CN107012210A - A kind of MicroRNA detection method based on rare earth nano material Fluorescence amplification - Google Patents

A kind of MicroRNA detection method based on rare earth nano material Fluorescence amplification Download PDF

Info

Publication number
CN107012210A
CN107012210A CN201710175548.3A CN201710175548A CN107012210A CN 107012210 A CN107012210 A CN 107012210A CN 201710175548 A CN201710175548 A CN 201710175548A CN 107012210 A CN107012210 A CN 107012210A
Authority
CN
China
Prior art keywords
rare earth
sequence
stem
mirna
detection method
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710175548.3A
Other languages
Chinese (zh)
Inventor
陈学元
卢连宇
涂大涛
刘*
� 刘
周山勇
郑伟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fujian Institute of Research on the Structure of Matter of CAS
Original Assignee
Fujian Institute of Research on the Structure of Matter of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fujian Institute of Research on the Structure of Matter of CAS filed Critical Fujian Institute of Research on the Structure of Matter of CAS
Priority to CN201710175548.3A priority Critical patent/CN107012210A/en
Publication of CN107012210A publication Critical patent/CN107012210A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/682—Signal amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)

Abstract

The invention provides a kind of miRNA super sensitivity detection methods and applications based on rare earth nano material Fluorescence amplification, the detection method has the following advantages that：1) specific recognition can effectively be carried out using the capture probe of molecular beacon structure, also there is good recognition capability for target miRNA single base mismatch；2) various toolenzymes and multistep, intricate amplification procedure are not needed；Using rare earth nano material as mark substance markers biomolecule, without doing any processing in advance, being eventually adding enhancing liquid in experiment just can make nearly million times of Fluorescence Increasing, drastically increase detection sensitivity and operate very easy；3) because the property of the rare earth nano material is stable, specific surface area is big, modifiability is strong, with low cost and each nano particle contains thousands of rare earth ions, greatly improve the mark ratio of rare earth ion, influenceed small by external source rare earth ion, and do not influenceed by anti-coagulants, applicability is wider.

Description

A kind of MicroRNA detection method based on rare earth nano material Fluorescence amplification
Technical field
It is more specifically a kind of to be based on water-soluble rare-earth fluorescence labeling the present invention relates to nano fluorescent detection technique field The Fluorescence amplification of material, to realize the super sensitivity detection method to microRNA.
Background technology
MicroRNA (miRNA) be a kind of length be about 22 nucleotides non-coding single-stranded microRNA, with height Conservative is spent, they are widely present in virus, plant and the cell of higher mammal.Research shows that miRNA is in animals and plants Development, cell growth differentiation and the vital movement such as apoptosis, fat metabolism during play important regulating and controlling effect.Human diseases is special It is not the normal change with a variety of miRNA expression quantity of tumor disease, miRNA is as a kind of emerging disease marker in tumour disease The diagnosis of disease, treatment, Index for diagnosis are significant.Nowadays many conventional nucleic acid detection techniques are such as：RNA blottings, Micro-array chip, real-time quantitative PCR etc. are applied to miRNA detection.But it is due to that miRNA has biological in-vivo content in itself The low, feature that family's sequence homology is strong, nucleic acid chains are short so that these methods often have that detection sensitivity is high, reappearance The problems such as specific not strong and assist probes design of bad, detection is complicated.These features of miRNA in itself are directed to, it is many new Type based on enzyme amplification (rolling circle amplification rolling ring amplification, exponential amplification Reaction index iodines etc.) or based on the amplifying technique for hybridizing chain reaction, be suggested and applied to miRNA inspection Survey.But these technological means generally require the participation of toolenzyme and the signal Enlargement Design of complexity, this has required special Reaction condition and multistep, time-consuming, intricate experimental procedure, these requirements limit its miRNA in complex system and surpass Promotion and application in terms of Sensitive Detection.Therefore development one kind can specific recognition, and skill can be amplified using easy signal Art realizes that low concentration miRNA detection method is significant.
The content of the invention
It is glimmering based on rare earth nano material the purpose of the present invention is to propose to one kind for above-mentioned the deficiencies in the prior art The method of the miRNA super sensitivity detections of light amplification, methods described is to amplify strategy by simply and easily signal, make use of tool The capture probe for having molecular beacon structure realizes the specific recognition to object (miRNA samples to be measured), is received in conjunction with rare earth Rice material Fluorescence amplification technology realizes that signal amplifies.The method set up has very high sensitivity, and available for complicated body MiRNA direct detection in system.
The present invention provides following technical scheme：
A kind of miRNA detection methods based on rare earth nano material Fluorescence amplification, the described method comprises the following steps：
(1) capture probe is provided, the capture probe is molecular beacon structure, and sequential structure is：5 '-free segment1- stem Portion1- ring portion-stem2- free segment2- 3 ', the ring portion is energy specific recognition target miRNA sequence, the stem1With Stem2It is complementarily shaped to cane structure, the free segment1With free segment2Not with ring portion, stem1And stem2It is complementary；
(2) sample containing miRNA to be measured is added；
(3) stem of the detection probe of biotin labeling, the detection probe and capture probe is added2With free segment2Mutually Mend；
(4) Avidin of rare earth nano material mark is added；Or, Avidin is first added, rare earth nano is added afterwards The biotin of material marking；
(5) enhancing liquid is added；
(6) fluorescence signal is detected using time resolution.
According to the present invention, the capture probe in the step (1) can be fixed on solid phase carrier in the way of covalent coupling There is provided, the free form that can also be scattered in liquid is provided.Easy to detect for subsequent instrumentation, preferably capture probe is with covalently even The mode of connection is fixed on solid phase carrier.
By the method on capture probe covalent coupling to solid phase carrier, various methods as known in the art, bag can be used Include but be not limited to, by the upper chemically reactive group of the end of capture probe 5 ' connection, such as amino, carboxyl, amide groups, via These groups are by capture probe covalent coupling to solid phase carrier.In the specific embodiment of the present invention, the capture Probe is the molecular beacon structure of 5 ' Amino End Groups mark, by 5 ' Amino End Groups by its covalent coupling to solid phase carrier.In this hair In a bright embodiment, using pH9.6 carbonate buffer solution as coating buffer, the capture that 5 ' Amino End Groups are marked Probe is fixed on solid phase carrier.
If providing capture probe by the way of by capture probe covalent coupling to solid phase carrier, then, it will capture After probe is coated with onto solid phase carrier, preferably further fall unreacted chemical group on capture probe with confining liquid closing, The false positive being likely to occur in reduction subsequent detection.In the specific embodiment of the present invention, confining liquid used is second Alkanolamine solution, 0.1% ethanolamine solutions for example, prepared with 0.05mol/L carbonate buffer solution.
The solid phase carrier can be conventional and known various solid phase carriers, including but not limited to micropore in detection field Plate, magnetic microsphere, goldleaf, polymer microsphere etc..In the specific embodiment of the present invention, the solid phase carrier is micropore Plate, such as 96 conventional orifice plates.
According to the present invention, in 5 ' the free segments of end design of capture probe1Sequence, can make stem and solid phase carrier have one Segment distance, reduces steric effect, and capture probe is attached to the combination difficulty on solid phase carrier by reduction.In the tool of the present invention In body embodiment, the free segment1Sequence is AAGCTGACCTCT.
According to the present invention, in 3 ' the free segments of end design of capture probe2Sequence, is in order in stem2Outside sequence, then One section of sequence that can be complementary with detection probe is provided, specificity and stability that detection probe is combined with capture probe is improved；Together When the free segment of control2The length of sequence, prevents detection probe when capture probe loop-stem structure is also not switched on, to be just attached to and catch Obtain on probe, cause the appearance for detecting false positive.In the specific embodiment of the present invention, in the capture probe from By segment2Sequence is TTTTTTT.
According to the present invention, stem1And stem2Appropriate CG contents are controlled in sequence, in case too high CG contents make stem ring Structure is excessively stablized, and target miRNA can not open the stem ring of capture probe, cause false negative；Also too low CG is avoided to contain Amount makes loop-stem structure excessively loose, causes false positive.In the specific embodiment of the present invention, in the capture probe Stem1Sequence is TGGACA, stem2Sequence is TGTCCA.
, according to the invention it is preferred to above-mentioned detection method is used to detect miRNA-21, and in this case, the capturing probe In ring portion sequence be：TCAACATCAGTCTGATAAGCTA, sequence energy specific recognition miRNA-21.
According to the present invention, the sequence of detection probe is wanted can be with the stem on capture probe2Sequence and free segment2Sequence is mutual Mend, can so improve specificity and stability that detection probe is combined with capture probe, reduce the false positive and false negative of detection. In the specific embodiment of the present invention, the sequence of the detection probe is：AAAAAAATGGACA.
, according to the invention it is preferred to which the rare earth nano material in the step (4) is XYF4It is nanocrystalline, the X be selected from lithium, One or more in sodium, potassium etc., one or more of the Y in europium, samarium, terbium, dysprosium.One in the present invention is specific real Apply in mode, the rare earth nano material is NaEuF4It is nanocrystalline.
Rare earth nano material marks the method for biotin or Avidin to use various methods known in the art, including But it is not limited to liposomal method, chemical coordination method.
The liposomal method is method known to those skilled in the art.In the specific embodiment of the present invention In, with NaEuF4Nanocrystalline liposomal method marks biotin, comprises the following steps：
1) oil-soluble NaEuF is weighed4Nanocrystalline and biotin labeling Phospholipids is dissolved in chloroformic solution, is carried out after ultrasound Rotary evaporation removes solvent；
2) add ultra-pure water and carry out ultrasound, through reaction in half an hour, be collected by centrifugation, be finally dissolved in ultra-pure water.
The chemical coordination method is also method known to those skilled in the art.In the specific embodiment of the present invention In, with NaEuF4Nanocrystalline chemical coordination method marks biotin, comprises the following steps：
1) oil-soluble NaEuF is weighed4Nanocrystalline to be dissolved in ethanol solution hydrochloride, nano particle is collected by centrifugation, then uses in ultrasound Absolute ethyl alcohol is washed, and removes the oleic acid of nanocrystal surface, is added deionized water dissolving, is obtained water-solubility nanocrystalline；
2) step 1 is taken) water-solubility nanocrystalline of synthesis, biotin and ammoniacal liquor are added, ultrasound is washed with deionized water centrifugation Wash, be finally dissolved in deionized water.
, according to the invention it is preferred to the enhancing liquid in the step (5) contain Triton X-100, naphthoic acid trifluoroacetone, Trioctylphosphine and water.In the specific embodiment of the present invention, the composition of the enhancing liquid is：In every liter of enhancing liquid Contain 1g Triton X-100,26.6mg naphthoyltrifluoroacetones, 193mg trioctylphosphines, pH 2.3.
According to the present invention, the time resolution in above-mentioned steps (6) is detected in fluorescence signal, the principle of the signal amplification It is, when the biotin or Avidin that have existed in the Avidin or biotin, with system marked containing rare earth nano material, shape Into after Avidin-Biotin or biotin-avidin-biotin composite, enhancing liquid is added, makes rare earth nano material molten Solution forms chelate into rare earth ion, and with the part in enhancing liquid, generates new signaling molecule, produces intramolecular and intermolecular Energy transmission so that nearly million times of the intensity enhancing of fluorescence signal, so as to be detected.
According to the present invention, because miRNA is present in virus, plant and the cell of higher mammal, in animals and plants Important regulating and controlling effect is played during the vital movements such as development, cell growth differentiation and apoptosis, fat metabolism.Therefore present invention inspection The method for surveying miRNA, the miRNA available for various uses is detected, includes the miRNA detections of non-diagnostic purpose and diagnostic purpose.
In the present invention, unless otherwise specified, the nucleotide sequence is that 5 ' ends are represented to the 3 ' orders held.
The beneficial effects of the present invention are：
The invention provides a kind of miRNA super sensitivity detection methods and applications based on rare earth nano material Fluorescence amplification, The detection method has the following advantages that：1) specific knowledge can effectively be carried out using the capture probe of molecular beacon structure Not, also there is good recognition capability for target miRNA single base mismatch；2) do not need various toolenzymes and multistep, Intricate amplification procedure；Using rare earth nano material as mark substance markers biomolecule, without doing any processing in advance, Being eventually adding enhancing liquid in experiment just can make nearly million times of Fluorescence Increasing, drastically increase detection sensitivity and operate very simple Just；3) because the property of the rare earth nano material is stable, specific surface area is big, modifiability is strong, with low cost and each nanometer Particle contains thousands of rare earth ions, greatly improves the mark ratio of rare earth ion, is influenceed small by external source rare earth ion, and Do not influenceed by anti-coagulants, applicability is wider.
Brief description of the drawings
Fig. 1 is the detection principle diagram of the miRNA described in a preferred embodiment of the invention.
Fig. 2 is the NaEuF that embodiment 1 is prepared4Nanocrystalline transmission electron microscope picture.
Concentration and the standard curve of fluorescence intensity that Fig. 3 is the miRNA-21 that embodiment 1 is prepared.
Fig. 4 is the investigation result of the selectivity of the identification miRNA-21 targets described in embodiment 2.
Fig. 5 is the investigation result for the miRNA-21 rate of recovery in complex system sample described in embodiment 3.
Embodiment
Below in conjunction with drawings and examples, the present invention is described in further detail.But skilled in the art realises that, Protection scope of the present invention is not limited only to following examples.According to present disclosure, those skilled in the art will recognize that To in the case where not departing from the technical characteristic and scope given by technical solution of the present invention, embodiment described above is made perhaps Change and modifications belongs to protection scope of the present invention more.
In following examples, the INSTRUMENT MODEL of the described transmission electron microscope picture of detection is JEM-2010, and producer is JEOL.
In following examples, the instrument for detecting the fluorescence signal molecule is fluorescence microplate reader, model Synergy4, factory Family is BioTek.
In following examples, the compositions of PBST lavation buffer solutions is 10mM phosphate buffer, 150mM sodium chloride and 0.05% (v/v) polysorbas20.
In following examples, the composition of PBS is：Contain KCl 0.2g, KH in every liter of buffer solution2PO40.2g, NaCl 8g, Na2HPO4·12H2O 3.14g, pH7.4-7.6.
Embodiment 1
Investigation to miRNA-21 detection sensitivities
1.NaEuF4Nanocrystalline liposomal method marks the preparation method of biotin：
1) NaEuF is weighed4Nanocrystalline 10mg and biotin labeling Phospholipids 20mg are dissolved in 5mL chloroform solvents, ultrasound Rotary evaporation is carried out after mixing and removes solvent；
2) step 1 is taken) desciccate addition 4mL ultra-pure water progress ultrasounds, through reaction in half an hour, it is collected by centrifugation, most After be dissolved in 0.5mL ultra-pure waters.
Fig. 2 gives the NaEuF that the present embodiment is prepared4Nanocrystalline transmission electron microscope picture.
As seen from the figure, obtained nanocrystalline Size Distribution is homogeneous (particle diameter is 13.5 ± 1nm), and crystallinity is good.
2. prepare enhancing liquid
1g Triton X-100,26.6mg naphthoyltrifluoroacetones are weighed, 193mg trioctylphosphines add distilled water 1L is settled to, pH 2.3 is adjusted with dilute HCl, it is standby.
3. the probe sequence needed for experiment
4. investigate NaEuF4The sensitivity of nanocrystalline Fluorescence amplification system of determination miRNA-21 standard liquids, including following step Suddenly：
1) it is coated with：Capture probe CP is diluted to 100nM with 0.05mol/L carbonate buffer solution, in 96 hole polyphenyl second In alkene plate, 100 μ L, 37 DEG C of incubation 1h are added per hole, liquid in hole is discarded, is washed with PBST lavation buffer solutions 3 times.
2) close：Prepared with 0.05mol/L carbonate buffer solution 0.1% monoethanolamine, 300 μ L, 37 DEG C are added per hole 1h is incubated, liquid in hole is removed, is washed with PBST lavation buffer solutions 3 times.
3) it is loaded：The 10fM-100nM miRNA-21 marks containing 20U ribonuclease inhibitors are prepared with PBS Quasi- solution, makes its concentration be respectively：0fM, 10fM, 100fM, 1pM, 10pM, 100pM, 1nM, 10nM, 100nM standard items, often Hole adds 100 μ L standard liquid, and 37 DEG C are incubated 1 hour, discard liquid in hole, are washed with PBST lavation buffer solutions 3 times.
4) detection probe DP is added：10nM DP solution is prepared with PBS, 100 μ L, 37 DEG C of incubations are added per hole 0.5h, discards liquid in hole, is washed with PBST lavation buffer solutions 3 times.
5) Avidin is added：5 μ g/mL avidin solution is prepared with PBS, 100 μ L, 37 DEG C of incubations are added per hole 0.5h, discards liquid in hole, is washed with PBST lavation buffer solutions 3 times.
6) NaEuF is added4The biotin of nanocrystalline mark：10 μ g/mL NaEuF is prepared with PBS4Nanocrystalline mark The biotin of note, 100 μ L, 37 DEG C of incubation 0.5h are added per hole, liquid in hole is discarded, is washed with PBST lavation buffer solutions 6 times.
7) enhancing liquid is added：200 μ L enhancing liquid is added per hole, fluorescence signal is detected using time resolution, design parameter is：Swash Send out wavelength 340nm, launch wavelength 617nm, the μ s of time delay 100.
8) standard curve is drawn：Using miRNA-21 concentration of standard solution as abscissa, with pair of each concentration standard liquid The fluorescence intensity answered is ordinate, draws standard curve.
Fig. 3 gives the present embodiment miRNA-21 concentration and the standard curve of fluorescence intensity.
As seen from the figure, in the range of 10fM-100pM, miRNA-21 concentration is linear related to fluorescence intensity, with blank Average value adds 3 times of SD meters, and lowest detection is limited to 1.38fM.
Embodiment 2
To the investigation for the selectivity for recognizing miRNA-21 targets
1. reagent and instrument are same as Example 1 needed for experiment, NaEuF needed for experiment4The biotin of nanocrystalline mark with Embodiment 1 is consistent.
2. the probe sequence needed for experiment (the base upper right corner is labeled with *, is represented as base mismatch)
3. investigate NaEuF4Nanocrystalline Fluorescence amplification system of determination miRNA-21 and mismatch selectivity, including it is as follows Step：
1) it is coated with：Capture probe CP is diluted to 100nM with 0.05mol/L carbonate buffer solution, in 96 hole polyphenyl second In alkene plate, 100 μ L, 37 DEG C of incubation 1h are added per hole, liquid in hole is discarded, is washed with PBST lavation buffer solutions 3 times.
2) close：Prepared with 0.05mol/L carbonate buffer solution 0.1% monoethanolamine, 300 μ L, 37 DEG C are added per hole 1h is incubated, liquid in hole is removed, is washed with PBST lavation buffer solutions 3 times.
3) it is loaded：PM, SM, TM, Random mark of the 1nM containing 20U ribonuclease inhibitors is prepared with PBS Quasi- solution, 100 μ L standard liquid is added per hole, and 37 DEG C of incubation 1h discard liquid in hole, washed with PBST lavation buffer solutions 3 times.
4) detection probe DP is added：10nM DP solution is prepared with PBS, 100 μ L, 37 DEG C of incubations are added per hole 0.5h, discards liquid in hole, is washed with PBST lavation buffer solutions 3 times.
5) Avidin is added：5 μ g/mL avidin solution is prepared with PBS, 100 μ L, 37 DEG C of incubations are added per hole 0.5h, discards liquid in hole, is washed with PBST lavation buffer solutions 3 times.
6) NaEuF is added4The biotin of nanocrystalline mark：10 μ g/mL NaEuF is prepared with PBS4Nanocrystalline mark The biotin of note, 100 μ L, 37 DEG C of incubation 0.5h are added per hole, liquid in hole is discarded, is washed with PBST lavation buffer solutions 6 times.
7) enhancing liquid is added：200 μ L enhancing liquid is added per hole, fluorescence signal is detected using time resolution, design parameter is：Swash Send out wavelength 340nm, launch wavelength 617nm, the μ s of time delay 100.
8) ratio fluorescent (F-F is drawn0)/F0Block diagram, it is the entitled abscissa with every kind of target, with every kind of target The ratio fluorescent of gained is ordinate, wherein, F is target fluorescent determining value, F0It is background fluorescence activity, ratio fluorescent (F-F0)/F0 For reacting the change of different target fluorescent values and background value, block diagram is drawn.
Fig. 4 gives the investigation result of the selectivity of the identification miRNA-21 targets described in the present embodiment.
As shown in Figure 4, single base mismatch (SM) and three base mispairings (TM) are compared with miRNA-21 (PM) ratio fluorescent, The ratio fluorescent of the two drops to 48% and 20% respectively, and the ratio fluorescent of random sequence (Random) is close to zero, explanation Random sequence (Random) effectively can not open capture probe；The above results also demonstrate the detection body described in the present embodiment System has good selectivity.
Embodiment 3
The investigation of method described in the present embodiment for the miRNA-21 rate of recovery in complex system sample
1. sequence and instrument are same as Example 1 needed for experiment, NaEuF needed for experiment4The biotin of nanocrystalline mark with Embodiment 1 is consistent.
2. model matrix used in complex system experiment is 10% hyclone.
3. standard working curve used in experiment is consistent with the experimental method of embodiment 1.
4. investigate NaEuF4The miRNA-21 rate of recovery in nanocrystalline Fluorescence amplification system of determination complex system sample, including Following steps：
1) it is coated with：Capture probe CP is diluted to 100nM with 0.05mol/L carbonate buffer solution, in 96 hole polyphenyl second In alkene plate, 100 μ L, 37 DEG C of incubation 1h are added per hole, liquid in hole is discarded, is washed with PBST lavation buffer solutions 3 times.
2) close：Prepared with 0.05mol/L carbonate buffer solution 0.1% monoethanolamine, 300 μ L, 37 DEG C are added per hole 1h is incubated, liquid in hole is removed, is washed with PBST lavation buffer solutions 3 times.
3) it is loaded：With 10% hyclone buffer concentration from low to high, 20U ribonuclease inhibitors are contained 100fM, 1pM, 10pM miRNA-21 simulation serum solutions, 100 μ L simulation serum solution is added per hole, and 37 DEG C of incubations 1 are small When, liquid in hole is discarded, is washed with PBST lavation buffer solutions 3 times.
4) detection probe DP is added：10nM DP solution is prepared with PBS, 100 μ L, 37 DEG C of incubations are added per hole 0.5h, discards liquid in hole, is washed with PBST lavation buffer solutions 3 times.
5) Avidin is added：5 μ g/mL avidin solution is prepared with PBS, 100 μ L, 37 DEG C of incubations are added per hole 0.5h, discards liquid in hole, is washed with PBST lavation buffer solutions 3 times.
6) NaEuF is added4The biotin of nanocrystalline mark：10 μ g/mL NaEuF is prepared with PBS4Nanocrystalline mark The biotin of note, 100 μ L, 37 DEG C of incubation 0.5h are added per hole, liquid in hole is discarded, is washed with PBST lavation buffer solutions 6 times.
7) enhancing liquid is added：200 μ L enhancing liquid is added per hole, fluorescence signal is detected using time resolution, design parameter is：Swash Send out wavelength 340nm, launch wavelength 617nm, the μ s of time delay 100.
8) rate of recovery is determined：Working curve using the gained of embodiment 1 calculates returning corresponding to Serum experiments as standard curve Yield.
The computational methods are：It is C by concentration known0The measure fluorescent value of blood serum sample to bring standard curve fit into public Formula obtains measurement concentration C, and concentration C is substituted into formula C/C0× 100%, that is, obtain the rate of recovery.
Fig. 5 gives the investigation result for the miRNA-21 rate of recovery in complex system sample described in embodiment 3.
It is computed understanding, the rate of recovery is between 90.2-108%, and the coefficient of variation is less than 10.1%, as a result shows, this Embodiment detection architecture can effectively shield the ambient interferences of complex system, and detection method has good precision and reproduction Property.

Claims (9)

1. a kind of miRNA detection methods based on rare earth nano material Fluorescence amplification, the described method comprises the following steps：
(1) capture probe is provided, the capture probe is molecular beacon structure, and sequence is：5 '-free segment1- stem1- ring portion- Stem2- free segment2- 3 ', the ring portion is energy specific recognition target miRNA sequence, the stem1And stem2It is complementary Form cane structure, the free segment1With free segment2Not with ring portion, stem1And stem2It is complementary；
(2) sample containing miRNA to be measured is added；
(3) stem of the detection probe of biotin labeling, the detection probe and capture probe is added2With free segment2It is complementary；
(4) Avidin of rare earth nano material mark is added；Or, Avidin is first added, rare earth nano material is added afterwards The biotin of mark；
(5) enhancing liquid is added；
(6) fluorescence signal is detected using time resolution.
2. detection method according to claim 1, the free segment of the capture probe1Sequence is AAGCTGACCTCT.
3. detection method according to claim 1 or 2, the free segment of the capture probe2Sequence is TTTTTTT.
4. the stem in the detection method according to claim any one of 1-3, the capture probe1Sequence is TGGACA, stem Portion2Sequence is TGTCCA.
5. the detection method according to claim any one of 1-4, the sequence of the detection probe is：AAAAAAATGGACA.
6. the ring portion sequence in the detection method according to claim any one of 1-5, the capturing probe is： TCAACATCAGTCTGATAAGCTA, sequence energy specific recognition miRNA-21.
7. the detection method according to claim any one of 1-6, the rare earth nano material is XYF4It is nanocrystalline, the X choosings One or more from lithium, sodium, potassium etc., one or more of the Y in europium, samarium, terbium, dysprosium；It is preferred that the rare earth is received Rice material is NaEuF4It is nanocrystalline.
8. the detection method according to claim any one of 1-7, the capturing probe is fixed in the way of covalent coupling On solid phase carrier.
9. the detection method according to claim any one of 1-8, the enhancing liquid contains Triton X-100, naphthoic acid three Fluorine acetone, trioctylphosphine and water；It is preferred that the composition of the enhancing liquid is：Contain 1g Triton X- in every liter of enhancing liquid 100,26.6mg naphthoyltrifluoroacetones, 193mg trioctylphosphines, pH 2.3.
CN201710175548.3A 2017-03-22 2017-03-22 A kind of MicroRNA detection method based on rare earth nano material Fluorescence amplification Pending CN107012210A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710175548.3A CN107012210A (en) 2017-03-22 2017-03-22 A kind of MicroRNA detection method based on rare earth nano material Fluorescence amplification

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710175548.3A CN107012210A (en) 2017-03-22 2017-03-22 A kind of MicroRNA detection method based on rare earth nano material Fluorescence amplification

Publications (1)

Publication Number Publication Date
CN107012210A true CN107012210A (en) 2017-08-04

Family

ID=59440045

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710175548.3A Pending CN107012210A (en) 2017-03-22 2017-03-22 A kind of MicroRNA detection method based on rare earth nano material Fluorescence amplification

Country Status (1)

Country Link
CN (1) CN107012210A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108220395A (en) * 2018-03-07 2018-06-29 深圳大学 A kind of nucleic acid detection method
CN110129417A (en) * 2019-05-23 2019-08-16 济南国科医工科技发展有限公司 MiRNA detection method based on discoloration silver nanoclusters and hybridization chain reaction
CN112034160A (en) * 2019-06-03 2020-12-04 中国科学院福建物质结构研究所 Circulating tumor cell detection kit based on rare earth nano material fluorescence amplification and application thereof
CN113528627A (en) * 2021-08-10 2021-10-22 浙江大学 Method for detecting micro RNA based on catalytic hairpin assembly amplification and inductively coupled plasma mass spectrometry

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103969432A (en) * 2014-03-27 2014-08-06 中国科学院福建物质结构研究所 Method for realizing time-resolved fluorescence immunoassay through dissolution enhancement of rear earth nano material

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103969432A (en) * 2014-03-27 2014-08-06 中国科学院福建物质结构研究所 Method for realizing time-resolved fluorescence immunoassay through dissolution enhancement of rear earth nano material

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LAN JM ET AL.: "A photoluminescent biosensor based on long-range self-assembled DNA cascades and upconversion nanoparticles for the detection of breast cancer-associated circulating microRNA in serum samples", 《RSC ADVANCES》 *
ZHOU SY ET AL.: "Dissolution-Enhanced Luminescent Bioassay Based on Inorganic Lanthanide Nanoparticles", 《ANGEWANDTE CHEMIE-INTERNATIONAL EDITION》 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108220395A (en) * 2018-03-07 2018-06-29 深圳大学 A kind of nucleic acid detection method
CN110129417A (en) * 2019-05-23 2019-08-16 济南国科医工科技发展有限公司 MiRNA detection method based on discoloration silver nanoclusters and hybridization chain reaction
CN110129417B (en) * 2019-05-23 2023-04-25 济南国科医工科技发展有限公司 miRNA detection method based on color-changing silver nanoclusters and hybridization chain reaction
CN112034160A (en) * 2019-06-03 2020-12-04 中国科学院福建物质结构研究所 Circulating tumor cell detection kit based on rare earth nano material fluorescence amplification and application thereof
CN113528627A (en) * 2021-08-10 2021-10-22 浙江大学 Method for detecting micro RNA based on catalytic hairpin assembly amplification and inductively coupled plasma mass spectrometry

Similar Documents

Publication Publication Date Title
CN107012210A (en) A kind of MicroRNA detection method based on rare earth nano material Fluorescence amplification
Wang et al. A reusable aptamer-based evanescent wave all-fiber biosensor for highly sensitive detection of Ochratoxin A
Zhao et al. Composite QDs@ MIP nanospheres for specific recognition and direct fluorescent quantification of pesticides in aqueous media
Luo et al. ICP-MS-based multiplex and ultrasensitive assay of viruses with lanthanide-coded biospecific tagging and amplification strategies
Kang et al. Applications of nanotechnology in virus detection, tracking, and infection mechanisms
CN103994946A (en) High-sensitivity multi-target quantitative analysis method based on gas pressure detection
CN102495038B (en) Optical ion sensing film for detecting metal ions, and preparation method and application thereof
Agrawal et al. Nanosensors and their pharmaceutical applications: a review
Hu et al. Chemical-modified nucleotide-based elemental tags for high-sensitive immunoassay
Huerta-Aguilar et al. Simultaneous recognition of cysteine and cytosine using thiophene-based organic nanoparticles decorated with Au NPs and bio-imaging of cells
Liu et al. Label-free dsDNA-Cu NPs-based fluorescent probe for highly sensitive detection of L-histidine
CN112034160B (en) Circulating tumor cell detection kit based on rare earth nano material fluorescence amplification and application thereof
CN108169303A (en) Aptamer electrochemical sensor based on metal-organic framework material as signal probe
JP6563475B2 (en) Rare earth nanomaterial dissolution / enhanced time-resolved fluorescence immunoassay
CN103842821A (en) Method for analyzing biomolecules and biomolecule analyzer
CN101467045A (en) Increased specificity of analyte detection by measurement of bound and unbound labels
US20050069900A1 (en) Analyte sample detection
Li et al. A novel sensor for the detection of alkaline phosphatase activity based on the self-assembly of Eu3+-doped oxide nanoparticles and heptamethine cyanine dye
Ren et al. Quantum dot probes for cellular analysis
CN104003370A (en) Preparation method of fluorescent carbon quantum dot probe for detecting beryllium in water
Yuan et al. Viruslike element-tagged nanoparticle inductively coupled plasma mass spectrometry signal multiplier: membrane biomarker mediated cell counting
CN104845607A (en) Aggregation induced luminescence nanofluorescent probe and preparation method therefor
Lu et al. Bi-functionalized aptasensor for ultrasensitive detection of thrombin
CN103323607A (en) Method for simultaneously measuring two-component plant hormones
Liu et al. A novel SERS biosensor for ultrasensitive detection of mercury (II) in complex biological samples

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20170804