CN107022600B - Primer combination for detecting 6 common food pathogenic bacteria and application thereof - Google Patents

Primer combination for detecting 6 common food pathogenic bacteria and application thereof Download PDF

Info

Publication number
CN107022600B
CN107022600B CN201610069658.7A CN201610069658A CN107022600B CN 107022600 B CN107022600 B CN 107022600B CN 201610069658 A CN201610069658 A CN 201610069658A CN 107022600 B CN107022600 B CN 107022600B
Authority
CN
China
Prior art keywords
primer
seq
group
sequence
iii
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610069658.7A
Other languages
Chinese (zh)
Other versions
CN107022600A (en
Inventor
张岩
刘铭
邢婉丽
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CapitalBio Corp
Original Assignee
CapitalBio Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CapitalBio Corp filed Critical CapitalBio Corp
Priority to CN201610069658.7A priority Critical patent/CN107022600B/en
Publication of CN107022600A publication Critical patent/CN107022600A/en
Application granted granted Critical
Publication of CN107022600B publication Critical patent/CN107022600B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a primer combination for detecting 6 common food pathogenic bacteria and application thereof. The primer combination consists of primer groups I, II, III, IV, V and VI. The primer group I consists of I-F3, I-B3, I-FIP, I-BIP, I-LF and I-LB, the primer group II consists of II-F3, II-B3, II-FIP, II-BIP, II-LF and II-LB, the primer group III consists of III-F3, III-B3, III-FIP, III-BIP, III-LF and III-LB, the primer group IV consists of IV-F3, IV-B3, IV-FIP, IV-BIP, IV-LF and LB-IV, the primer group V consists of V-F3, V-B3, V-FIP, V-BIP, V-LF and V-LB, the primer group VI-F3, VI-B3, VI-FIP, VI-BIP and LB-LB, the sequence is shown in sequence 1 to 36 in sequence, can be used for detecting enterobacter sakazakii, yersinia enterocolitica, shigella, bacillus cereus, vibrio vulnificus or campylobacter jejuni, and has great popularization value.

Description

Primer combination for detecting 6 common food pathogenic bacteria and application thereof
Technical Field
The invention relates to a primer combination for detecting 6 common food pathogenic bacteria and application thereof.
Background
Enterobacter sakazakii, Yersinia enterocolitica, Shigella, Bacillus cereus, Vibrio vulnificus and Campylobacter jejuni are common pathogenic bacteria in food, and are also important food-borne pathogenic bacteria. The enterobacter sakazakii is mainly used for infecting children through the digestive tract of infant formula milk powder to cause neonatal meningitis, septicemia and necrotizing colitis, and the mortality rate is 50-80%. The international food microbiology standards committee listed enterobacter sakazakii as a microorganism that produced serious life hazards or chronic sequelae to certain populations in 2002. Yersinia enterocolitica is a zoonosis pathogen, the host of the yersinia enterocolitica is mainly an animal, and the yersinia enterocolitica is also detected in foods such as meat, vegetables, dairy products, oysters, clams, shrimps and the like to cause diarrhea; shigella is the most common pathogenic bacterium causing acute infectious dysentery of human beings, commonly called shigella dysenteriae, human beings are infected and attacked mainly by eating food polluted by Shigella dysenteriae, and the main clinical characteristics of systemic poisoning symptoms and large intestine suppurative inflammation are that the shigella is fatal to infants and is an important food-borne pathogenic bacterium; bacillus cereus is a gram-positive bacillus, is very easy to pollute food to cause food poisoning, and particularly causes symptoms of vomiting and diarrhea in foods with rich protein and carbohydrate contents, such as meat, rice, dairy products, preserved beancurd, fish, roast chicken and the like; vibrio vulnificus, also called marine vibrio, is a bacterium inhabiting the sea, and if seafood polluted by the vibrio vulnificus is eaten, gastroenteritis is easily caused; campylobacter jejuni is a food-borne zoonotic pathogen. Its main host is poultry, which mainly causes acute enteritis and food poisoning in humans, and has replaced salmonella as one of the most common diarrheal pathogenic bacteria in some countries. Therefore, it is of great importance to control the contamination of food products, in particular chicken products, with campylobacter jejuni and to enhance the detection of campylobacter jejuni in food products.
The national standard method GB based on the traditional separation method is still the main basis for detecting 6 common food pathogenic bacteria by many detection organizations at present. Mainly comprises the steps of enrichment culture, plate separation, biochemical identification and the like. The detection method is complicated, the detection time is long, the sensitivity is low, missing detection and wrong detection are easy to occur, and the traditional detection method can not meet the requirement of rapid detection of the food at present. The application of the molecular detection technology developed in recent years, particularly the PCR technology, in the aspects of rapid identification and detection of microorganisms opens up a new way for rapid detection of food-borne pathogenic bacteria. However, PCR has disadvantages of long detection time, susceptibility to contamination, and high false positive rate, and thus its application is limited. A loop-mediated isothermal amplification (LAMP) technology is a sensitive, specific, simple and rapid nucleic acid amplification technology developed in recent years, and the principle is that under the action of DNA polymerase with strand displacement activity, 4-6 primers of 6-8 regions are identified, a target gene is rapidly and specifically amplified under an isothermal condition, and the LAMP technology can be popularized and applied to rapid and accurate detection of common food-borne microorganisms.
Disclosure of Invention
The invention aims to provide a primer combination for detecting 6 common food pathogenic bacteria and application thereof.
The primer combination provided by the invention is (a1), (a2) or (a 3):
(a1) the primer set I, the primer set II, the primer set III, the primer set IV, the primer set V and the primer set VI are combined;
(a2) any two, any three, any four or any five of the primer group I, the primer group II, the primer group III, the primer group IV, the primer group V and the primer group VI;
(a3) the primer group I, the primer group II, the primer group III, the primer group IV, the primer group V or the primer group VI;
the primer group I consists of a primer I-F3, a primer I-B3, a primer I-FIP, a primer I-BIP, a primer I-LF and a primer I-LB;
the primer I-F3 is (b1) or (b 2);
(b1) a single-stranded DNA molecule shown in sequence 1 of the sequence table;
(b2) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 1 and have the same functions as the sequence 1;
the primer I-B3 is (B3) or (B4);
(b3) a single-stranded DNA molecule shown in a sequence 2 of a sequence table;
(b4) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 2 and have the same functions as the sequence 2;
the primer I-FIP is (b5) or (b 6);
(b5) a single-stranded DNA molecule shown in sequence 3 of the sequence table;
(b6) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 3 and have the same functions as the sequence 3;
the primer I-BIP is (b7) or (b 8);
(b7) a single-stranded DNA molecule shown in a sequence 4 of the sequence table;
(b8) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 4 and having the same functions as the sequence 4;
the primer I-LF is (b9) or (b 10);
(b9) a single-stranded DNA molecule shown in sequence 5 of the sequence table;
(b10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 5 and having the same functions as the sequence 5;
the primer I-LB is (b11) or (b 12);
(b11) a single-stranded DNA molecule shown in sequence 6 of the sequence table;
(b12) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 6 and having the same functions as the sequence 6;
the primer group II consists of a primer II-F3, a primer II-B3, a primer II-FIP, a primer II-BIP, a primer II-LF and a primer II-LB;
the primer II-F3 is (c1) or (c 2);
(c1) a single-stranded DNA molecule shown in sequence 7 of the sequence table;
(c2) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 7 and having the same functions as the sequence 7;
the primer II-B3 is (c3) or (c 4);
(c3) a single-stranded DNA molecule shown in sequence 8 of the sequence table;
(c4) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 8 and have the same functions as the sequence 8;
the primer II-FIP is (c5) or (c 6);
(c5) a single-stranded DNA molecule shown in sequence 9 of the sequence table;
(c6) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 9 and has the same function as the sequence 9;
the primer II-BIP is (c7) or (c 8);
(c7) a single-stranded DNA molecule shown in sequence 10 of the sequence table;
(c8) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 10 and has the same function as the sequence 10;
the primer II-LF is (c9) or (c 10);
(c9) a single-stranded DNA molecule shown in sequence 11 of the sequence table;
(c10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 11 and having the same functions as the sequence 11;
the primer II-LB is (c11) or (c 12);
(c11) a single-stranded DNA molecule shown in sequence 12 of the sequence table;
(c12) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 12 and has the same function as the sequence 12;
the primer group III consists of a primer III-F3, a primer III-B3, a primer III-FIP, a primer III-BIP, a primer III-LF and a primer III-LB;
the primer III-F3 is (d1) or (d 2);
(d1) a single-stranded DNA molecule shown in sequence 13 of the sequence table;
(d2) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 13 and has the same function as the sequence 13;
the primer III-B3 is (d3) or (d 4);
(d3) a single-stranded DNA molecule shown as a sequence 14 in a sequence table;
(d4) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 14 and has the same function as the sequence 14;
the primer III-FIP is (d5) or (d 6);
(d5) a single-stranded DNA molecule shown in sequence 15 of the sequence table;
(d6) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 15 and having the same functions as the sequence 15;
the primer III-BIP is (d7) or (d 8);
(d7) a single-stranded DNA molecule shown as sequence 16 in the sequence table;
(d8) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 16 and having the same functions as the sequence 16;
the primer III-LF is (d9) or (d 10);
(d9) a single-stranded DNA molecule shown in sequence 17 of the sequence table;
(d10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 17 and having the same functions as the sequence 17;
the primer III-LB is (d11) or (d 12);
(d11) a single-stranded DNA molecule shown in sequence 18 of the sequence table;
(d12) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 18 and has the same function as the sequence 18;
the primer group IV consists of a primer IV-F3, a primer IV-B3, a primer IV-FIP, a primer IV-BIP, a primer IV-LF and a primer IV-LB;
the primer IV-F3 is (e1) or (e 2);
(e1) a single-stranded DNA molecule shown as sequence 19 in the sequence table;
(e2) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 19 and having the same functions as the sequence 19;
the primer IV-B3 is (e3) or (e 4);
(e3) a single-stranded DNA molecule shown in sequence 20 of the sequence table;
(e4) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 20 and having the same functions as the sequence 20;
the primer IV-FIP is (e5) or (e 6);
(e5) a single-stranded DNA molecule shown in sequence 21 of the sequence table;
(e6) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 21 and has the same function as the sequence 21;
the primer IV-BIP is (e7) or (e 8);
(e7) a single-stranded DNA molecule shown as a sequence 22 in a sequence table;
(e8) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 22 and having the same functions as the sequence 22;
the primer IV-LF is (e9) or (e 10);
(e9) a single-stranded DNA molecule shown as sequence 23 in the sequence table;
(e10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 23 and having the same functions as the sequence 23;
the primer IV-LB is (e11) or (e 12);
(e11) a single-stranded DNA molecule shown in sequence 24 of the sequence table;
(e12) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 24 and having the same functions as the sequence 24;
the primer group V consists of a primer V-F3, a primer V-B3, a primer V-FIP, a primer V-BIP, a primer V-LF and a primer V-LB;
the primer V-F3 is (F1) or (F2);
(f1) a single-stranded DNA molecule shown as sequence 25 in the sequence table;
(f2) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 25 and having the same functions as the sequence 25;
the primer V-B3 is (f3) or (f 4);
(f3) a single-stranded DNA molecule shown as a sequence 26 in a sequence table;
(f4) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 26 and has the same function as the sequence 26;
the primer V-FIP is (f5) or (f 6);
(f5) a single-stranded DNA molecule shown as sequence 27 in the sequence table;
(f6) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 27 and has the same function as the sequence 27;
the primer V-BIP is (f7) or (f 8);
(f7) a single-stranded DNA molecule shown as sequence 28 in the sequence table;
(f8) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 28 and having the same functions as the sequence 28;
the primer V-LF is (f9) or (f 10);
(f9) a single-stranded DNA molecule shown as sequence 29 in the sequence table;
(f10) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 29 and has the same function as the sequence 29;
the primer V-LB is (f11) or (f 12);
(f11) a single-stranded DNA molecule shown as a sequence 30 in a sequence table;
(f12) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 30 and has the same function as the sequence 30;
the primer group VI consists of a primer VI-F3, a primer VI-B3, a primer VI-FIP, a primer VI-BIP, a primer VI-LF and a primer VI-LB;
the primer VI-F3 is (g1) or (g 2);
(g1) a single-stranded DNA molecule shown as sequence 31 in the sequence table;
(g2) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 31 and has the same function as the sequence 31;
the primer VI-B3 is (g3) or (g 4);
(g3) a single-stranded DNA molecule shown as a sequence 32 in a sequence table;
(g4) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 32 and has the same function as the sequence 32;
the primer VI-FIP is (g5) or (g 6);
(g5) a single-stranded DNA molecule shown as a sequence 33 in a sequence table;
(g6) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 33 and having the same functions as the sequence 33;
the primer VI-BIP is (g7) or (g 8);
(g7) a single-stranded DNA molecule shown in sequence 34 of the sequence table;
(g8) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 34 and having the same functions as the sequence 34;
the primer VI-LF is (g9) or (g 10);
(g9) a single-stranded DNA molecule shown in sequence 35 of the sequence table;
(g10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 35 and having the same functions as the sequence 35;
the primer VI-LB is (g11) or (g 12);
(g11) a single-stranded DNA molecule shown as a sequence 36 in a sequence table;
(g12) and (b) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 36 and has the same function as the sequence 36.
In the primer group I, the molar ratio of a primer I-F3 to a primer I-B3 to a primer I-FIP to a primer I-BIP to a primer I-LF to a primer I-LB is specifically 0.5: 0.5: 2: 2: 1: 1.
in the primer group II, the molar ratio of the primer II-F3 to the primer II-B3 to the primer II-FIP to the primer II-BIP to the primer II-LF to the primer II-LB is specifically 0.5: 0.5: 2: 2: 1: 1.
in the primer group III, the molar ratio of a primer III-F3 to a primer III-B3 to a primer III-FIP to a primer III-BIP to a primer III-LF to a primer III-LB may be specifically 0.5: 0.5: 2: 2: 1: 1.
in the primer group IV, the molar ratio of a primer IV-F3, a primer IV-B3, a primer IV-FIP, a primer IV-BIP, a primer IV-LF and a primer IV-LB can be specifically 0.5: 0.5: 2: 2: 1: 1.
in the primer group V, the molar ratio of the primer V-F3, the primer V-B3, the primer V-FIP, the primer V-BIP, the primer V-LF and the primer V-LB can be specifically 0.5: 0.5: 2: 2: 1: 1.
in the primer group VI, the molar ratio of the primer VI-F3 to the primer VI-B3 to the primer VI-FIP to the primer VI-BIP to the primer VI-LF to the primer VI-LB is specifically 0.5: 0.5: 2: 2: 1: 1.
the invention also protects the application of the primer combination in the preparation of the kit; the application of the kit is as follows (h1) or (h 2):
(h1) identifying Enterobacter sakazakii and/or Yersinia enterocolitica and/or Shigella and/or Bacillus cereus and/or Vibrio vulnificus and/or Campylobacter jejuni;
(h2) the kit is used for detecting whether a sample to be detected contains enterobacter sakazakii and/or enterocolitis yersinia and/or shigella and/or bacillus cereus and/or vibrio vulnificus and/or campylobacter jejuni.
The invention also protects a kit containing the primer combination; the application of the kit is as follows (h1) or (h 2):
(h1) identifying Enterobacter sakazakii and/or Yersinia enterocolitica and/or Shigella and/or Bacillus cereus and/or Vibrio vulnificus and/or Campylobacter jejuni;
(h2) the kit is used for detecting whether a sample to be detected contains enterobacter sakazakii and/or enterocolitis yersinia and/or shigella and/or bacillus cereus and/or vibrio vulnificus and/or campylobacter jejuni.
The invention also provides a preparation method of the kit, which comprises the step of packaging each primer independently.
The invention also provides a method for detecting whether the bacteria to be detected are enterobacter sakazakii, yersinia enterocolitica, shigella, bacillus cereus, vibrio vulnificus or campylobacter jejuni, which comprises the following steps:
(1) extracting the genome DNA of the bacteria to be detected;
(2) taking the genomic DNA extracted in the step (1) as a template, respectively adopting each primer group in the primer combination to perform loop-mediated isothermal amplification, and then judging as follows:
if the primer group I is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as Enterobacter sakazakii;
if the primer group II is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as yersinia enterocolitica;
if the primer group III is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as shigella;
if the primer group IV is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as a candidate of bacillus cereus;
if the primer group V is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as vibrio vulnificus;
if the primer group VI is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as campylobacter jejuni.
The invention also provides a method for detecting whether a sample to be detected contains enterobacter sakazakii and/or yersinia enterocolitica and/or shigella and/or bacillus cereus and/or vibrio vulnificus and/or campylobacter jejuni, which comprises the following steps:
(1) extracting the total DNA of a sample to be detected;
(2) taking the total DNA extracted in the step (1) as a template, respectively adopting each primer group in the primer combination to perform loop-mediated isothermal amplification, and then judging as follows:
if the primer group I is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain the Enterobacter sakazakii;
if the primer group II is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain yersinia enterocolitica;
if the primer group III is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain Shigella;
if the primer group IV is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain the bacillus cereus;
if the primer group V is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain vibrio vulnificus;
if the primer group VI is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain campylobacter jejuni.
In any of the above methods, when the primer set I is used, the molar concentrations of the primer I-F3, the primer I-B3, the primer I-FIP, the primer I-BIP, the primer I-LF and the primer I-LB in the reaction system of the LAMP are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M, respectively.
In any of the above methods, when the primer set II is used, the molar concentrations of the primer II-F3, the primer II-B3, the primer II-FIP, the primer II-BIP, the primer II-LF and the primer II-LB in the reaction system of the loop-mediated isothermal amplification are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M, respectively.
In any of the above methods, when the primer set III is used, the molar concentrations of the primer III-F3, the primer III-B3, the primer III-FIP, the primer III-BIP, the primer III-LF and the primer III-LB in the reaction system of the LAMP are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M, respectively.
In any of the above methods, when the primer set IV is used, the molar concentrations of the primer IV-F3, the primer IV-B3, the primer IV-FIP, the primer IV-BIP, the primer IV-LF and the primer IV-LB in the reaction system of the loop-mediated isothermal amplification are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M in sequence.
In any of the above methods, when the primer set V is used, the molar concentrations of the primer V-F3, the primer V-B3, the primer V-FIP, the primer V-BIP, the primer V-LF and the primer V-LB in the reaction system of the LAMP are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M, respectively.
In any of the above methods, when the primer set VI is used, the molar concentrations of the primer VI-F3, the primer VI-B3, the primer VI-FIP, the primer VI-BIP, the primer VI-LF and the primer VI-LB in the reaction system of the loop-mediated isothermal amplification are 0.5. mu.M, 2. mu.M, 1. mu.M and 1. mu.M in sequence.
The invention also protects the application of the primer combination in detecting whether the bacteria to be detected are enterobacter sakazakii, yersinia enterocolitica, shigella, bacillus cereus, vibrio vulnificus or campylobacter jejuni.
The invention also protects the application of the primer combination in detecting whether the sample to be detected contains enterobacter sakazakii and/or yersinia enterocolitica and/or shigella and/or bacillus cereus and/or vibrio vulnificus and/or campylobacter jejuni.
Any of the enterobacter sakazakii may specifically be the strain with CICC number 21560. The yersinia enterocolitica strain of any of the above may specifically be the strain with ATCC accession No. 23715. Any of the above shigella may specifically be the strain with ATCC No. 12022. Any of the Bacillus cereus strains described above can be specifically the strain ATCC No. 11778. Any of the Vibrio vulnificus described above may specifically be the strain ATCC No. 27562. The Campylobacter jejuni strain may specifically be the strain ATCC No. 33291.
The primer combination provided by the invention is used for identifying 6 common food pathogenic bacteria, has high specificity and high sensitivity, and can simply, conveniently, quickly and accurately detect enterobacter sakazakii, enterocolitis yersinia, shigella, bacillus cereus, vibrio vulnificus and campylobacter jejuni. The invention has great popularization value.
Drawings
FIG. 1 shows the results of using the primer set I in example 2.
FIG. 2 shows the results of using the primer set II in example 2.
FIG. 3 shows the results of using the primer set III in example 2.
FIG. 4 shows the results of using the primer set IV in example 2.
FIG. 5 shows the results of using the primer set V in example 2.
FIG. 6 shows the results of using the primer set VI in example 2.
FIG. 7 shows the results of sample one in example 4.
FIG. 8 shows the results of sample two in example 4.
FIG. 9 shows the results of sample three in example 4.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged. ATCC website: http:// www.atcc.org/. CICC website: http:// www.china-cic.
Example 1 preparation of kit
The kit consists of six LAMP primer groups, and each primer group is used for detecting one food pathogenic bacterium.
The primer set for detecting enterobacter sakazakii was as follows (5 '→ 3'):
outer primer F3 (SEQ ID NO: 1 of the sequence Listing): TCGGTGGTTACCAGGTTA, respectively;
outer primer B3 (SEQ ID NO: 2 of the sequence Listing): AGTCAGCACGCCATACC, respectively;
inner primer FIP (sequence 3 of the sequence table): AGTGTCGCCTTTATACGGCATGCGTACGTTGGTTTCGAAATGG, respectively;
inner primer BIP (sequence 4 of the sequence table): GCGCTTTCAAAGCTCAGGGCACGGGTGTATACGTCCAG, respectively;
loop primer LF (sequence 5 of the sequence listing): GCCCAGCCAGTCGTAG, respectively;
loop primer LB (sequence 6 of the sequence listing): GTACAGCTGACCGCTAAAC are provided.
The primer sets for detection of yersinia enterocolitica were as follows (5 '→ 3'):
outer primer F3 (SEQ ID NO: 7 of the sequence Listing): TATGCGCAAAGCCATGT, respectively;
outer primer B3 (SEQ ID NO: 8 of the sequence Listing): GTTGATGCGGAAAGATGG, respectively;
inner primer FIP (sequence 9 of the sequence table): CAGTTATCATCGAGTTCATAACGGTAAAGAAAATGGGGATACATTGGAT, respectively;
inner primer BIP (sequence 10 of the sequence table): TCGTTTGCTTATAACTCATCAGGGAATCAACATCACCATGACCAA, respectively;
loop primer LF (sequence 11 of the sequence listing): CTTCAGGTTAAAACCTTTAGGG, respectively;
loop primer LB (sequence 12 of sequence listing): GATTTCTTCTATGGCAGTAATAAGT are provided.
The primer set for detecting shigella was as follows (5 '→ 3'):
outer primer F3 (SEQ ID NO: 13 of the sequence Listing): ATGTTCCGCCTCGAAAT, respectively;
outer primer B3 (SEQ ID NO: 14 of the sequence Listing): GGAGGTCATTTGCTGTCA, respectively;
inner primer FIP (SEQ ID NO: 15 of the sequence listing): AGGTAGACTTCTATCTCATCCACAATCTGGAGGACATTGCCCG, respectively;
inner primer BIP (sequence 16 of sequence table): CCTTCCAGACCATGCTCGCCTCCCGACACGCCATAG, respectively;
loop primer LF (sequence 17 of the sequence listing): TGGAGAGTTCTGACTTTATCC, respectively;
loop primer LB (seq id No. 18 of the sequence listing): TGCCGTGAAGGAAATGC are provided.
The primer set for detecting bacillus cereus was as follows (5 '→ 3'):
outer primer F3 (SEQ ID NO: 19 of the sequence Listing): GAAAGAATATCCAAATCAAACAG, respectively;
outer primer B3 (SEQ ID NO: 20 of the sequence Listing): CCCAATCACGTGAACGAAA, respectively;
inner primer FIP (sequence 21 of sequence table): GCTGCAATGACCTCGTTATTATTGTCAGTATTAGGTCGTAGTAGTGG, respectively;
inner primer BIP (sequence 22 of sequence table): CGATCATTTTTCTTAATTTTCGTGTCCTCCCGACACGCCATAG, respectively;
loop primer LF (sequence 23 of sequence listing): AATTTATCGAATAAAGGATTTGTAT, respectively;
loop primer LB (sequence 24 of sequence listing): CTCCTGAAGATGGTGGCGTT are provided.
The primer set for detecting Vibrio vulnificus was as follows (5 '→ 3'):
outer primer F3 (SEQ ID NO: 25 of the sequence Listing): GACGCCAAAATTGTCCG, respectively;
outer primer B3 (SEQ ID NO: 26 of the sequence Listing): CTCATTCTGCGGTAGGTC, respectively;
inner primer FIP (SEQ ID NO: 27 of the sequence Listing): TCTGGAACCAGCTGTGATCTTGCAAGCCTGGCACGGGTA, respectively;
inner primer BIP (sequence 28 of sequence table): GCAAACCGCCGCACTTACATTTCGGTGTGTAACCAGAAAC, respectively;
loop primer LF (sequence 29 of the sequence listing): CTGTAGCTCGTTAACCAAATGA, respectively;
loop primer LB (sequence 30 of sequence listing): TCCATTCGCCAGCAGT are provided.
The primer set for detecting campylobacter jejuni was as follows (5 '→ 3'):
outer primer F3 (SEQ ID NO: 31 of the sequence Listing): TTCAGCGATTAATATCTTGCTTA, respectively;
outer primer B3 (SEQ ID NO: 32 of the sequence Listing): CTTTTGAAAACTCTAGGAGTCAT, respectively;
inner primer FIP (SEQ ID NO: 33 of the sequence Listing): GCCCTTCAAGTGTTGAGAACATATAGAGTCAGCTTCGCGAGAG, respectively;
inner primer BIP (sequence 34 of sequence table): TAGCACACTTTACAGATTGGATTCCAGTCATAAATCCTACCCAACCTA, respectively;
loop primer LF (sequence 35 of the sequence listing): GAAAGTTGATGCCAAAATCATAA, respectively;
loop primer LB (seq id No. 36 of sequence listing): AGGACATGTTCATGATGGA are provided.
The primer set for detecting Enterobacter sakazakii was designated as primer set I. The primer set for detecting yersinia enterocolitica was designated as primer set ii. The primer group for detecting Shigella is named as primer group III. The primer set for detecting Bacillus cereus was designated as primer set IV. The primer set for detecting Vibrio vulnificus was named primer set V. The primer set for detecting Campylobacter jejuni was designated as primer set VI.
Example 2 specificity
The bacteria to be detected are respectively:
enterobacter sakazakii (Enterobacter sakazakii), CICC number is 21560;
yersinia enterocolitica (Yersinia enterocolitica), ATCC No. 23715;
shigella (Shigella flexneri) ATCC No. 12022;
bacillus cereus (Bacillus cereus) having ATCC accession number 11778;
vibrio vulnificus (Vibrio vulgaris) ATCC No. 27562;
campylobacter jejuni (Campylobacter jejuni), ATCC No. 33291.
1. And extracting the genome DNA of the bacteria to be detected.
2. The genomic DNA extracted in step 1 was used as a template for loop-mediated isothermal amplification using each of the primer sets prepared in example 1.
Reaction system (10 μ L): 7.0. mu.L of the reaction solution (product catalog No. CP.440020 from Boo Bio Inc.), 1. mu.L of the primer mixture and 50pg-50ng of the template DNA, and 10. mu.L of water was supplemented. The primer mixture is a mixture of each primer in the primer group. In the reaction system, the final concentrations of the outer primer F3 and the outer primer B3 were 0.5. mu.M, the final concentrations of the inner primer FIP and the inner primer BIP were 2. mu.M, and the final concentrations of the loop primer LF and the loop primer LB were 1. mu.M.
Reaction conditions are as follows: keeping the temperature at 65 ℃ for 50 min.
In the reaction process, a fluorescence PCR instrument is adopted to detect fluorescence signals.
The results using primer set I are shown in FIG. 1. The positive amplification curve is shown only when the bacteria to be tested are Enterobacter sakazakii. When the bacteria to be detected are other five bacteria except the Enterobacter sakazakii, no positive amplification curve is shown.
The results using primer set II are shown in FIG. 2. The positive amplification curve is shown only when the bacteria to be tested are Yersinia enterocolitica. When the bacteria to be detected are other five bacteria except the yersinia enterocolitica, the positive amplification curve is not displayed.
The results using primer set III are shown in FIG. 3. And only when the bacteria to be detected are Shigella, a positive amplification curve is displayed. When the bacteria to be detected are other five bacteria except shigella, the positive amplification curve is not displayed.
The results using primer set IV are shown in FIG. 4. The positive amplification curve is shown only when the bacteria to be tested is bacillus cereus. When the bacteria to be detected are other five bacteria except the bacillus cereus, the positive amplification curve is not displayed.
The results using primer set V are shown in FIG. 5. The positive amplification curve is shown only when the bacteria to be tested is vibrio vulnificus. When the bacteria to be detected are other five bacteria except the vibrio vulnificus, a positive amplification curve is not displayed.
The results using primer set VI are shown in FIG. 6. The positive amplification curve is shown only when the bacteria to be tested are Campylobacter jejuni. When the bacteria to be detected are other five bacteria except the campylobacter jejuni, no positive amplification curve is displayed.
The results show that the six primer groups provided by the invention have high specificity to the target bacteria respectively.
Example 3 sensitivity results
The bacteria to be detected are respectively:
enterobacter sakazakii (Enterobacter sakazakii), CICC number is 21560;
yersinia enterocolitica (Yersinia enterocolitica), ATCC No. 23715;
shigella (Shigella flexneri) ATCC No. 12022;
bacillus cereus (Bacillus cereus) having ATCC accession number 11778;
vibrio vulnificus (Vibrio vulgaris) ATCC No. 27562;
campylobacter jejuni (Campylobacter jejuni), ATCC No. 33291.
Sensitivity of primer group I for detecting Enterobacter sakazakii
1. Extracting the genome DNA of the Enterobacter sakazakii.
2. Using the genomic DNA extracted in step 1 as a template, the primer set I prepared in example 1 was used for loop-mediated isothermal amplification.
Reaction system (10 μ L): 7.0. mu.L of the reaction solution (product catalog No. CP.440020 from Boo Bio Inc.), 1. mu.L of the primer mixture and the template DNA, and 10. mu.L of water were added. The primer mixture is a mixture of each primer in the primer group. In the reaction system, the concentrations of the outer primer F3 and the outer primer B3 are both 0.5. mu.M, the concentrations of the inner primer FIP and the inner primer BIP are both 2. mu.M, and the concentrations of the loop primer LF and the loop primer LB are both 1. mu.M. In the reaction system, the content of the template DNA is 10, 102、103、104Or 105Number of copies.
Reaction conditions are as follows: keeping the temperature at 65 ℃ for 50 min.
In the reaction process, a fluorescence PCR instrument is adopted to detect fluorescence signals.
The results show that the sensitivity of the primer group I for detecting Enterobacter sakazakii is 103Number of copies/reaction system.
Second, sensitivity of primer group II for detecting yersinia enterocolitica
Replacing enterobacter sakazakii with yersinia enterocolitica, replacing primer group I with primer group II, and performing the same steps.
The result shows that the sensitivity of the primer group II for detecting the yersinia enterocolitica is 103Number of copies/reaction system.
Third, sensitivity of primer group III for detecting Shigella
Shigella is used for replacing enterobacter sakazakii, a primer group III is used for replacing a primer group I, and other steps are the same as the step I.
The result shows that the sensitivity of the primer group III for detecting Shigella is 103Number of copies/reaction system.
Fourth, sensitivity of primer group IV for detecting bacillus cereus
Replacing Enterobacter sakazakii with Bacillus cereus, replacing primer group I with primer group IV, and performing the same steps.
The result shows that the sensitivity of the primer group IV for detecting the bacillus cereus is 103Number of copies/reaction system.
Fifth, the sensitivity of the primer group V for detecting the vibrio vulnificus
Replacing enterobacter sakazakii with vibrio vulnificus, replacing primer group I with primer group V, and performing the same steps.
The result shows that the sensitivity of the primer group V for detecting the vibrio vulnificus is 103Number of copies/reaction system.
Sixthly, sensitivity of primer group VI for detecting campylobacter jejuni
And (3) replacing the enterobacter sakazakii with the campylobacter jejuni, replacing the primer group I with the primer group VI, and performing the other steps.
The result shows that the sensitivity of the primer group VI for detecting the campylobacter jejuni is 103Number of copies/reaction system.
Example 4 application
The sample to be detected is the following sample I, sample II or sample III:
a first sample: milk containing enterobacter sakazakii has been identified by bacterial culture;
sample two: fresh pork confirmed to contain yersinia enterocolitica by bacterial culture identification;
sample three: shigella-containing deli sauced beef has been identified by bacterial culture.
1. And extracting the total DNA of the sample to be detected.
2. Using the total DNA extracted in step 1 as a template, the primer sets prepared in example 1 were used to perform loop-mediated isothermal amplification.
Reaction system (10 μ L): 7.0. mu.L of the reaction solution (product catalog No. CP.440020 from Boo Bio Inc.), 1. mu.L of the primer mixture and 50ng of the template DNA, and 10. mu.L of water was supplemented. The primer mixture is a mixture of each primer in the primer group. In the reaction system, the final concentrations of the outer primer F3 and the outer primer B3 were 0.5. mu.M, the final concentrations of the inner primer FIP and the inner primer BIP were 2. mu.M, and the final concentrations of the loop primer LF and the loop primer LB were 1. mu.M.
Reaction conditions are as follows: keeping the temperature at 65 ℃ for 50 min.
In the reaction process, a fluorescence PCR instrument is adopted to detect fluorescence signals.
The results for sample one are shown in figure 7. Only when the primer set I was used, a positive amplification curve was shown. When five primer sets other than the primer set I were used, no positive amplification curve was shown.
The results for sample two are shown in FIG. 8. Only when the primer set II was used, a positive amplification curve was shown. When five primer sets other than the primer set II were used, no positive amplification curve was shown.
The results for sample three are shown in FIG. 9. Only when the primer set III was used, a positive amplification curve was shown. When five primer sets other than primer set III were used, no positive amplification curve was shown.
The results show that the primer combination provided by the invention is used for detecting 6 common food pathogenic bacteria, and the results are accurate and reliable.
Figure IDA0000919804140000011
Figure IDA0000919804140000021
Figure IDA0000919804140000031
Figure IDA0000919804140000041
Figure IDA0000919804140000051
Figure IDA0000919804140000061
Figure IDA0000919804140000071

Claims (8)

1. The primer combination comprises a primer group I, a primer group II, a primer group III, a primer group IV, a primer group V and a primer group VI;
the primer group I consists of a primer I-F3, a primer I-B3, a primer I-FIP, a primer I-BIP, a primer I-LF and a primer I-LB; the primers I-F3 are SEQ ID NO: 1, a single-stranded DNA molecule; the primer I-B3 is SEQ ID NO: 2; the primer I-FIP is SEQ ID NO: 3, a single-stranded DNA molecule; the primer I-BIP is SEQ ID NO: 4, a single-stranded DNA molecule; the primers I-LF are SEQ ID NO: 5, a single-stranded DNA molecule; the primers I-LB are SEQ ID NO: 6;
the primer group II consists of a primer II-F3, a primer II-B3, a primer II-FIP, a primer II-BIP, a primer II-LF and a primer II-LB; the primer II-F3 is SEQ ID NO: 7; the primer II-B3 is SEQ ID NO: 8, a single-stranded DNA molecule; the primer II-FIP is SEQ ID NO: 9, a single-stranded DNA molecule; the primer II-BIP is SEQ ID NO: 10, a single-stranded DNA molecule; the primers II-LF are SEQ ID NO: 11; the primer II-LB is SEQ ID NO: 12;
the primer group III consists of a primer III-F3, a primer III-B3, a primer III-FIP, a primer III-BIP, a primer III-LF and a primer III-LB; the primer III-F3 is SEQ ID NO: 13, a single-stranded DNA molecule; the primer III-B3 is SEQ ID NO: 14, a single-stranded DNA molecule; the primer III-FIP is SEQ ID NO: 15, a single-stranded DNA molecule; the primer III-BIP is SEQ ID NO: 16; the primer III-LF is SEQ ID NO: 17; the primer III-LB is SEQ ID NO: 18, a single-stranded DNA molecule;
the primer group IV consists of a primer IV-F3, a primer IV-B3, a primer IV-FIP, a primer IV-BIP, a primer IV-LF and a primer IV-LB; the primer IV-F3 is SEQ ID NO: 19; the primer IV-B3 is SEQ ID NO: 20, a single-stranded DNA molecule; the primer IV-FIP is SEQ ID NO: 21, a single-stranded DNA molecule; the primer IV-BIP is SEQ ID NO: 22; the primer IV-LF is SEQ ID NO: 23; the primer IV-LB is SEQ ID NO: 24, a single-stranded DNA molecule;
the primer group V consists of a primer V-F3, a primer V-B3, a primer V-FIP, a primer V-BIP, a primer V-LF and a primer V-LB; the primer V-F3 is SEQ ID NO: 25; the primer V-B3 is SEQ ID NO: 26; the primer V-FIP is SEQ ID NO: 27, a single-stranded DNA molecule; the primer V-BIP is SEQ ID NO: 28; the primer V-LF is SEQ ID NO: 29; the primer V-LB is SEQ ID NO: 30;
the primer group VI consists of a primer VI-F3, a primer VI-B3, a primer VI-FIP, a primer VI-BIP, a primer VI-LF and a primer VI-LB; the primer VI-F3 is SEQ ID NO: 31; the primer VI-B3 is SEQ ID NO: 32, a single-stranded DNA molecule; the primer VI-FIP is SEQ ID NO: 33; the primer VI-BIP is SEQ ID NO: 34, a single-stranded DNA molecule; the primer VI-LF is SEQ ID NO: 35; the primer VI-LB is SEQ ID NO: 36, or a single-stranded DNA molecule as shown.
2. Use of a primer combination according to claim 1 in the preparation of a kit; the application of the kit is as follows (h1) or (h 2):
(h1) identifying Enterobacter sakazakii and/or Yersinia enterocolitica and/or Shigella and/or Bacillus cereus and/or Vibrio vulnificus and/or Campylobacter jejuni;
(h2) the kit is used for detecting whether a sample to be detected contains enterobacter sakazakii and/or enterocolitis yersinia and/or shigella and/or bacillus cereus and/or vibrio vulnificus and/or campylobacter jejuni.
3. A kit comprising the primer combination of claim 1; the application of the kit is as follows (h1) or (h 2):
(h1) identifying Enterobacter sakazakii and/or Yersinia enterocolitica and/or Shigella and/or Bacillus cereus and/or Vibrio vulnificus and/or Campylobacter jejuni;
(h2) the kit is used for detecting whether a sample to be detected contains enterobacter sakazakii and/or enterocolitis yersinia and/or shigella and/or bacillus cereus and/or vibrio vulnificus and/or campylobacter jejuni.
4. A method for preparing the kit according to claim 3, comprising the step of packaging each primer individually.
5. A method for detecting whether bacteria to be detected are Enterobacter sakazakii, Yersinia enterocolitica, Shigella, Bacillus cereus, Vibrio vulnificus or Campylobacter jejuni comprises the following steps:
(1) extracting the genome DNA of the bacteria to be detected;
(2) taking the genomic DNA extracted in the step (1) as a template, respectively adopting each primer group in the primer combination of claim 1 to perform loop-mediated isothermal amplification, and then judging as follows:
if the primer group I is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as Enterobacter sakazakii;
if the primer group II is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as yersinia enterocolitica;
if the primer group III is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as shigella;
if the primer group IV is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as a candidate of bacillus cereus;
if the primer group V is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as vibrio vulnificus;
if the primer group VI is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as campylobacter jejuni;
the methods are useful for non-disease diagnosis and treatment.
6. A method for detecting whether a sample to be detected contains Enterobacter sakazakii and/or Yersinia enterocolitica and/or Shigella and/or Bacillus cereus and/or Vibrio vulnificus and/or Campylobacter jejuni comprises the following steps:
(1) extracting the total DNA of a sample to be detected;
(2) taking the total DNA extracted in the step (1) as a template, respectively adopting each primer group in the primer combination of claim 1 to perform loop-mediated isothermal amplification, and then judging as follows:
if the primer group I is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain the Enterobacter sakazakii;
if the primer group II is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain yersinia enterocolitica;
if the primer group III is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain Shigella;
if the primer group IV is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain the bacillus cereus;
if the primer group V is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain vibrio vulnificus;
if the primer group VI is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain campylobacter jejuni;
the methods are useful for non-disease diagnosis and treatment.
7. The use of the primer combination of claim 1 for detecting whether the bacteria to be detected is Enterobacter sakazakii, Yersinia enterocolitica, Shigella, Bacillus cereus, Vibrio vulnificus or Campylobacter jejuni; the use is for non-disease diagnosis and treatment.
8. Use of the primer combination of claim 1 for detecting whether a sample to be tested contains enterobacter sakazakii and/or yersinia enterocolitica and/or shigella and/or bacillus cereus and/or vibrio vulnificus and/or campylobacter jejuni; the use is for non-disease diagnosis and treatment.
CN201610069658.7A 2016-02-01 2016-02-01 Primer combination for detecting 6 common food pathogenic bacteria and application thereof Active CN107022600B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610069658.7A CN107022600B (en) 2016-02-01 2016-02-01 Primer combination for detecting 6 common food pathogenic bacteria and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610069658.7A CN107022600B (en) 2016-02-01 2016-02-01 Primer combination for detecting 6 common food pathogenic bacteria and application thereof

Publications (2)

Publication Number Publication Date
CN107022600A CN107022600A (en) 2017-08-08
CN107022600B true CN107022600B (en) 2020-04-28

Family

ID=59524252

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610069658.7A Active CN107022600B (en) 2016-02-01 2016-02-01 Primer combination for detecting 6 common food pathogenic bacteria and application thereof

Country Status (1)

Country Link
CN (1) CN107022600B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107988327A (en) * 2017-12-29 2018-05-04 广东环凯微生物科技有限公司 The dry powdered LAMP quick detection kits of Shigella
CN110592250A (en) * 2019-11-01 2019-12-20 中国人民解放军总医院 LAMP primer combination for detecting intestinal pathogenic bacteria and application thereof
CN112795674A (en) * 2021-03-18 2021-05-14 上海海关动植物与食品检验检疫技术中心 Primer probe combination, kit and method for detecting Cronobacter sakazakii based on RAA technology

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101831493A (en) * 2009-11-06 2010-09-15 武汉工业学院 Loop-mediated isothermal amplification (LAMP) primer pair of bacillus cereus and detection method
CN101182574B (en) * 2007-11-19 2010-09-29 天津出入境检验检疫局动植物与食品检测中心 Method for detecting food-borne enterocolitisyersinia genus by loop-mediated isothermal amplification
CN103160604A (en) * 2013-04-08 2013-06-19 北京出入境检验检疫局检验检疫技术中心 LAMP (loop-mediated isothermal amplification) detection kit for Vibrio vulnificus and detection method using same
CN103484536A (en) * 2013-07-10 2014-01-01 东北农业大学 Kit used for rapid detection of enterobacter sakazakii in milk, and applications thereof
CN104846078A (en) * 2015-04-14 2015-08-19 江苏出入境检验检疫局动植物与食品检测中心 Campylobacter jejuni constant-temperature fluorescence detection primer group, kit, and detection method which are capable of avoiding false negative

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101182574B (en) * 2007-11-19 2010-09-29 天津出入境检验检疫局动植物与食品检测中心 Method for detecting food-borne enterocolitisyersinia genus by loop-mediated isothermal amplification
CN101831493A (en) * 2009-11-06 2010-09-15 武汉工业学院 Loop-mediated isothermal amplification (LAMP) primer pair of bacillus cereus and detection method
CN103160604A (en) * 2013-04-08 2013-06-19 北京出入境检验检疫局检验检疫技术中心 LAMP (loop-mediated isothermal amplification) detection kit for Vibrio vulnificus and detection method using same
CN103484536A (en) * 2013-07-10 2014-01-01 东北农业大学 Kit used for rapid detection of enterobacter sakazakii in milk, and applications thereof
CN104846078A (en) * 2015-04-14 2015-08-19 江苏出入境检验检疫局动植物与食品检测中心 Campylobacter jejuni constant-temperature fluorescence detection primer group, kit, and detection method which are capable of avoiding false negative

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
七种病原体LAMP快速检测研究;张如胜;《中国优秀硕士学位论文全文数据库（电子期刊）》;20100215(第02期);参见第三章，表3 *

Also Published As

Publication number Publication date
CN107022600A (en) 2017-08-08

Similar Documents

Publication Publication Date Title
Chen et al. Prevalence and methodologies for detection, characterization and subtyping of Listeria monocytogenes and L. ivanovii in foods and environmental sources
Park et al. Current and emerging technologies for rapid detection and characterization of Salmonella in poultry and poultry products
Pinto et al. Identification and typing of food-borne Staphylococcus aureus by PCR-based techniques
Chiang et al. Multiplex PCR and a chromogenic DNA macroarray for the detection of Listeria monocytogens, Staphylococcus aureus, Streptococcus agalactiae, Enterobacter sakazakii, Escherichia coli O157: H7, Vibrio parahaemolyticus, Salmonella spp. and Pseudomonas fluorescens in milk and meat samples
Macé et al. Development of a rapid real-time PCR method as a tool to quantify viable Photobacterium phosphoreum bacteria in salmon (Salmo salar) steaks
Miya et al. Development of a multilocus variable-number of tandem repeat typing method for Listeria monocytogenes serotype 4b strains
Li et al. Prevalence, antibiotic susceptibility, and molecular characterization of Cronobacter spp. isolated from edible mushrooms in China
Thongkao et al. Rapid and sensitive detection of V ibrio harveyi by loop‐mediated isothermal amplification combined with lateral flow dipstick targeted to vhhP2 gene
Bavisetty et al. Rapid pathogen detection tools in seafood safety
Razei et al. Presenting a rapid method for detection of Bacillus cereus, Listeria monocytogenes and Campylobacter jejuni in food samples
CN107022600B (en) Primer combination for detecting 6 common food pathogenic bacteria and application thereof
Williams et al. Implications of chitin attachment for the environmental persistence and clinical nature of the human pathogen Vibrio vulnificus
CN105936935B (en) PCR detection kit for rapidly identifying specific serotype salmonella
Leoni et al. Trh (tdh−/trh+) gene analysis of clinical, environmental and food isolates of Vibrio parahaemolyticus as a tool for investigating pathogenicity
Kim et al. Comparison of culture, conventional and real-time PCR methods for Listeria monocytogenes in foods
Sridapan et al. Rapid detection of Clostridium perfringens in food by loop-mediated isothermal amplification combined with a lateral flow biosensor
Anderson et al. Evaluation of repetitive extragenic palindromic-polymerase chain reaction and denatured gradient gel electrophoresis in identifying Salmonella serotypes isolated from processed turkeys
Shang et al. PCR identification of Salmonella serovars for the E serogroup based on novel specific targets obtained by pan-genome analysis
Kim et al. Evaluating the prevalence of foodborne pathogens in livestock using metagenomics approach
Nuchchanart et al. Development of a lateral flow dipstick test for the detection of 4 strains of Salmonella spp. in animal products and animal production environmental samples based on loop-mediated isothermal amplification
CN107022601B (en) Primer combination for detecting 5 food pathogenic bacteria with national limit standard and application thereof
Ye et al. Analysis of major band of Enterobacter sakazakii by ERIC-PCR and development of a species-specific PCR for detection of Ent. sakazakii in dry food samples
Ohshima et al. A novel typing method for Listeria monocytogenes using high-resolution melting analysis (HRMA) of tandem repeat regions
Park et al. Development and evaluation of a next-generation Sequencing panel for the multiple detection and identification of pathogens in fermented foods
Tanaka et al. Most-probable-number loop-mediated isothermal amplification-based procedure enhanced with K antigen-specific immunomagnetic separation for quantifying TDH+ Vibrio parahaemolyticus in molluscan shellfish

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant