on a mucin solid culture medium, and culturing to obtain a bacterial colony;

and step three, culturing and purifying bacterial colonies.

Preferably, the concentration of feces in the diluent is 10 to 6g/ml, and the volume ratio of the diluent to the mucin liquid medium is 1: 9.

Preferably, the conditions of the culture in step one are: anaerobic culture at 37 ℃ for 4 days in the first step.

Preferably, the primer for Akkermansia comprises: a first primer and a second primer;

the sequence of the primer I is CAGCACGTGAAGGTGGGGAC, and the sequence of the primer II is CCTTGCGGTTGGCTTCAGAT.

Preferably, the conditions for the culturing in step two are: anaerobic culture at 37 ℃ for 4 days in the first step.

Preferably, the method for culturing the purified colonies comprises the following steps: after the bacterial colony is inoculated on a chocolate plate for culture, the bacterial colony on the chocolate plate is inoculated on a Columbia blood plate for purification culture to obtain the bacterial colony

Preferably, the preparation method further comprises: and (3) sequencing verification, wherein the sequencing verification method is performed after the step of culturing the purified colonies.

The invention also provides a probiotic solid koji which is prepared from the probiotic.

PreferablyIn the probiotic solid koji, the viable count of the probiotics is 10⁹cfu/g koji.

In summary, the present invention provides a probiotic, wherein the preservation number of the probiotic is: GDMCC 60085. The invention also provides a preparation method of the probiotic, which comprises the following steps: step one, preparing bacterial liquid; step two, PCR amplification: and step three, culturing and purifying bacterial colonies. The invention also provides a probiotic solid koji which is prepared from the probiotic. According to the technical scheme provided by the invention, through a whole gene sequencing experiment, the prepared strain can participate in carbohydrate metabolism and fat metabolism, and simultaneously can generate vitamins and short-chain fatty acid acetic acid, so that the probiotic is a probiotic with good potential. Meanwhile, the preparation method provided by the invention is simple and easy to operate, and is suitable for large-scale popularization and application. Solves the technical defects of single probiotic species and complex separation in the prior art.

Biological preservation Instructions

Norzea, taxonomic nomenclature: akkermansia sp, deposited at Guangdong province microbial culture Collection center at 10 and 11 months in 2016, and addressed to Zhou Luo Miao No. 59, 5 th building of Michelia Tokyo No. 100, Guangzhou city, with the collection number of GDMCC No. 60085.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a bar graph of short chain fatty acid content in metabolites of bacterial colonies.

Detailed Description

The invention provides probiotics and a preparation method thereof, which are used for solving the technical defects of single probiotic strain and complex separation in the prior art.

The technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In order to illustrate the present invention in more detail, the following examples are provided to describe a probiotic and a preparation method thereof.

Example 1

This example is a specific example of the preparation of probiotics.

1.1 mucin purification

1.1.1 stock preparation

0.2g of anhydrous NaH is weighed₂PO₄、7gNa₂HPO₄·12H₂Dissolving O and 6g NaCl in deionized water, adjusting pH to 7.8, diluting to 1000ml, sterilizing at 125 deg.C under high pressure for 30min to obtain solution A, and storing at room temperature.

Weighing 5.85g NaCl in deionized water, adjusting pH to 7.0, diluting to 1000ml, sterilizing at 125 deg.C under high pressure for 30min to obtain solution B, and storing at room temperature.

1.1.2 purification

Weighing 10-15 g of mucin powder, adding the mucin powder into a 500ml A solution flask, uniformly stirring the mixture for 2 hours on a magnetic stirrer, adjusting the pH value of the solution to 7.2 +/-0.2 by using 1M sodium hydroxide, dropwise adding 500-1000 ul of toluene, continuously uniformly stirring the mixture for 18 hours on the magnetic stirrer, centrifuging the mixture for 10 minutes at 3000rpm, collecting the supernatant to another high-pressure flask, discarding the precipitate, and adding precooled absolute ethyl alcohol into the solution to enable the concentration of the ethanol to be about 60%. Standing in a refrigerator at 4 deg.C for 30min, centrifuging at 3000rpm for 10min, collecting precipitate, discarding supernatant, dissolving precipitate in 200mlB liquid, stirring for 6h, centrifuging at 3000rpm for 10min, collecting supernatant to another flask with high pressure, discarding precipitate, and adding pre-cooled anhydrous ethanol to the solution to obtain 60% concentration. Standing in refrigerator at 4 deg.C for 30min, centrifuging at 3000rpm for 10min, collecting precipitate, removing supernatant, dissolving the precipitate in 100ml distilled water, and storing at 4 deg.C under sealed condition.

1.2 liquid mucin Medium preparation

1.2.1 stock preparation

Preparing acid trace elements: weighing and/or measuring 1.491gFeCl₂·4H₂O、0.06gH₃BO4、0.068gZnCl₂、0.1725gCuCl₂·7H₂O、0.0635gMnCl₂、0.0119gCoCl₂·6H₂O、0.0235gNiCl₂·6H₂O and 4.18ml of HCl, dissolved in distilled water to a volume of 100 ml.

Preparing alkaline trace elements: weighing 0.01729gNa₂SeO₃、0.0242gNa₂MoO₄·2H₂O and 0.4g NaOH, dissolved in distilled water to 100 ml.

Preparing a vitamin solution: weighing 0.02g biotin and 0.21g vitamin B₃0.5g of vitamin B₆0.1g of vitamin B₂0.2g of vitamin B₁0.25g of vitamin B₁₂And 0.1g of pantothenic acid, dissolving in distilled water, and fixing to 100 ml.

Weighing and/or measuring 1.1g of CaCl₂、1.0gMgCl₂1ml of acid trace element and 1ml of alkaline trace element, adding distilled water to 100ml of constant volume, sterilizing at 125 ℃ under high pressure for 30min to obtain a solution 1, and sealing and storing at normal temperature.

Weighing 5.3g Na₂HPO₄3gNaCl and 4gKH₂PO₄Dissolving in distilled water, diluting to 100ml, pressurizing at 125 deg.C for 30min, diluting with distilled water to 100ml, sterilizing at 125 deg.C for 30min to obtain solution 2, and sealing at room temperature.

Weighing and/or measuring 2g NaHCO3 and 2ml vitamin solution, adding distilled water to 100ml, filtering with 0.22 μm filter membrane to obtain 3 solutions, and storing at 4 deg.C under sealed condition.

Weighing 2.5g Na₂S, distilled water is added to 100ml, and the solution is filtered by a 0.22 mu m filter membrane to prepare 4 solution which is stored in a sealing way at 4 ℃.

1.2.2 preparation of the Medium

Placing 200ml of sterile distilled water in a high-pressure wide-mouth bottle, sequentially adding 2ml of solution 1, 2ml of solution 2, 1ml of solution 3, 2ml of solution 4 and 30-40ml of purified mucin solution in a super clean bench, and shaking up after adding each solution. Sucking 5ml of liquid by using an electric pipette, subpackaging the liquid in a 15ml centrifugal tube, tightly covering the tube cover, and sealing and storing at 4 ℃.

1.3 preparation of solid mucin Medium

1.3.1 stock preparation

1.3.2 preparation of the Medium

Weighing 2g of agar in 200ml of distilled water, sterilizing for 30min at the high pressure of 125 ℃, immediately and sequentially adding 2ml of 1 solution, 2ml of 2 solution, 1ml of 3 solution, 2ml of 4 solution and 30-40ml of the purified mucin solution prepared in the step 1.1 into a super clean workbench, and shaking uniformly after adding one liquid; pouring into sterile plates, wherein each plate is 20 ml; after cooling and solidifying, placing in a sterile plastic bag, and sealing and storing at 4 ℃.

1.4 bacterial isolation

1.4.1 preparation of bacterial liquid

Collecting human fresh feces, adding 9ml of normal saline into 1g of feces, mixing, continuously diluting with 10 times of gradient, and diluting to 10 degree of dilution^-61ml of the fecal suspension was inoculated into 9ml of the mucin liquid medium prepared in step 1.2, and anaerobically cultured at 37 ℃ for 4 days to obtain a bacterial liquid.

Human feces used in this example were collected from healthy volunteers.

1.4.2 PCR amplification

Carrying out PCR by using a primer aiming at Akkermansia with a bacterial solution cultured for 3 days as a template; wherein, the sequence of the primer I is CAGCACGTGAAGGTGGGGAC, and the sequence of the primer II is CCTTGCGGTTGGCTTCAGAT. And (3) selecting bacterial liquid in the PCR reaction positive tube, inoculating the bacterial liquid on the mucin solid culture medium prepared in the step 1.3, and carrying out anaerobic culture to obtain bacterial colonies.

1.4.3 culture of purified colonies

Inoculating the bacterial colony on the mucin solid culture medium on a chocolate plate to culture a bacterial colony in an anaerobic manner, inoculating the bacterial colony on the chocolate plate on a Columbia blood plate to carry out purification culture to obtain a bacterial colony, and taking the bacterial colony on the Columbia blood plate to carry out PCR sequencing verification through a 16sRNA universal primer.

For convenience of description, in the present examples, the resulting purified colonies were designated NORZEA 37.

Example 2

This example is a specific example demonstrating the involvement of the purified colonies prepared in example 1 in carbohydrate metabolism.

2.1 DNA extraction, library construction and sequencing

Bacterial DNA extraction was performed using a mouse dose fecal DNA extraction kit (meiji, guangzhou) according to product instructions and techniques well known to those of ordinary skill in the art.

A DNA library with 150bp double ends and 250-300bp insert length was constructed using the TruSeq DNA sample preparation kit according to the product instructions and the technical means well known to those of ordinary skill in the art.

DNA sequencing is carried out by utilizing an Illumina Hiseq2500 sequencer, high-quality sequencing fragments are extracted, and subsequent work such as bacterial genome assembly, annotation, comparative genome analysis and the like is carried out.

2.2 genome Assembly

Assembling the sequencing fragments by using Velvet microbial genome assembling software, sequentially selecting different Kmer parameters (between 35 and 145) in the assembling process, and selecting the optimal assembling result.

After obtaining the preliminary contig assembly results, contig extension and scaffold was performed using SSPACE software followed by vacancy elimination for scaffold using GapFiller. Finally, contigs with a length of less than 200bp are filtered out and the final assembly result is obtained.

2.3 Gene function prediction

Gene annotation was performed using the Prokka genome analysis software, which uses a series of predictive tools to identify characteristic regions of the genome and their locations, including: 1) prediction of small rRNA (e.g., 5S,16S and 23S rRNA) using rnamer software; 2) prediction of tRNA using Aragorn software; and 3) predicting CRISPR sequences using PILER-CR. Prokka uses multiple steps to functionally annotate protein-encoding genes: 1) using Prodigal software to predict protein coding genes and pseudogene loci in the assembly result; 2) protein-encoding genes homologous to the model strain ATGG BAA-835 are referenced to the functional annotation of the model strain; 3) the remaining protein families were aligned by searching for bacterial protein information in the UniProt and RefSeq databases.

After the Prokka operation is finished, COG (gene family function database provided by the national center for biological information NCBI) and KEGG (Kyoto encyclopedia of genes and genomes) databases are continuously used for comparing and annotating gene functions. The parameters of the comparison requirements are as follows: comparable lengths exceed 70% of the gene length, and similarities are higher than 35%. Genes for which no match was found in the above several databases were labeled as hypothetical proteins. The prediction of the gene function of carbohydrate hydrolase was annotated by the same method using CAZy (carbohydrate activating enzyme database).

According to the gene function prediction results, NORZEA37 was found to have genes involved in galactose metabolism, fructose and mannose metabolism, and starch and sucrose metabolism. Therefore, NORZEA37 may be involved in carbohydrate metabolism.

Example 3

This example is a specific example to verify that the purified colonies prepared in example 1 are involved in the metabolism of fats.

3.1 DNA extraction, library construction and sequencing

3.2 genome Assembly

Assembling the sequencing fragments by using Velvet microbial genome assembling software, sequentially selecting different Kmer parameters (between 35 and 145) in the assembling process, and selecting the optimal assembling result. After obtaining the preliminary contig assembly results, contig extension and scaffold was performed using SSPACE software followed by vacancy elimination for scaffold using GapFiller. Finally, contigs with a length of less than 200bp are filtered out and the final assembly result is obtained.

3.3 Gene function prediction

After the Prokka operation is finished, COG (gene family function database provided by the national center for biological information NCBI) and KEGG (Kyoto encyclopedia of genes and genomes) databases are continuously used for comparing and annotating gene functions. The parameters of the comparison requirements are as follows: comparable lengths exceed 70% of the gene length, and similarities are higher than 35%. Genes for which no match could be found in the above several databases were labeled as putative proteins. The prediction of the gene function of carbohydrate hydrolase was annotated by the same method using CAZy (carbohydrate activating enzyme database).

According to the results of gene function prediction, NORZEA37 was found to have genes involved in fatty acid metabolism, glyceride metabolism, glycerophospholipid and sphingolipid metabolism. Therefore, NORZEA37 may be involved in lipid metabolism.

Example 4

This example is an embodiment of verifying that the purified colonies prepared in example 1 produce vitamins.

4.1 DNA extraction, library construction and sequencing

4.2 genome Assembly

4.3 Gene function prediction

According to the prediction of gene function, the NORZEA37 has genes involved in vitamin B1 (thiamine), vitamin B2 (riboflavin), vitamin B3 (nicotinic acid), vitamin B5 (pantothenic acid), vitamin B6, vitamin B7 (biotin) and vitamin B9 (folic acid synthesis), so that the NORZEA37 can be involved in the synthesis of vitamins.

Example 5

This example is an example demonstrating that the purified colonies prepared in example 1 produce short chain fatty acid acetic acid.

5.1 DNA extraction, library construction and sequencing

5.2 genome Assembly

5.3 Gene function prediction

Gene function prediction found that NORZEA37 has a gene involved in acetic acid synthesis. Therefore, NORZEA37 may be involved in the synthesis of short chain fatty acids.

5.4 gas chromatography identification of short chain fatty acids in bacterial metabolites

Handle 10⁵cfu NORZEA37 was inoculated into 500ml of a mucin broth containing 1g of mucin, 37g of swine brain heart extract and 5mg of L-cysteine hydrochloride per liter of deionized water, and cultured in an anaerobic incubator for 87 hours.

Collecting culture supernatant, and treating: about 180-200 mg of the culture medium sample is weighed and placed in a 2mL EP tube, and 1mL of distilled water is added to suspend the sample. Vortexing and shaking for 10min to obtain homogenate, centrifuging at 4 deg.C (5000 × g) for 10min, collecting supernatant, filtering with 0.22 μm filter membrane, adding 50% sulfuric acid (1/10 vol) into the supernatant, and shaking for 1 min. Then, 2 times of diethyl ether was added and mixed gently (without vortex) to extract for 20min, after which centrifugation (1000 Xg) was carried out at 4 ℃ for 5min, and the supernatant was taken for analysis. Detection Using Agilent 7890 gas chromatograph

The specific detection parameters are as follows: DB-FFAP, column length 30m, internal diameter 0.32mm, film thickness 0.25um, injection port temperature 230 ℃, detector temperature 250 ℃, split ratio 10: 1. The specific method for temperature programming comprises the following steps: keeping at 100 deg.C for 0.5min, and raising to 170 deg.C at 8 deg.C/min for 0.5 min. Finally, the temperature is raised to 220 ℃ at the speed of 20 ℃/min and maintained for 2 min.

The content of short chain fatty acids in the metabolites of the experimentally obtained bacterial colonies can be seen in figure 1.

From the examples 2 to 5, it can be concluded that the bacteria prepared by the technical scheme provided by the invention can participate in carbohydrate metabolism and fat metabolism, and can also produce vitamins and short-chain fatty acid acetic acid, and further, the bacteria prepared by the invention are probiotics with weight-losing and anti-oxidation functions.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Claims

1. The probiotic bacteria are characterized by having the preservation number as follows: 60085 for GDMCC NO; the probiotic produces vitamins and short chain fatty acid acetic acid.

2. A probiotic solid koji, characterized in that it is produced from the probiotic of claim 1.

3. The probiotic solid koji according to claim 2, wherein the probiotic solid koji has a viable count of 10⁹cfu/g koji.