CN107007578A - Application of the sulforaphane in treatment leukemia medicament is prepared - Google Patents
Application of the sulforaphane in treatment leukemia medicament is prepared Download PDFInfo
- Publication number
- CN107007578A CN107007578A CN201710109473.9A CN201710109473A CN107007578A CN 107007578 A CN107007578 A CN 107007578A CN 201710109473 A CN201710109473 A CN 201710109473A CN 107007578 A CN107007578 A CN 107007578A
- Authority
- CN
- China
- Prior art keywords
- sulforaphane
- genes
- apoptosis
- leukemia
- prepared
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/13—Amines
- A61K31/145—Amines having sulfur, e.g. thiurams (>N—C(S)—S—C(S)—N< and >N—C(S)—S—S—C(S)—N<), Sulfinylamines (—N=SO), Sulfonylamines (—N=SO2)
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses application of the sulforaphane in treatment leukemia medicament is prepared, belong to the new application technical field of sulforaphane.Technical scheme main points are：Application of the sulforaphane in treatment leukemia medicament is prepared, i.e. sulforaphane are by raising Bax genes and the genes of Caspase 3 and lowering the propagation that the genes of Bcl 2 promote apoptosis of leukemia and then suppress leukaemia.Present invention System Approach influences of the SFN to acute leukemia cellses KG1a and K562 Apoptosis first, as a result prove that SFN can promote acute leukemia cellses apoptosis by regulating and controlling Bax genes, the genes of Bcl 2 and the genes of caspase 3, this is not only theoretic breakthrough, and with potential clinical meaning, a kind of brand-new thinking and potential treatment path are provided for treatment leukaemia.
Description
Technical field
The present invention relates to the new application technical field of sulforaphane, and in particular to sulforaphane is in treatment leukemia medicament
Application.
Background technology
Sulforaphane（Sulforaphane, SFN）Be it is a kind of be present in broccoli and other brassicaceous vegetables it is different
Rhodanate material, with anti-proliferative capacity, it has now been found that SFN is a variety of to oophoroma, carcinoma of urinary bladder, prostate cancer etc. pernicious
The growth of tumour cell is inhibited, is a kind of new anticancer component.But, effects of the SFN to hematopoietic tumor cell
And mechanism then report it is less.
Cell cycle out of control is to cause one of major reason of malignant proliferative disorders.Acute leukemia is a class Hematopoietic Stem
The Clonal disease of malignant, leukaemia because proliferation out of control, dysdifferentiation, apoptosis are obstructed etc. mechanism in marrow and other
Largely breed in hematopoietic tissue, and infiltrate other tissues and organ, while normal hematopoiesis is suppressed.Bcl-2 gene families be with
The family that Apoptosis is closely related, wherein Bcl-2 and Bax adhere to suppress apoptosis and promotion apoptosis two in Bcl-2 families separately
Part, Bcl-2 plays the effect of protection cell, reduces Apoptosis, and Bax then plays the effect of inducing cell apoptosis, both
Expression in the cell maintains poised state, forms an apoptosis regulating system, common regulating cell propagation and apoptosis.When
Bax-Bax homodimers are formed when Bax is over-expressed, promote Apoptosis；As Bcl-2 expression quantity rises, Bax homologous two
Aggressiveness is just separated, and Bcl-2 and Bax can form the Bax-Bcl-2 dimer more more stable than Bax-Bax, then suppresses withering for cell
Die.Therefore, the proportionate relationship between the albumen of Bax/Bcl-2 two is to determine and malignant tumour strong and weak to Apoptosis inhibitory action
The key factor of prognosis.Aspartic acid proteolysis containing cysteine（Caspase）, Caspase is one group and is present in cell
There is the protease of similar structures in matter.Caspase and eukaryotic apoptosis are closely related, and participate in the growth of cell, differentiation
Adjusted with apoptosis, be also the important component of Apoptosis path.Wherein, Caspase-3 is considered as one and is related to not
Same cell line apoptosis performs most common member, these protein control Mitochondrial outer membrane permeabilization（MOMP）And mitochondrial membrane
The release of space protein such as cromoci.
In all kinds of adult leukemias, with acute myeloid leukemia（Acute myeloid leukaemia, AML）Morbidity
Rate highest, and chemotherapy remission rate is relatively low.KGla cells and K562 cells are be respectively derived from acute myeloid leukemia resistance thin
The cell line of foundation is separated in the patient of born of the same parents' strain and chronic leukemia acute change, is the ideal of current research acute myeloid leukemia
Model, the present invention acts on KG1a cells and K562 cells with the SFN of various concentrations, observes it to Leukemia Cell Proliferation, apoptosis
And the influence of related gene expression, the effect of analysis SFN suppression Leukemia Cell Proliferations and mechanism.
The content of the invention
It is an object of the invention to provide the new application of sulforaphane, i.e. sulforaphane in treatment leukemia medicament is prepared
New opplication.
In fact, the new opplication the present invention relates to sulforaphane in treatment leukemia medicament is prepared, i.e. sulforaphane lead to
Cross the propagation that regulation and control Apoptosis suppresses leukaemia.
Specifically, the new opplication the present invention relates to sulforaphane in treatment leukemia medicament is prepared, i.e. sulforaphane lead to
Cross regulation and control Bax genes, Bcl-2 genes and Caspase-3 genes induced apoptosis in leukemia cell lines and then suppress leukaemia's
Propagation.
New opplication of the sulforaphane involved in the present invention in treatment leukemia medicament is prepared, i.e. sulforaphane passes through up-regulation
Bax genes and Caspase-3 genes and downward Bcl-2 genes promote apoptosis of leukemia and then suppress the increasing of leukaemia
Grow.
Further limit, described leukaemia is KG1a cells and K562 cells.
Present invention System Approach influences of the SFN to acute leukemia cellses KG1a and K562 Apoptosis first, as a result
Prove that SFN can promote acute leukemia cellses apoptosis by regulating and controlling Bax genes, Bcl-2 genes and caspase-3 genes, this
Be not only theoretic breakthrough, and with potential clinical meaning, for treatment leukaemia provide a kind of brand-new thinking with
Potential treatment path.
Brief description of the drawings
Fig. 1 is SFN to KGla cells and the influence figure of K562 cell proliferation activities, and CCK8 detections and micro- sem observation are shown
The SFN of various concentrations（0、4、8、12μmol/L）Act on after KGla cells and K562 cells, cell proliferation activity is with cell
Concentration and extended durations of action and reduce；
Fig. 2 be flow cytomery SFN to KGla cells and the influence figure of K562 Apoptosis, as a result show various concentrations
SFN（0、4、8、12μmol/L）The early apoptosis rate for acting on KGla cells 48h is respectively 0,3.12%, 13.33%, 28.18%, no
With the SFN of concentration（0、4、8、12μmol/L）Effect K562 cells 48h early apoptosis rate is respectively 0,2.81%, 10.68%,
30.27%；
Fig. 3 is that Western blotting detect SFN to Bax genes, Bcl-2 genes and Caspase-3 bases in leukaemia
Because of the influence figure of protein expression；
Fig. 4 is influence figures of the RT-PCR detections SFN in leukaemia to apoptogene Bax, Bcl-2 and Caspase-3.
Embodiment
The above to the present invention is described in further details by the following examples, but this should not be interpreted as to this
The scope for inventing above-mentioned theme is only limitted to following embodiment, and all technologies realized based on the above of the present invention belong to this hair
Bright scope.
Embodiment
1st, experiment material
Sulforaphane（Lot number 28911701）Purchased from LKT Laboratories companies of the U.S., purity 98%.1640 culture medium and tire
Cow's serum is U.S.'s Gibco Products.CCK-8 kits are purchased from Dojindo companies of Japan, Annexin-V/PI Apoptosis
Detection reagent（U.S. company BD, lot number 5121706）, RNA extracts kits, Reverse Transcriptase kit, 2 × Taq of PCR reagent PCR
Master Mix, DNA Marker are purchased from Shanghai Tiangeng, agarose（Spain Biowest）, primer is by Shanghai bioengineering
Company synthesizes, and rabbit-anti people Bax mAb, rabbit-anti people Bcl-2 mAb, rabbit-anti people Caspase-3 mAb produce for Abcam companies of the U.S.
Product, anti-human GAPDH pAb and HRP- goat-anti rabbit pAb provides for century Kang Wei company.Flow cytometer（FACSCaibur types）For
U.S. company BD product, MK3 ELIASAs and the U.S. of ND2000 ultramicrospectrophotometers system Thermo Products, gel figure
Picture analysis system is produced by Genegenius companies of Britain, and flow cytometer is U.S. company BD, and Eclipse Ti-s are inverted aobvious
Micro mirror is purchased from Nikon companies of Japan.
2nd, cell culture
Human acute myeloid leukemia cell KGla and K562 cell line is preserved by this laboratory, with containing 10% hyclone
Penicillin l00U/mL, the μ g/mL of streptomysin 100, the μ of glutamine 100 are previously added in RPMI1640 medium cultures, culture medium
Mol/L, puts the CO that volume fraction is 5%2Incubator changes liquid passage according to cell growth state, taken the logarithm in time in 37 DEG C of cultures
Growth period cell does follow-up test.
3rd, cell proliferation experiment
By the exponential phase cell of Secondary Culture, count, be 1 × 10 according to every hole cell density5/ L is inoculated in the culture of 96 holes
In plate, be separately added into final concentration be respectively 0,2,4,6,8,10,12 μm of ol/L SFN（0.9% NS dissolved dilutions are 2 × 103μ
mol/L）, 37 DEG C are cultivated after 24h, 48h, 72h, and CCK-8 reagents 10uL is added per hole and continues to be incubated 4h, in enzyme-linked immunosorbent assay instrument
OD values are the OD values in each hole of measurement at 450nm, and experiment is repeated 3 times, averaged.Comparative survival rate of cells=（Experimental group-blank
Group）/（Control group-blank group）×100%.According to KG1a cell survival rates, cell growth curve is drawn, suitable SFN concentration is chosen
Do subsequent experimental.
4th, flow cytometer showed Apoptosis
KG1a cells 1 × 10 after collection 0,4,8,12 μm of ol/L SFN processing6/ L, cell is washed with precooling PBS 2 times, is added
100 μ L 1 × Binding Buffer suspension cells；Plus 5 μ L Annexin V-FITC mix after, add 5 μ L PI dye
Color, 4 DEG C of lucifuges are incubated after 15min, add 400 μ L 1 × Binding Buffer suspension cells, flow cytometer detection.
Often pipe obtains 10000 cells, with CellQuest analysis software apoptosis rates.
5th, western bloting analyze Bax, Bcl-2 and Caspase-3 albumen
KG1a cells after collection 0,4,8,12 μm of ol/L SFN effects 48h, ice-cold SDS lysis buffers dissolving
20min, 12000 × g centrifuge 15min, and extract proteins, BCA protein concentrations detection kit determines protein content, albumen applied sample amount
For 30 μ g, 10wt% SDS-PAGE electrophoresis；Electricity goes to pvdf membrane, 5wt% skimmed milk power closing, 1:1000 4 DEG C of primary antibodies are stayed overnight,
TBST is washed after film 3 times, and 1:5000 secondary antibody room temperature 2h, then washed 3 times with TBST, the development of ECL chemical luminescence for liquid is taken pictures.With
Image J are analyzed experimental result.
6th, RT-PCR detects Bax, Bcl-2 and Caspase-3 mRNA expression
KG1a cells after collection 0,4,8,12 μm of ol/L SFN processing 48h, extract total serum IgE with Trizol methods, use nucleic acid-protein
Quantitative instrument detects RNA purity and concentration, and purity is between 1.8-2.0, and concentration is in 1-3 μ g/ μ L.Carried out with Reverse Transcriptase kit inverse
Transcription synthesis cDNA, transcription system is 20uL.Bax primer sequence sense primers：5 '-TTTGCTTCAGGGTTTCATCC-3 ', under
Swim-the CAGTTGAAGTTGCCGTCAGA-3 ' of primer 5 ', amplified production 246bp；Bcl-2 primer sequence sense primers：5’-
GGATGCCTTTGTGGAACTGT-3 ', anti-sense primer：5 '-AGCCTGCAGCTTTGTTTCAT-3 ', amplified production 236bp；
Caspase-3：5 '-TGTTTGTGTGCTTCTGAGCC-3 ', 5 '-CACGCCATGTCATCATCAAC-3 ', amplified production
817bp；Internal reference β-actin primer sequence sense primers：5 '-AGAGCTACGAGCTGCCTGAC-3 ', anti-sense primer 5 '-
AGCACTGTGTTGGCGTACAG-3 ', amplified production 183bp.The primer is synthesized by Shanghai Sheng Gong Bioisystech Co., Ltd.
PCR reaction systems are 20 μ L, PCR amplification kit Taq PCR Mastermix 10 μ L, upstream and downstream primer each 0.4 μ L, cDNA
1 μ L, 95 DEG C of pre-degenerations 3min, 94 DEG C of 30s, Amplification 55 DEG C of 30s, 72 DEG C of 60s, 30 circulations, 72 DEG C of extension 5min.
5 μ L PCR primers are taken to be splined in 1wt% Ago-Gel, in 80V electrophoresis 30min.Take out gel and be placed in gel imaging analysis
Observed in system, Image J softwares are scanned gray value and analysis result.
7th, experimental result
1st, it is apparent that SFN has obvious suppression to the growing multiplication of KG1a cells and k562 cells from Fig. 1, and
And be in be decreased obviously trend as SFN extended durations of action and dosage increase its propagation.
2nd, it can be seen that SFN can act on KG1a cells in SFN and k562 is thin with the apoptosis of inducing leukemia cell from Fig. 2
After born of the same parents 48h, by the double dyes of Annexin V-FITC/PI, flow cytomery finds that with the increase of SFN concentration KG1a is thin
The early apoptosis rate of born of the same parents gradually increases, after 0,4,8,12 μm of ol/L SFN effect KG1a cells and K562 cells 48h, early apoptosis
Rate is respectively 0,3.12%, 13.33%, 28.18% and 0,2.81%, 28.18% and 30.27%.It can thus be appreciated that SFN can induce white blood
Sick Apoptosis, and with the increase of SFN concentration, the early apoptosis rate of KG1a cells and K562 cells becomes in gradually increase
Gesture.
3rd, as can be seen from Figure 3 with 0,4,8,12 μm of ol/L sulforaphane intervene after KG1a cells, K562 cells 48h,
Bax and Caspase-3 protein expressions significantly increase, and each concentration group and 0 μm of ol/L comparing difference are statistically significant（P﹤ 0.05）,
And Bcl-2 expression has declined, 12 μm of ol/L and 0 μm of ol/L comparing difference are statistically significant（P﹤ 0.05）.As a result Lay is shown
Fu sulfanes may be lowered Bc-l2 gene expressions and promote Apoptosis by raising Bax genes, and this expression regulation is present
In protein expression level.
4th, Fig. 4 employs PT-PCR detection methods, as a result further demonstrate sulforaphane have up-regulation Bax genes and
Caspase-3 genes and the function of lowering Bcl-2 genes, sulforaphane can be by raising Bax genes and Caspase-3 genes
And Bcl-2 genes promotion apoptosis of leukemia is lowered, and then suppress the propagation of leukaemia.
Embodiment above describes general principle, principal character and the advantage of the present invention, the technical staff of the industry should
Understand, the present invention is not limited to the above embodiments, the original for simply illustrating the present invention described in above-described embodiment and specification
Reason, under the scope for not departing from the principle of the invention, various changes and modifications of the present invention are possible, and these changes and improvements are each fallen within
In the scope of protection of the invention.
SEQUENCE LISTING
<110>Xinxiang College of Medical Science
<120>Application of the sulforaphane in treatment leukemia medicament is prepared
<130> 2017
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> RNA
<213>Artificial sequence
<400> 1
TTTGCTTCAGGGTTTCATCC 20
<210> 2
<211> 20
<212> RNA
<213>Artificial sequence
<400> 1
CAGTTGAAGTTGCCGTCAGA 20
<210> 3
<211> 20
<212> RNA
<213>Artificial sequence
<400> 1
GGATGCCTTTGTGGAACTGT 20
<210> 4
<211> 20
<212> RNA
<213>Artificial sequence
<400> 1
AGCCTGCAGCTTTGTTTCAT 20
<210> 5
<211> 20
<212> RNA
<213>Artificial sequence
<400> 1
TGTTTGTGTGCTTCTGAGCC 20
<210> 6
<211> 20
<212> RNA
<213>Artificial sequence
<400> 1
CACGCCATGTCATCATCAAC 20
<210> 7
<211> 20
<212> RNA
<213>Artificial sequence
<400> 1
AGAGCTACGAGCTGCCTGAC 20
<210> 8
<211> 20
<212> RNA
<213>Artificial sequence
<400> 1
AGCACTGTGTTGGCGTACAG 20
Claims (5)
1. application of the sulforaphane in treatment leukemia medicament is prepared.
2. application of the sulforaphane according to claim 1 in treatment leukemia medicament is prepared, it is characterised in that：It is described
The sulforaphane propagation that passes through regulating cell Apoptosis inhibitor leukaemia.
3. application of the sulforaphane according to claim 2 in treatment leukemia medicament is prepared, it is characterised in that：It is described
Sulforaphane by regulating and controlling Bax genes, Bcl-2 genes and Caspase-3 genes induced apoptosis in leukemia cell lines and then suppression
The propagation of leukaemia.
4. application of the sulforaphane according to claim 3 in treatment leukemia medicament is prepared, it is characterised in that：It is described
Sulforaphane by raise Bax genes and Caspase-3 genes and lower Bcl-2 genes promote apoptosis of leukemia and then
Suppress the propagation of leukaemia.
5. application of the sulforaphane in treatment leukemia medicament is prepared according to any one in claim 2-4, its
It is characterised by：Described leukaemia is KG1a cells and K562 cells.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710109473.9A CN107007578A (en) | 2017-02-27 | 2017-02-27 | Application of the sulforaphane in treatment leukemia medicament is prepared |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710109473.9A CN107007578A (en) | 2017-02-27 | 2017-02-27 | Application of the sulforaphane in treatment leukemia medicament is prepared |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107007578A true CN107007578A (en) | 2017-08-04 |
Family
ID=59440546
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710109473.9A Pending CN107007578A (en) | 2017-02-27 | 2017-02-27 | Application of the sulforaphane in treatment leukemia medicament is prepared |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107007578A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115844869A (en) * | 2022-12-19 | 2023-03-28 | 新乡医学院 | Application of sulforaphane in reversing drug resistance of cytarabine resistant leukemia cells and pharmaceutical composition |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101120948A (en) * | 2006-08-08 | 2008-02-13 | 普文英 | Compound composition with chemical protecting, cancer preventing and treating use |
| CN101474170A (en) * | 2008-12-04 | 2009-07-08 | 中国人民解放军第三军医大学 | Application of isosulfocyanate compound in preparing medicament for treating leukemia |
| WO2010065329A2 (en) * | 2008-11-25 | 2010-06-10 | The Board Of Regents Of The University Of Texas System | Nanoparticles for cancer treatment |
-
2017
- 2017-02-27 CN CN201710109473.9A patent/CN107007578A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101120948A (en) * | 2006-08-08 | 2008-02-13 | 普文英 | Compound composition with chemical protecting, cancer preventing and treating use |
| WO2010065329A2 (en) * | 2008-11-25 | 2010-06-10 | The Board Of Regents Of The University Of Texas System | Nanoparticles for cancer treatment |
| CN101474170A (en) * | 2008-12-04 | 2009-07-08 | 中国人民解放军第三军医大学 | Application of isosulfocyanate compound in preparing medicament for treating leukemia |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115844869A (en) * | 2022-12-19 | 2023-03-28 | 新乡医学院 | Application of sulforaphane in reversing drug resistance of cytarabine resistant leukemia cells and pharmaceutical composition |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Huang et al. | Interleukin-8 induces expression of FOXC1 to promote transactivation of CXCR1 and CCL2 in hepatocellular carcinoma cell lines and formation of metastases in mice | |
| Alisi et al. | Multidrug resistance and cancer stem cells in neuroblastoma and hepatoblastoma | |
| Hao et al. | Role of chemokine receptor CXCR7 in bladder cancer progression | |
| Li et al. | Glucose regulated protein 78: a critical link between tumor microenvironment and cancer hallmarks | |
| Chang et al. | Mesothelin enhances invasion of ovarian cancer by inducing MMP-7 through MAPK/ERK and JNK pathways | |
| Liu et al. | Expression of intercellular adhesion molecule 1 by hepatocellular carcinoma stem cells and circulating tumor cells | |
| Liu et al. | CCL5 promotes VEGF-dependent angiogenesis by down-regulating miR-200b through PI3K/Akt signaling pathway in human chondrosarcoma cells | |
| Zhong et al. | Mesenchymal stem cells in inflammatory microenvironment potently promote metastatic growth of cholangiocarcinoma via activating Akt/NF-κB signaling by paracrine CCL5 | |
| Kayamori et al. | NOTCH3 is induced in cancer-associated fibroblasts and promotes angiogenesis in oral squamous cell carcinoma | |
| Chen et al. | Clinicopathological and prognostic significance of galectin-1 and vascular endothelial growth factor expression in gastric cancer | |
| Liu et al. | IgG gene expression and its possible significance in prostate cancers | |
| van der Schaft et al. | Absence of lymphangiogenesis in ductal breast cancer at the primary tumor site | |
| Matušan-Ilijaš et al. | Osteopontin expression correlates with nuclear factor-κB activation and apoptosis downregulation in clear cell renal cell carcinoma | |
| Zhuang et al. | MicroRNA-23a depletion promotes apoptosis of ovarian cancer stem cell and inhibits cell migration by targeting DLG2 | |
| Shen et al. | Estrogen receptor α-NOTCH1 axis enhances basal stem-like cells and epithelial-mesenchymal transition phenotypes in prostate cancer | |
| Yu et al. | Overexpression of astrocyte elevated gene-1 (AEG-1) in cervical cancer and its correlation with angiogenesis | |
| Liu et al. | Retracted: microRNA‐137 promotes endothelial progenitor cell proliferation and angiogenesis in cerebral ischemic stroke mice by targeting NR4A2 through the Notch pathway | |
| Patten et al. | SCARF-1 promotes adhesion of CD4+ T cells to human hepatic sinusoidal endothelium under conditions of shear stress | |
| Chen et al. | Overexpression of CXCR7 induces angiogenic capacity of human hepatocellular carcinoma cells via the AKT signaling pathway | |
| Li et al. | Tumor-derived exosome-educated hepatic stellate cells regulate lactate metabolism of hypoxic colorectal tumor cells via the IL-6/STAT3 pathway to confer drug resistance | |
| Xue et al. | Overexpression of FYN suppresses the epithelial-to-mesenchymal transition through down-regulating PI3K/AKT pathway in lung adenocarcinoma | |
| Ma et al. | Circular RNA circ_0014717 suppresses hepatocellular carcinoma tumorigenesis through regulating miR-668-3p/BTG2 axis | |
| Zheng et al. | Down-regulation of lncRNA snaR is correlated with postoperative distant recurrence of HPV-negative cervical squamous cell carcinoma | |
| Parent et al. | Mammalian target of rapamycin activation impairs hepatocytic differentiation and targets genes moderating lipid homeostasis and hepatocellular growth | |
| She et al. | The effect of hepatocellular carcinoma-associated fibroblasts on hepatoma vasculogenic mimicry |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170804 |