CN107034216A - The design and application of miRancer molecules - Google Patents
The design and application of miRancer molecules Download PDFInfo
- Publication number
- CN107034216A CN107034216A CN201610084172.0A CN201610084172A CN107034216A CN 107034216 A CN107034216 A CN 107034216A CN 201610084172 A CN201610084172 A CN 201610084172A CN 107034216 A CN107034216 A CN 107034216A
- Authority
- CN
- China
- Prior art keywords
- microrna
- target
- sequence
- single stranded
- nucleotides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/50—Methods for regulating/modulating their activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/50—Biochemical production, i.e. in a transformed host cell
- C12N2330/51—Specially adapted vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The present invention relates to the design of miRancer molecules and application.The miRancer molecules that the present invention is provided can a kind of combining target microRNA single stranded RNA sequence, the single stranded RNA sequence has 5' end arms and 3' end arms, the 5' end arms is combined by base pair complementarity with target microRNA, and the 3' end arms is combined by base pair complementarity with the 5' end arms.The miRancer molecules of the present invention specific can increase target microRNA activity, so as to the expression for adjusting the gene that target microRNA is targetted.
Description
Technical field
The present invention relates to RNA molecule and application thereof.Specifically, the present invention relates to being capable of specificity
With reference to the expression with enhancing microRNA and oligo rna molecule of activity and application thereof.
Background technology
Ripe microRNA (miRNA) be about 22 nucleotides (nt) of a class length (for example
About 18-25 nucleotides) tiny RNA, in the cell with a variety of important adjustment effects.miRNA
It is widely present in eucaryote, they can be with those and the complementary mRNA molecules of its sequence
Function (silence for for example causing gene) is combined, this is an important plan of regulatory gene expression
Slightly.Result of study shows that miRNA participates in regulation and control ontogeny, Apoptosis, propagation and differentiation
Etc. vital movement, it can be played a role in the diagnosis and treatment of disease particularly cancer.
The content of the invention
In some embodiments, provided herein is a kind of combining target microRNA single stranded RNA
Sequence, the activity of single stranded RNA sequence enhancing target microRNA preferably is (herein
Referred to as miRancer molecules), the single stranded RNA sequence has 5' end arms and 3' end arms, the 5'
End arms is combined by base pair complementarity with target microRNA, and the 3' end arms passes through base complementrity
Pairing is combined with the 5' end arms,
The single stranded RNA sequence has formula 1 below from 5' ends to 3' ends：
(n5-11)(n0-3)(n6-7)(n1)(n11-21)(n0-2),
Wherein n is continuous nucleotides or its analog, and numeral is nucleotides or its analog thereafter
Number, each n can be independently from each other following nucleotides：A, U, G and C, or its nucleosides
Acid-like substance, wherein n1With the target microRNA primary nucleotide complementary in 5' ends, accordingly
n6-7Corresponding to target microRNA from 5' ends to 2-7 or 2-8 of 3' ends, so that
(n5-11)(n0-3)(n6-7) it is 5' end arms, (n11-21)(n0-2) it is 3' end arms, wherein n0-3For the C or G of insertion
To form GC pairings between the 5' end arms and 3' end arms.
In some embodiments, provided herein is the single strand RNA molecule being capable of combining target
MicroRNA and the activity for strengthening the microRNA.Inventor can strengthen described
The RNA molecule of microRNA activity is referred to as microRNA enhancers (microRNA enhancer),
Abbreviation miRancer.The enhancing microRNA activity can include for example stablizing described
MicroRNA, extends the half-life period of the microRNA, changes what the microRNA was adjusted
One or more in terms of expression of target gene.Measurement microRNA and microRNA is adjusted
The method of expression of target gene be known in the art.
In some embodiments, except (the n of insertion in RNA molecule described herein0-3) as scarce
Mouth is not calculated outside homogeneity, and the 5' end arms and the target microRNA are from 5' ends to 3' ends
The complementary strand of 2-18 nucleotides at least 50%, 60%, 70%, 80%, 90% or 100%
Homogeneity, (n6-7) and the target microRNA are from 5' ends to 2-7 of 3' ends preferably wherein
Or the complementary strand of 2-8 nucleotides has at least 80%, 90% or 100% homogeneity, preferably
(n11-21) and (n5-11)(n0-3)(n6-7) in unpaired nucleotides number be less than 6,5,4,3,2 or 1
Right, preferably whole unpaired nucleotides are in (n1) around.In some embodiments,
(n5-11)(n0-3)(n6-7) with 2-18 nucleotides of the target microRNA from 5' ends to 3' ends to
Few 50%, 60%, 70%, 80%, 90%, 95% or 100% is complementary.In some embodiments,
(n6-7) with the target microRNA from 5' ends to 2-7 of 3' ends or 2-8 nucleotides to
Few 80%, 90%, 95%, 99% or 100% is complementary.In some embodiments, (n11-21) with
(n5-11)(n0-3)(n6-7) at least 50%, 60%, 70%, 80%, 90%, 95% or 100% complementation.
In some embodiments, provided herein is a kind of carrier for including the single stranded RNA sequence,
Such as plasmid.
In some embodiments, provided herein is a kind of many nucleosides for including the single stranded RNA sequence
The carrier of acid sequence, such as plasmid.
In some embodiments, provided herein is a kind of the synthesis of single stranded RNA sequence or again
The RNA molecule of group.
In some embodiments, provided herein is a kind of cell for including the carrier.
In some embodiments, provided herein is the single stranded RNA sequence, the carrier or institute
State synthesis RNA molecule be used for specificity increase endogenous and/or exogenous target microRNA or
The expression of other tiny RNAs and/or the application method and/or purposes of activity.
In some embodiments, provided herein is the single stranded RNA sequence, the carrier or institute
The RNA molecule of synthesis is stated for external and/or specificity regulation in vivo (such as increase) target
The application method and/or purposes of the expression of the gene of microRNA targetings.In some embodiments,
MicroRNA targetings can be adjusted provided herein is the single stranded RNA sequence by being incorporated into genome
Gene expression region (the 5'UTR areas for including for example described gene) come it is specific regulation (for example
Increase) target microRNA targeting gene expression.
In some embodiments, provided herein is the single stranded RNA sequence, the carrier or institute
State the user that the RNA molecule of synthesis is used to sense the target microRNA or other tiny RNAs
Method and/or purposes.
In some embodiments, provided herein is the single stranded RNA sequence, the carrier or institute
State the RNA molecule of synthesis be used to sensing the target microRNA or other tiny RNAs so as to adjusting
Save the purposes of the expression of the gene of the target microRNA or other tiny RNAs targeting.
In some embodiments, provided herein is a kind of method, methods described includes being used for specificity increasing
Plus expression and/or the side of activity of endogenous and/or exogenous target microRNA or other tiny RNAs
Method, the expression for the gene of the external and/or internal specificity regulation target microRNA targetings
Method, as receptor be used for sense the target microRNA or other tiny RNAs method,
With for by sensing the target microRNA or other tiny RNAs so as to adjusting the mesh
Any one or more in the expression for the gene that microRNA or other tiny RNAs are targetted is marked,
Methods described is included provided herein is the single stranded RNA sequence, the carrier or the synthesis
RNA molecule with comprising target microRNA or other tiny RNAs sample (for example cell, blood,
Tissue etc. sample) contact the step of.In some embodiments, by by the single stranded RNA sequence
Row, the carrier or the RNA molecule of the synthesis are incorporated into aim cell and played a role.
In some embodiments, by by the RNA of single stranded RNA sequence, the carrier or the synthesis
The target microRNA that molecule discharges after being cracked with cell interacts, so as to sense the target
MicroRNA or other tiny RNAs, it is possible to for detect the microRNA in the sample
In the presence of.
In some embodiments, the single-stranded of combining target microRNA is produced provided herein is a kind of
The method of RNA sequence, methods described includes selection target microRNA and (for example adjusted according to hope
Target gene select corresponding microRNA), then produce that provided herein is the single stranded RNA sequence
Row, the carrier or the RNA molecule of the synthesis.
In some embodiments, provided herein is a kind of composition, it includes the single stranded RNA sequence
Row, the carrier, and/or the RNA molecule of the synthesis, the composition preferably can be used for
Purposes and method described herein.In some embodiments, provided herein is a kind of kit, it is wrapped
RNA molecule containing the single stranded RNA sequence, the carrier, and/or the synthesis, and make
With specification, the kit preferably can be used for purposes described herein and method.In some realities
Apply in scheme, the kit includes being suitable for storing the single stranded RNA sequence, the load
The various reagents of body, and/or the RNA molecule of the synthesis such as buffer solution etc..In some embodiments
In, the kit includes being appropriate for the single stranded RNA sequence, the carrier, and/or described
The RNA molecule of synthesis includes enzyme, conversion with the various reagents that target microRNA reacts or transfected
Reagent etc..In some embodiments, the kit includes fitting through the single stranded RNA sequence
Row, the carrier, and/or the synthesis RNA molecule by with target microRNA reactions and
Adjust destination gene expression (such as enhancing destination gene expression) reagent.
In some embodiments, provided herein is point that can be transcribed into the single stranded RNA sequence
From or recombination of polynucleotide, wherein the polynucleotides include the single stranded RNA expression vector, its
Described in expression vector include the DNA sequence dna for encoding the single stranded RNA.
In some embodiments, provided herein is a kind of combining target microRNA and enhancing are described
MicroRNA active method, methods described include by the single stranded RNA sequence, the carrier,
Or the synthesis RNA molecule introduce target cell the step of.The enhancing microRNA activity can
Including for example stablizing the microRNA, to extend the half-life period of the microRNA, change institute
One or more in stating in terms of the expression of target gene that microRNA is adjusted.
Brief description of the drawings
Fig. 1：The multi-form of miR-7 binding sequences.
Fig. 2：The multi-form of miR-9 binding sequences.
Fig. 3：MiR-7reporter and miR-9reporter schematic diagram.
Fig. 4：The miR-7reporter or miR-9reporter fluorescence being overexpressed after miRancers
Plain enzymatic activity.*,p<0.05,**,p<0.01by Student's t-test..
Fig. 5：The miR-7 binding sequence schematic diagrames of different stem lengths.
Fig. 6：It is overexpressed the uciferase activity of miR-7reporter after the miRancers of different stem lengths
*, p<0.01by Student's t-test.
Fig. 7:It is overexpressed the fluorescein of miR-7reporter or miR-9reporter after miRancer
Enzymatic activity.**,p<0.01by Student's t-test.
Fig. 8：It is overexpressed the expression of miR-7 or miR-9 after miRancer.* *, p<0.001
by Student's t test。
Fig. 9：Luciferase reporter vector schematic diagram containing miRancer or sponge sequences.
Figure 10：It is overexpressed influences of the miR-7 or miR-9 to different uciferase activities.*, p<0.05,
**,p<0.01,***,p>0.001by Student’s t test。
Embodiment
The present invention now is described more fully with reference to accompanying drawing, which describe the present invention a part and
Not all embodiments.In fact, these inventions can embody in many different forms, and not
It is interpreted as being limited by embodiment illustrated herein, its modification and other embodiments also include
Within the scope of the appended claims.
1.microRNA enhancers (microRNA enhancer)
In some embodiments, provided herein is the single strand RNA molecule being capable of combining target
MicroRNA and the activity for strengthening the microRNA, it is this to strengthen microRNA activity
RNA molecule be referred to herein as microRNA enhancers (microRNA enhancer), referred to as
miRancer.In some embodiments, enhancing microRNA activity can include for example stablizing institute
MicroRNA is stated, extends the half-life period of the microRNA, is changed (for example increasing or decreasing)
One or more in terms of the expression of target gene that the microRNA is adjusted.Measurement
MicroRNA half-life period and the method for expression of target gene are known in the art, see, for example, herein
The method illustrated in embodiment.
In some embodiments, miRancer is the single stranded RNA for being capable of combining target microRNA
Sequence, the single stranded RNA sequence has 5' end arms and 3' end arms, and the 5' end arms is mutual by base
Recruit and pair combined with target microRNA, the 3' end arms passes through base pair complementarity and the 5' ends
Arm is combined.
Herein, outer except as otherwise clearly stating, the order of nucleotide sequence is each meant from 5' end to 3'
The order at end.
In some embodiments, single stranded RNA sequence such as miRancer molecules are wrapped from 5' ends to 3' ends
Molecule containing formula 1 below or the molecular composition by the formula 1：
(n5-11)(n0-3)(n6-7)(n1)(n11-21)(n0-2),
Wherein n is continuous nucleotides or its analog, and numeral is nucleotides or its analog thereafter
Number, wherein n1The primary nucleotides in 5' ends (being typically U) with target microRNA is complementary,
Corresponding n6-7(claim from 5' ends to 2-7 of 3' ends or 2-8 corresponding to target microRNA
For " Seed Sequences ") so that (n5-11)(n0-3)(n6-7) it is 5' end arms, (n11-21)(n0-2) it is 3' end arms, its
Middle n0-3Matched for the C or G of insertion with forming GC between the 5' end arms and 3' end arms, (n0-2)
It can be overhang (overhang) for 3' ends, it can be such as UU.
In some embodiments, (n1) it is A.In some embodiments, wherein except the (n of insertion0-3)
Do not calculated as breach outside homogeneity, the 5' end arms and the target microRNA from 5' ends to
The 2-18 nucleotides at least 50%, 60%, 70%, 80%, 90% or 100% at 3' ends are complementary,
For example, the 5' end arms of the miRancer molecules and the microRNA molecule from 5' to 3' the
2-18 bit sequences (or such as 2-17,2-16,2-15,2-14 bit sequence) 100%, about 99%,
98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%,
86%, 85%, 84%, 83%, 82%, 81%, 80%, 75%, 70%, 65%, 60%, 55%,
Or 50% is complementary.In some embodiments it is preferred that wherein (n6-7) divide with the target microRNA
2-7 or 2-8 sequence 100% of the son from 5' to 3', about 99%, 98%, 97%, 96%,
95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%,
83%, 82%, 81%, 80%, 75%, 70%, 65%, 60%, 55%, or 50% complementation.
In some embodiments, (n5-11)(n0-3)(n6-7) and (n11-21) between 100%, about 99%, 98%,
97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%,
85%, 84%, 83%, 82%, 81%, 80%, 75%, 70%, 65%, 60%, 55%, or
50% is complementary, forms stem structure.In some embodiments it is preferred that (n11-21) and (n5-11)(n0-3)(n6-7)
In unpaired nucleotides number be less than 6,5,4,3,2 or 1 pairs, it is preferably all unpaired
Nucleotides is in (n1) around, form ring structure.In some embodiments, the length of the stem structure
It is 10-18 to pairing nucleotides, including such as 10 pairs, 11 pairs, 12 pairs, 13 pairs, 14 pairs, 15
It is right, 16 pairs, 17 pairs, 18 pairs of pairing nucleotides.In some embodiments, the ring structure bag
Include 1-13 nucleotides, including such as 1,2,3,4,5,6,7,8,9,10,11,12,
Or 13 nucleotides.In some embodiments, (n0-2) (overhang) can be overhang for 3' ends,
It can be such as UU.In some embodiments, close to (n1) around (including (n1) including)
1,2,3,4,5,6,7,8,9,10,11,12 or 13 nucleotides formation ring；For example,
In (n1) 5' ends and 3' ends respectively there is 1,2,3,4,5 or 6 nucleotides formation 5' ends and 3' end arms,
It is not complementary between the 5' ends and 3' end arms, so as to form ring.In some embodiments, in (n1)
5' ends and 3' ends respectively there is 1,2,3,4,5 or 6 nucleotides formation 5' ends and 3' end arms, institute
State it is not complementary between 5' ends and 3' end arms, so as to form ring, without being formed between the remaining nucleotides of ring
At least 50%, 60%, 70%, 80%, 90% or 100% are complementary, form stem.In some implementations
In scheme, in (n1) 5' ends and 3' ends respectively there is 1,2,3,4,5 or 6 nucleotides formation 5'
End and 3' end arms, it is not complementary between the 5' ends and 3' end arms, so that ring is formed, without forming ring
100% is complementary between remaining nucleotides, forms stem.
In some embodiments, each n of nucleotide sequence described herein is independently from each other
Following nucleotides：A, U, T, G and C, or its nucleotide analog, if for example described sequence
For RNA sequence, each n can be independently from each other following nucleotides：A, U, G and C,
Or its nucleotide analog.
In some embodiments, (n1) it is A.In some embodiments, (n6-7) and microRNA
2-7 or 2-8 complete complementaries, (n0-3) it is the cytidine (C) or guanosine (G) its class inserted
Like thing, so that its corresponding (n11-21) relevant position in sequence is complementary guanosine (G) or born of the same parents
Glycosides (C) its analog, it is described to match somebody with somebody to form GC pairings between the 5' end arms and 3' end arms
To number can be 0,1,2,3, the C of the insertion calculate the microRNA with
Do not counted during complementarity between the miRancer as breach.In some embodiments,
(n5-11) it is 5,6,7,8,9,10, or 11 continuous nucleotides.In some embodiments,
(n6-7) it is 6 or 7 continuous nucleotides.In some embodiments, (n11-21) it is 16,17 or 18
Individual continuous nucleotide, wherein the number of unpaired nucleotides is less than 6,5,4,3,2 or 1 pairs,
It is preferred that all unpaired nucleotides is in (n1) around, form ring structure；In some embodiments,
The length of the stem structure is 10-18 to pairing nucleotides, including such as 10 pairs, 11 pairs, 12 pairs,
13 pairs, 14 pairs, 15 pairs, 16 pairs, 17 pairs, 18 pairs of pairing nucleotides；The ring structure includes
1-13 nucleotides, including such as 1,2,3,4,5,6,7,8,9,10,11,12,13
Individual nucleotides.In some embodiments, (n0-2) can overhang (overhang) for 3' ends, it can be with
It is such as UU.In some embodiments, the 3' ends, which are overhang, can for example promote Ago2 combination.
In some embodiments, miRancer molecules can additionally comprise the combination for promoting Ago2 at 3' ends
Sequence, such as HDV ribozymes, it can promote the removal of 3' sections of additional sequences of RNA molecule, production
Raw short 3' ends are overhang, so as to promote RNA molecule and Ago2 combination (see, for example, Renfu
Shang et al., NATURE COMMUNICATIONS, 6:8430, its full text is by quoting simultaneously
Enter herein).
In some embodiments, single stranded RNA sequence such as miRancer molecules are wrapped from 5' ends to 3' ends
Molecule containing formula 2 below or the molecular composition by the formula 2：
(n7-9)(n2)(n7)(n1)(n16-18),
Wherein n is continuous nucleotides or its analog, and numeral is nucleotides or its analog thereafter
Number, wherein n1The primary nucleotides in 5' ends (being typically U) with target microRNA is complementary,
Corresponding n7Corresponding to target microRNA from 5' ends to 2-8 of 3' ends, wherein n2For insertion
C or G between the 5' end arms and 3' end arms formed GC match.In some embodiments,
(n7) with target microRNA 2-8 at least 50% from 5' ends to 3' ends, 60%, 70%, 80%,
90% or 100% is complementary.In some embodiments, (n7) with target microRNA from 5' ends to
The 2-8 complete complementaries at 3' ends.In some embodiments, close to (n1) around (including (n1)
It is interior) 1,2,3,4,5,6,7,8,9,10,11,12 or 13 nucleotides formation ring；
For example, in (n1) 5' ends and 3' ends respectively have 1,2,3,4,5 or 6 nucleotides formation 5' ends and
3' end arms, it is not complementary between the 5' ends and 3' end arms, so as to form ring.In some embodiments,
In (n1) 5' ends and 3' ends respectively there is 1,2,3,4,5 or 6 nucleotides formation 5' ends and 3' end arms,
It is not complementary between the 5' ends and 3' end arms, so as to form ring, without formed ring remaining nucleotides it
Between it is at least 50%, 60%, 70%, 80%, 90% or 100% complementary, form stem.In some realities
Apply in scheme, in (n1) 5' ends and 3' ends respectively have 1,2,3,4,5 or 6 nucleotides formed
5' ends and 3' end arms, it is not complementary between the 5' ends and 3' end arms, so that ring is formed, without forming ring
Remaining nucleotides between it is 100% complementary, form stem.
Provided herein is miRancer can be a kind of oligonucleotides.Term " oligonucleotides " refers to
The molecule of the nucleotides formation two or more by being covalently attached.Term oligonucleotides generally includes few core
Glycosides, oligonucleotide analogs, oligonucleotide mimetic and these chimeric combination.When refer to nucleotides or
During sequence monomer, it can be with base sequence, such as, for example, A, T (or U), G or C or its class
Like the sequence of thing.
Herein " nucleotides " it is used herein refer to comprising sugared structure division, base structure part and
The glucosides of the group (linking group between such as phosphoric acid or phosphorothioate nucleotides) of covalent attachment, and wrap
Include naturally occurring nucleotides (such as DNA or RNA) and the sugar comprising modification and/or base structure portion
The non-naturally occurring nucleotides divided, it is also referred to as " nucleotide analog ".Non-natural
The nucleotides of presence includes sugared structure division (such as two ring nucleosides acid or the nucleosides of 2 ' modifications with modification
Acid, such as 2 ' substitution nucleotides) nucleotides." nucleotide analog " is naturally occurring nucleosides
Sour (such as DNA or RNA nucleotides) is produced using the modification in sugar and/or base structure part
Variant.Analog can not have functional impact or with functional impact to the oligonucleotides.
For example, by producing for the increased binding affinity of target and/or increased to intracellular nucleic acid enzyme
Resistance and/or increased transporte to cells in easiness.In some embodiments, it is described
MiRancer molecules include 1,2,3 or more nucleotide analogs.In some embodiment party
In case, the oligomer includes 3-8 nucleotide analog, such as 6 or 7 nucleotide analogs.
In some embodiments, the nucleotide analog includes locked nucleic acid (LNA).For example, described
1 in nucleotide analog, 2,3 or more nucleotide analogs can be LNA.
The RNA molecule of modification defined herein can contain nucleotide analog/modification, such as skeleton
Modification, sugar-modified or base modification.Backbone modification can be the nucleotide backbone included in nucleic acid molecules
Phosphate it is chemical.The bound phosphate groups of the modification skeleton of modification can be replaced by using different substituents
Modified for one or more oxygen atoms, the example includes such as thiophosphate.It is sugar-modified to be
The sugared chemical modification of the nucleotides of nucleic acid molecules, for example, 2' hydroxyls (OH) can be by many different "
Epoxide " or " " substituent is modified or substituted for deoxidation.Base modification can be the alkali of the nucleotides of nucleic acid molecules
The chemical modification of base section.Nucleotide analog or modification can be selected from the core suitable for transcription and/or translation
Thuja acid analog.Nucleotide analog/modification can include 2- amido-6-chloropurine nucleosides -5'- triphosphoric acids
Ester, 2'- amino -2'- deoxycytidines-triguaiacyl phosphate, 2'- fluorothymidine -5'- triguaiacyl phosphates, 5- methylcytidines -5'-
Triguaiacyl phosphate, 5- bromine cytidine-5'-triphosphate esters, 7- goes azepine-adenine -5'- triguaiacyl phosphates, and pseudouridine -5'-
Triguaiacyl phosphate etc..The nucleosides of modification can include pyridine -4- ketone ribonucleotide, 5- azepines-uridine, dihydro
Pseudouridine, 2- is thio-dihydrouridine, 2,6- diaminopurines, N2, N2- dimethylguanosines, N1-
Methyl-pseudouridine, 5,6- dihydrouridines, 4- is thio-uridine, 5- hydroxyls-uridine, deoxidation-thymidine, flesh
Glycosides, α-thio-guanosine, 6- methyl-guanosines, 5- Methyl-Cytidines, 8- oxo-guanosines, 7- goes azepine-bird
Glycosides, N1- methyl-adenosine, the chloro- purine of 2- amino -6-, false iso- cytidine, the chloro- purine of 6- etc..
Provided herein is miRancer molecules can include or be total up to 25,26,27,28 by length,
29、30、31、32、33、34、35、36、37、38、39、40、41、42、43、44、
45th, 46,47,48,49,50 continuous nucleotide sequence compositions.In some embodiments,
The oligonucleotides include or by length altogether be about 30-45, such as about 33-40, such as about
33-37, such as about 33-35 continuous nucleotide sequence composition.In some embodiments, originally
The described oligonucleotides of invention is made up of no more than 40 nucleotides, such as no more than 38 nucleotides,
Such as no more than 34 nucleotides, such as 33,35 or 37 nucleotides.
2. composition
Provided herein is the method and composition for including miRancer molecules, the miRancer is when thin
MicroRNA activity can be strengthened when being expressed in born of the same parents.Such method and composition is expressed comprising miRancer
Carrier." miRancer expression vectors " refers to the carrier for including miRancer molecules, and it has coding
MiRancer polynucleotide sequence.MiRancer expression vectors are designed to produce from the carrier
MiRancer molecules.
" microRNA " or " miRNA " refers to few ribonucleic acid, and length is about 18 in general
To about 25 nucleotides, it regulates and controls the expression of the polynucleotides comprising target sequence.MicroRNA is non-
Encoding histone RNA, has been accredited in animal and plant.It is many that microRNA is initially transcribed into length
The RNA of polyadenylation, is then processed to form with the shorter sequence for forming stable hair clip ability.
Most of microRNA genes synthesize pri-miRNA in the presence of RNA polymerase II.Thin
Pri-miRNA is sheared through Drosha enzymes in karyon, forms about 70nt loop-stem structure, i.e.,
pre-miRNA.Then, pre-miRNA shears generation microRNA in the presence of Dicer enzymes
Single-stranded structure, forms maturation microRNA.
3.miRancer expression vectors
Provided herein is miRancer expression vectors.MiRancer expression vectors expression vector includes energy quilt
The polynucleotides of miRancer sequences are transcribed into, the miRancer sequences can strengthen microRNA
Activity.
In some embodiments, the miRancer expression vectors are provided and formed with similar hair
Press from both sides the miRancer molecules of RNA structures.In some embodiments, the miRancer molecules
MicroRNA molecule can be stablized, so as to adjust the expression activity of the microRNA target genes.
The miRNA can derive from any animal or plant.
In some embodiments, miRancer 5' end arms sequence and miRNA sequence are from the 2nd
The continuous nucleotide sequence of beginning can be 100%, at least 99%, 98%, 97%, 96%, 95%,
90%th, 85%, 80% or lower complementary sequence.In embodiments, miRancer 5' end arms
Sequence is included with continuous nucleotide sequence of the miRNA sequence since the 2nd ing with 1,2,3,4,
The sequence of 5 or more places mispairing, and still there is enough complementations and miRNA sequence formation double-strand knot
Structure, generates miRNA binding sequences and strengthens the activity of the microRNA.
By miRancer expression vector miRancer molecules, and with complementary enough with microRNA
Sequence.Refer to that its complementarity makes enough with " the complementary sequence enough " of microRNA target sequences
MiRancer molecules are obtained to be combined with microRNA and increase the activity of the microRNA.Specific
Embodiment in, with can be with microRNA target sequences with target sequence complementary miRancer enough
Have the sequence of 100% complementation or can be had with target sequence and be less than 100% complementary sequence (i.e. at least
99%th, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70% or lower
Complementary sequence).In other embodiments, miRancer and target sequence can have 1,2,3,4,
Mispairing at 5 or at most 6, as long as miRancer with target sequence there is enough complementations to increase target sequence
Activity such as half-life period.
In some embodiments, miRNA sequence can have " U " positioned at 5' ends.Optionally,
A pair of base-pair changes can be added in miRNA 5' ends, so that the sequence is differed with target sequence
One nucleotides.
" target sequence " refers to the sequence for designing the microRNA that miRancer is targetted.Target sequence
Can be endogenous sequence, or the heterologous sequence that can be introduced into.
The miRancer produced by miRancer expression vectors can increase microRNA activity.
Include measuring the expression of the genes/proteins of its targeting for determining microRNA active method
Change.In some embodiments, single miRNA can be in silence albumen and/or gene family
Multiple albumen/genes or whole albumen and/or gene family.
" increase " represent relative to microRNA normal levels in wild-type organisms (or
MicroRNA targeting genes/proteins level) increase.Pass through " increase miRancer activity "
Can increase the conspicuousness quantity in expression activity to any statistical significance, such as relative to wild type
Expression activity increase at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%,
50%th, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.
MiRancer molecules as described herein, which can be delivered to animal such as mammal, includes people or plant
In one or more in thing cell.
4. encode the polynucleotides and preparation method of miRancer expression vectors
Provided herein is separation or reorganization body polynucleotides, its encode miRancer expression vectors,
The various components of miRancer expression vectors, together be processed to miRancer miRancer express
The different products of carrier.
Polynucleotides can be RNA or DNA polymer, and they can be single-stranded or double-stranded, appoint
Selection of land includes synthesis, non-natural or modified nucleotide base.DNA polymer forms it is many
Nucleotides can be by one or many of cDNA, genomic DNA, synthetic DNA or their mixture
Individual fragment is constituted.Polynucleotides may include ribonucleotide and ribonucleotide and dezyribonucleoside
The combination of acid.It is similar with synthesis that the deoxynucleotide includes naturally occurring molecule with ribonucleotide
Thing.Polynucleotides of the present invention are also covered by the sequence of form of ownership, including but not limited to single stranded form,
Double chain form, hairpin structure, loop-stem structure etc..
Provided herein is composition can comprising separation or substantially purified polynucleotides." separation "
Or " purifying " polynucleotides, be substantially or essentially without those in naturally occurring environment just
Often with polynucleotides or the free components interacted therewith.Therefore, separation or purified multinuclear
Thuja acid substantially free of other cellular materials or when by recombinate body technique produce when culture medium or
Substantially free of the precursor or other chemical substances when by chemical synthesis.In some embodiment party
In case, day in the biological genomic DNA that " separation " polynucleotides are derived from without polynucleotides
So it is present in the sequence of the polynucleotides both sides (that is, positioned at 5' the and 3' ends of the polynucleotides).
Additionally provide the recombination of polynucleotide comprising miRancer expression vectors and its different component.Weight
Regulation and control and volume that combination such as non-natural of the group carrier comprising artificial or heterologous nucleotide sequence coexists
Code sequence.In other embodiments, recombinant vector can include the regulating and controlling sequence from separate sources
And coded sequence, or the regulation and control sequence from identical source but to be arranged different from naturally occurring mode
Row and coded sequence.The carrier can be used by itself or may be used in conjunction with a vector.If using carrier,
Then the selection of carrier depends on the method to convert host cell.Plasmid vector can for example be used.
In order to successfully convert, screen and breed the host cell for including any separating acid fragment of the invention,
The genetic elements that can be included on carrier.Therefore in order to obtain the desired expression of display and pattern
Cell line, can be analyzed, the Western blotting of rna blot analysis, protein expression divides by southern blotting technique
Analysis or phenotypic analysis etc. are screened.
In specific embodiments, one or more miRancer expression vectors as described herein can
There is provided and expressed in different cell types in expression cassette form.The box may include 5' and 3' regulating and controlling sequences,
Its by operationally with provided herein is polynucleotides be connected.In the 5'-3' directions of transcription, the table
Up to box may include transcription and translation sintering (i.e. promoter), recombination of polynucleotide provided in this article,
And transcription and translation terminator (i.e. terminator).
Many promoters can be used for provided herein is miRancer expression vectors.By in miRancer
In expression vector use different promoters, can adjust miRancer expression time, position and/
Or level.If desired, miRancer expression vectors (such as can be assigned and lured containing promoter regulatory region
Conductivity type, composing type, environment or growth adjustment or cell or tissue specificity/selective expression
Regulatory region), transcription initiation starts site, ribosome bind site, RNA processing signals, transcription eventually
Stop bit point and/or polyadenylation signal.
5. the method imported
Provided herein is method include by miRancer expression vectors import cell, to improve target
MicroRNA activity.Provided herein is method be limited to ad hoc approach, as long as entering polynucleotides
The inside of at least one cell of host.The method that polynucleotides are imported in host cell is this
Known to field, including but not limited to virus-mediated method.Importing includes referring to enter nucleic acid integration very
In core or prokaryotic, it can be integrated into the cell amplifying nucleic acid in the genome of cell, and including referring to
Nucleic acid or albumen are supplied to cell.Conversion scheme and for by polynucleotide sequence introduced plant
Scheme can be changed according to the type for being converted cell.
6. application method
Increase the side of microRNA activity there is provided by the way that miRancer expression vectors are imported into cell
Method.Provided herein is method include by miRancer expression vectors import cell, wherein by miRancer
The miRancer molecules that expression vector is produced, it can increase microRNA and/or change (as increased
Or reduction) microRNA targeting gene activity.In some embodiments, can be by
MiRancer molecules be incorporated into the gene that target microRNA in genome is targetted regulatory region (including
The region such as 5'UTR and/or 3'UTR and/or upstream region of gene, downstream, introne) to adjust base
The expression of cause.In some embodiments, provided herein is miRancer molecules can increase
The gene expression of the gene of microRNA targetings, this is very surprising, because it has generally been thought that
MicroRNA effect is to reduce the expression of gene.In some embodiments, provided herein is
MiRancer molecules can change target microRNA effect (for example, target microRNA drops
The expression of lower gene, then, by by provided herein is miRancer molecules or carrier introduce
To the regulatory region of the gene so that target microRNA increases the expression of gene).In some realities
Apply in scheme, phase can be related to by the corresponding microRNA of the target gene for expecting regulation
The miRancer molecules answered, so as to adjust the expression for the target gene for expecting to change its expression.
7. active variant
The active variant for the polynucleotides applied in composition and method is also provided herein." variant "
Refer to substantially similar sequence.For polynucleotides, variant be included in one of polynucleotides or
Multiple internal sites have missing and/or the insertion of one or more nucleotides, and/or in polynucleotides
One or more sites have the displacements of one or more nucleotides.Variant polynucleotides may include synthesis
The polynucleotides in source, such as those for example generated by direct mutagenesis.In general, this paper institutes
Disclosed miRancer expression vectors, single strand RNA molecule, miRancer molecules, with prototype multinuclear
Thuja acid have at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%,
93%th, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.For
The sequence alignment method of comparison is well known in the art.Aligned sequences, the program for determining sequence identity
Including CLUSTAL, GAP, BESTFIT, BLAST, FASTA and TFASTA etc..Can be with
The comparison using these programs is carried out using default parameters.
8. target microRNA molecule
In some embodiments, the target microRNA that this paper miRancer can be acted on is not
It is particularly limited.For example, the target microRNA for wishing to be conditioned can be selected from existing database
Molecule.In some embodiments, can be according to corresponding to the gene selects for wishing regulation
MicroRNA molecule.Furthermore it is possible to by bioinformatics method (for example using miRanda,
The programs such as TargetScan, RNAhybrid) find the gene that microRNA is targetted.
This paper miRancer molecules can improve described by being combined with target microRNA molecule
MicroRNA activity.In some embodiments, when hybridizing with target microRNA molecule,
The oligonucleotides can be resistant to 1,2,3 or 4 (or more) mispairing, and still with it is described
Target is fully combined, with the effect (for example, improving the activity of the microRNA) indicated a need for.
For example, mispairing can by the nucleotides sequence column memory increase length oligonucleotide sequence and/
Or increased number of nucleotide analog (such as locked nucleic acid (LNA)) and be compensated.In some realities
Apply in scheme, when hybridizing with target microRNA molecule, the continuous nucleotide sequence is included
No more than 3 mispairing (for example, no more than 1 or no more than 2 mispairing).In some embodiment party
In case, when hybridizing with target microRNA molecule, the continuous nucleotide sequence, which is included, not to be surpassed
Cross a mispairing.
The miRancer molecules of the present invention are preferably with microRNA molecule in complementary region at least 80%
Complementation, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%,
At least 95%, at least 96%, at least 97%, at least 98%, at least 99%, such as at least 100%
It is complementary.
In some embodiments, the miRancer can comprising 5 ' or 3 ' other nucleotides or
Modification, such as, independently 1,2,3,4 or 5 other nucleotides 5 ' and/or 3 ', its with
Target sequence is not complementary.In this regard, in some embodiments, oligonucleotides of the invention can be with
Connect the continuous nucleotide sequence of other nucleotides included in 5 ' and/or 3 ' sides.In some embodiments
In, 5 ' or 3 ' the other nucleotides are naturally occurring nucleotides, such as DNA or RNA.
In some embodiments, 5 ' or 3 ' the other nucleotides can be nucleotide analog.It is complementary
Area can include 2-12,2-13 of microRNA molecule, 2-14,2-15,2-16,2-17,
2-18.
9. pharmaceutical composition
MiRancer molecules, carrier, the cell of the present invention can be used in pharmaceutical preparation and composition,
Also the kit of convenient application can be prepared into.Suitably, the composition or kit are comprising medicinal molten
Agent, such as water or salt solution, diluent, carrier, salt or adjuvant.
Present invention additionally comprises the pharmaceutical composition of the oligonucleotides containing the present invention and preparation.The present invention's
Pharmaceutical composition can be applied in many ways, depending on needing local treatment or systematic treating,
And depending on region to be treated.
10. application
The oligonucleotides of the present invention may be used as investigational agent, for example, for diagnosing, treating and preventing.
Under study for action, the oligonucleotides can be used for specifically binding target microRNA, can increase
Its activity, thus promotes to the functional selection of target or it is commented as the target of Results
Estimate.
In diagnosticum, the oligonucleotides can be used for by RNA traces, in situ hybridization or phase
As technology come detect and quantify in cell organize in target microRNA levels.
For therapeutic agent, suspect with can be by the table of the gene for adjusting target microRNA targetings
Can be by applying few nucleosides of the present invention up to the disease treated or the animal of illness or people
Acid is treated.Treatment suspection is further provided for suffer from or tend to suffer from and target microRNA targets
To gene the related disease of expression or illness mammal (such as treatment people) method, it is described
Pass through the one or more that effective dose is treated or prevented by applying oligonucleotides of the invention or combination
Thing.Oligonucleotides of the present invention or pharmaceutical composition are typically applied with effective dose.
The present invention also provides the method for treating disease such as tumour, and methods described is including being there is this needs
Patient apply oligonucleotide molecules as described herein or include the pharmaceutical composition of the molecule.
11. experimental result
Reagent and material
The cell line used in testing below is MCF-7 human breast cancer cell lines, is purchased from ATCC, is cultivated
Base is RPMI-1640, is purchased from Gibco, and hyclone FBS is purchased from Gibco.Transfection reagent is
Lipofectamine 2000, is purchased from invitrogen. plasmid pSilencer 4.1CMV and is purchased from Ambion
Company, plasmid psiCheck2 and Dual-Luciferase detection kit are purchased from promega companies.Primer
Synthesis is completed by Shanghai life work, and mimics synthesis is completed by the lucky agate in Shanghai.
Recombinant plasmid clone method is conventional method, and sequencing is completed by Shanghai life work, and details is hereinafter
Illustrate.
Dual-Luciferase reporter assay is carried out according to kit (Promega E1910) specification.
Experimentation
1. it is designed with the microRNA binding sequences of higher structure.
First, microRNA binding sequence is designed to the single stranded RNA of similar hairpin structure,
Hairpin structure 5' end arms is combined by base pair complementarity with microRNA, and 3' end arms then passes through alkali
Base complementary pairing is combined with 5 ' end arms.In order to prevent Dicer1 processing and similar siRNA effects hair
Occur, the length of double-strand preferably is within 18 nucleotides.
Then, 7nt or 13nt ring structure is introduced respectively in the corner of hairpin structure, to determine
The potential function that different structure may be brought.
After again, insert two couples of GC to stablize RNA secondary structures at the middle part of hair fastener ring structure.
Finally, a linear microRNA binding sequence is also devised as negative control.
So, 8 kinds of various forms of exemplary microRNA binding sequences have just been obtained (with miR-7
Exemplified by miR-9).Fig. 1 shows the multi-form of miR-7 binding sequences；Fig. 2 shows miR-9
The multi-form of binding sequence.
2. prepare expression vector.
From expression vector of the pSilencer 4.1CMV plasmids as small hairpin RNA.Plasmid passes through
After BamHI and HindIII double digestions, separated with 1% agarose gel, then use Axyprep DNA
Extraction kit (AP-GX-50) are reclaimed, and deposit in -20 DEG C.
3. prepare insetion sequence.
Following DNA sequence dna is synthesized：
MiR-7 binding sequences A is positive:
GATCCAAAATCACTAGTCTTCCAGGAAGACTAGTGATTTTA
MiR-7 binding sequences A is reverse:
AGCTTAAAATCACTAGTCTTCCTGGAAGACTAGTGATTTTG
MiR-7 binding sequences B is positive:
GATCCAAAATCACTAGTCTTCCACCTAGACTAGTGATTTA
MiR-7 binding sequences B is reverse:
AGCTTAAAATCACTAGTCTAGGTGGAAGACTAGTGATTTTG
MiR-7 binding sequences C is positive:
GATCCAAAATCACTAGTCTTCCACCTTCTCTAGTGATTTTA
MiR-7 binding sequences C is reverse:
AGCTTAAAATCACTAGAGAAGGTGGAAGACTAGTGATTTTG
MiR-7 binding sequences D is positive:
GATCCAAAATCACTAGTCTTCCAA
MiR-7 binding sequences D is reverse:
AGCTTTGGAAGACTAGTGATTTTG
MiR-7 binding sequences E is positive:
GATCCAATCACTACCGTCTTCCAGGAAGACGGTAGTGATTA
MiR-7 binding sequences E is reverse:
AGCTTAATCACTACCGTCTTCCTGGAAGACGGTAGTGATTG
MiR-7 binding sequences F is positive:
GATCCAATCACTACCGTCTTCCACCTAGACGGTAGTGATTA
MiR-7 binding sequences F is reverse:
AGCTTAATCACTACCGTCTAGGTGGAAGACGGTAGTGATTG
MiR-7 binding sequences G is positive:
GATCCAATCACTACCGTCTTCCACCTTCTCGGTAGTGATTA
MiR-7 binding sequences G is reverse:
AGCTTAATCACTACCGAGAAGGTGGAAGACGGTAGTGATTG
MiR-7 binding sequences H is positive:
GATCCAATCACTACCGTCTTCCAA
MiR-7 binding sequences H is reverse:
AGCTTTGGAAGACGGTAGTGATTG
MiR-9 binding sequences A is positive:
GATCCCAGCTAGATAACCAAAGACTTTGGTTATCTAGCTGA
MiR-9 binding sequences A is reverse:
AGCTTCAGCTAGATAACCAAAGTCTTTGGTTATCTAGCTGG
MiR-9 binding sequences B is positive:
GATCCCAGCTAGATAACCAAAGAGAATGGTTATCTAGCTGA
MiR-9 binding sequences B is reverse:
AGCTTCAGCTAGATAACCATTCTCTTTGGTTATCTAGCTGG
MiR-9 binding sequences C is positive:
GATCCCAGCTAGATAACCAAAGAGAAACCTTATCTAGCTGA
MiR-9 binding sequences C is reverse:
AGCTTCAGCTAGATAAGGTTTCTCTTTGGTTATCTAGCTGG
MiR-9 binding sequences D is positive:
GATCCCAGCTAGATAACCAAAGAA
MiR-9 binding sequences D is reverse:
AGCTTTCTTTGGTTATCTAGCTGG
MiR-9 binding sequences E is positive:
GATCCGCTAGATACCACCAAAGACTTTGGTGGTATCTAGCA
MiR-9 binding sequences E is reverse:
AGCTTGCTAGATACCACCAAAGTCTTTGGTGGTATCTAGCG
MiR-9 binding sequences F is positive:
GATCCGCTAGATACCACCAAAGAGAATGGTGGTATCTAGCA
MiR-9 binding sequences F is reverse:
AGCTTGCTAGATACCACCATTCTCTTTGGTGGTATCTAGCG
MiR-9 binding sequences G is positive:
GATCCGCTAGATACCACCAAAGAGAAACCTGGTATCTAGCA
MiR-9 binding sequences G is reverse:
AGCTTGCTAGATACCAGGTTTCTCTTTGGTGGTATCTAGCG
MiR-9 binding sequences H is positive:
GATCCGCTAGATACCACCAAAGAA
MiR-9 binding sequences H is reverse:
AGCTTTCTTTGGTGGTATCTAGCG
These DNA sequence dnas are annealed in 1 × TE buffer by following program in pairs：
95℃ 2min
touch down at 0.1℃every 8s
4℃ 30min
DNA sequence dna after annealing connects the BamHI and HindIII into pSilencer 4.1CMV plasmids
Between, the kit used is TAKARA ligation kit (D6022).Recombinant plasmid passes through sequencing
Confirm that sequence is correct.
4. prepare microRNA report carriers.
MicroRNA binding site is inserted between the XhoI and NotI of psi-CHECK2 plasmids
To obtain microRNA report carriers.Fig. 3 shows miR-7reporter and miR-9reporter
Schematic diagram.
5. luciferase reporting tests
Into MCF-7 cells, cotransfection miR-7 binding sequences and miR-7reporter, are then pressed
Dual-Luciferase reporter assay (Promega E1910) has been done as directed.Fig. 4 shows overexpression
The uciferase activity of miR-7reporter or miR-9reporter after miRancers.*,p<0.05,
**,p<0.01by Student's t-test.
Selection F types can strengthen the microRNA binding sequences of microRNA activity as preferred.
All sequences that can strengthen microRNA activity are referred to as microRNA enhancers, referred to as
miRancers.
6. optimize miRancer structures
Using F types as prototype, continue to grope suitable miRancer structures, by shortening or extending
MiRancer Stem plot structures, have obtained containing 15bp (miR-7 binding sequence F1) or 13bp
The hairpin structure of (miR-7 binding sequence F2), as a result shows, the two still can work.
Fig. 5 shows the miR-7 binding sequence schematic diagrames of different stem lengths.Fig. 6 displays are overexpressed different stem lengths
MiR-7reporter uciferase activity * *, p after miRancers<0.01by Student's t-test.
7. chemical synthesis miRancers.
And then miRancer (Shanghai Ji agate) has chemically been synthesized according to F types.For in drosophila
Bantam miRNA design miRancer be used as control.Inventor has found chemical synthesis
MiRancers can also specifically influence microRNA activity and level.Fig. 7 displays are overexpressed
MiR-7reporter or miR-9reporter uciferase activity after miRancer.**,p<0.01
By Student's t-test. Fig. 8 displays are overexpressed the expression of miR-7 or miR-9 after miRancer.
* *, p<0.001by Student's t test.
8.miRancer motif enhancing gene expressions
MiRancer-7, miR-7sponge, miRancer-9 are inserted respectively in luciferase upstream,
MiR-9sponge, is then total to miR-7mimics, miR-9mimics (Shanghai Ji agate) respectively
Transfection, it is found that the luciferase containing miRancer can be stable by corresponding miRNA, and contains
The luciferase for having sponge is then suppressed by corresponding miRNA.This explanation miRancer can be used
To strengthen the expression of gene.Fig. 9 shows the luciferase report containing miRancer or sponge sequences
Accuse carrier schematic diagram.Figure 10 displays are overexpressed miR-7 or miR-9 to different uciferase activities
Influence.*, p<0.05,**,p<0.01,***,p>0.001by Student’s t test.
Claims (10)
1. a kind of combining target microRNA single stranded RNA sequence, the single stranded RNA sequence
With 5' end arms and 3' end arms, the 5' end arms is tied by base pair complementarity and target microRNA
Close, the 3' end arms is combined by base pair complementarity with the 5' end arms,
The single stranded RNA sequence has formula 1 below from 5' ends to 3' ends：
(n5-11)(n0-3)(n6-7)(n1)(n11-21)(n0-2),
Wherein n is continuous nucleotides or its analog, and numeral is nucleotides or its analog thereafter
Number, wherein n1With the target microRNA primary nucleotide complementary in 5' ends, corresponding n6-7
Corresponding to target microRNA from 5' ends to 2-7 or 2-8 of 3' ends, so that
(n5-11)(n0-3)(n6-7) it is 5' end arms, (n11-21)(n0-2) it is 3' end arms, wherein n0-3For the C or G of insertion
To form GC pairings between the 5' end arms and 3' end arms.
2. the single stranded RNA sequence described in claim 1, wherein except the (n of insertion0-3) it is used as breach
Do not calculate outside homogeneity, the 5' end arms and the target microRNA from 5' ends to 3' ends the
The complementary strand of 2-18 nucleotides at least 50%, 60%, 70%, 80%, 90% or 100% it is same
One property, preferably wherein (n6-7) and the target microRNA 2-7 from 5' ends to 3' ends or the
The complementary strand of 2-8 nucleotides has at least 80%, 90% or 100% homogeneity, preferably (n11-21)
With (n5-11)(n0-3)(n6-7) in unpaired nucleotides number be less than 6,5,4,3,2 or 1 pairs, it is excellent
The whole unpaired nucleotides of choosing are in (n1) around.
3. a kind of carrier for including single stranded RNA sequence described in claim 1 or 2, such as plasmid.
4. a kind of polynucleotide sequence for including single stranded RNA sequence described in coding claim 1 or 2
Carrier, such as plasmid.
5. a kind of RNA molecule for including the synthesis of single stranded RNA sequence described in claim 1 or 2.
6. a kind of cell of the carrier comprising claim 3 or 4.
7. the single stranded RNA sequence of claim 1 or 2, the carrier of claim 3 or 4 or power
Profit requires the purposes of the RNA molecule of 5 synthesis, and the purposes includes endogenous for specificity increase
Expression and/or the activity of property and/or exogenous target microRNA or other tiny RNAs, for external
And/or the expression of the gene of the target microRNA targetings of specificity regulation in vivo, as receptor
For sensing the target microRNA or other tiny RNAs, and for by sensing the target
MicroRNA or other tiny RNAs are small so as to adjust the target microRNA or other
RNA target to gene expression.
8. a kind of method, methods described includes being used for specificity increase endogenous and/or exogenous target
The expression of microRNA or other tiny RNAs and/or the method for activity, for external and/or internal spy
The method of the expression of the gene of the opposite sex regulation target microRNA targetings, is used for as receptor
The method for sensing the target microRNA or other tiny RNAs, and for by sensing the mesh
Mark microRNA or other tiny RNAs are small so as to adjust the target microRNA or other
RNA target to gene expression, methods described includes the single stranded RNA of claim 1 or 2
The RNA molecule of the synthesis of sequence, the carrier of claim 3 or 4 or claim 5 with comprising
The step of sample of target microRNA or other tiny RNAs is contacted.
9. a kind of method for the single stranded RNA sequence for producing combining target microRNA, methods described
Single stranded RNA sequence including producing the combining target microRNA described in claim 1 or 2.
10. a kind of composition or kit, its single stranded RNA sequence comprising claim 1 or 2,
The carrier of claim 3 or 4, and/or the RNA molecule of the synthesis of claim 5, institute preferably
Stating composition or kit is used for the purposes described in claim 7 or the method described in claim 8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610084172.0A CN107034216A (en) | 2016-02-04 | 2016-02-04 | The design and application of miRancer molecules |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610084172.0A CN107034216A (en) | 2016-02-04 | 2016-02-04 | The design and application of miRancer molecules |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107034216A true CN107034216A (en) | 2017-08-11 |
Family
ID=59532203
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610084172.0A Pending CN107034216A (en) | 2016-02-04 | 2016-02-04 | The design and application of miRancer molecules |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107034216A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102027113A (en) * | 2008-02-27 | 2011-04-20 | 朱利叶斯·马克西米利安-维尔茨堡大学 | MicroRNA (MIRNA) and downstream targets for diagnostic and therapeutic purposes |
| CN102181482A (en) * | 2011-01-25 | 2011-09-14 | 中山大学 | Method for rapidly regulating activity of endogenous miRNA in rice |
| CN102851291A (en) * | 2006-04-03 | 2013-01-02 | 桑塔里斯制药公司 | Pharmaceutical composition comprising anti-mirna antisense oligonucleotides |
-
2016
- 2016-02-04 CN CN201610084172.0A patent/CN107034216A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102851291A (en) * | 2006-04-03 | 2013-01-02 | 桑塔里斯制药公司 | Pharmaceutical composition comprising anti-mirna antisense oligonucleotides |
| CN102027113A (en) * | 2008-02-27 | 2011-04-20 | 朱利叶斯·马克西米利安-维尔茨堡大学 | MicroRNA (MIRNA) and downstream targets for diagnostic and therapeutic purposes |
| CN102181482A (en) * | 2011-01-25 | 2011-09-14 | 中山大学 | Method for rapidly regulating activity of endogenous miRNA in rice |
Non-Patent Citations (1)
| Title |
|---|
| LIAN HE等: "Efficient and specific inhibition of plant microRNA function by anti-microRNA oligonucleotides (AMOs) in vitro and in vivo", 《PLANT CELL REP》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107454843B (en) | Pharmaceutical composition for treating cancer comprising microribonucleic acid as active ingredient | |
| JP5383186B2 (en) | Nucleic acid agents that down-regulate H19 and methods of using the same | |
| Boudreau et al. | Generation of hairpin-based RNAi vectors for biological and therapeutic application | |
| US8497364B2 (en) | Triggered RNAi | |
| JP6486836B2 (en) | Artificial mimic miRNA for gene expression control and use thereof | |
| KR20150006477A (en) | Bi-functional short-hairpin rna (bi-shrna) specific for single-nucleotide kras mutations | |
| WO2008106658A2 (en) | TRIGGERED RNAi | |
| AU2015249265A1 (en) | Multiple targeted RNAi for the treatment of cancers | |
| JP2007530431A5 (en) | ||
| KR101390966B1 (en) | siRNA for inhibition of Hif1α expression and anticancer composition containing the same | |
| CN105247051A (en) | Organic compositions to treat EPAS1-related diseases | |
| TW201119681A (en) | Compositions and methods for inhibiting expression of KIF10 genes | |
| RU2385939C1 (en) | Genetic makers attacking six new rna interference targets in transcripts of human immunodeficiency virus type 1 and suppressing virus reproduction in human cells | |
| JP7050277B2 (en) | RNA molecule | |
| CN107034216A (en) | The design and application of miRancer molecules | |
| CN108245527A (en) | Pass through the method and drug of miR-1181 progress anticancers and its application | |
| EP2064328B1 (en) | Sensitization of cancer cells to therapy using sina targeting genes from the 1p and 19q chromosomal regions | |
| JP2022541212A (en) | SiRNA sequences targeting the expression of the human genes JAK1 or JAK3 for therapeutic use | |
| JP2022531580A (en) | Multiplexed shortn for use in vectors | |
| US11306310B2 (en) | MicroRNA inhibitor | |
| US20220251566A1 (en) | Cells engineered for oligonucleotide delivery, and methods for making and using thereof | |
| WO2017132945A1 (en) | Design and application of mirancer molecule | |
| CN111801418B (en) | Double-stranded miRNA-containing duplex oligonucleotide constructs and uses thereof | |
| GB2468477A (en) | Double stranded RNA molecule comprising siRNA and miRNA precursors | |
| JP2022062034A (en) | Rna action inhibitors and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170811 |
|
| WD01 | Invention patent application deemed withdrawn after publication |