CN106987594A - The combination of UV opsin genes and primer and application of a kind of rape aphid - Google Patents
The combination of UV opsin genes and primer and application of a kind of rape aphid Download PDFInfo
- Publication number
- CN106987594A CN106987594A CN201710409981.9A CN201710409981A CN106987594A CN 106987594 A CN106987594 A CN 106987594A CN 201710409981 A CN201710409981 A CN 201710409981A CN 106987594 A CN106987594 A CN 106987594A
- Authority
- CN
- China
- Prior art keywords
- aphid
- rape
- opsin
- primer
- phototaxis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Insects & Arthropods (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the combination of the UV opsin genes and primer of a kind of rape aphid and application, it is related to agricultural biological technical field.The UV opsin genes for the rape aphid that the present invention is provided, its base sequence is as shown in Seq ID No.5, the expression quantity of the result of study display UV opsin genes of the present invention and the phototaxis of rape aphid are significantly correlated, it can be used as the mark for determining rape aphid phototaxis, pass through the analysis and detection to the UV opsin gene expression quantity, the phototaxis behavior of rape aphid can be measured or anticipation, the UV opsin genes can be as mark in control of aphids, the field such as the prediction of aphid insect pest situation or aphid early warning carries out extensive use, basis and technical support are provided to improve trapping effect using the behavior of aphid phototaxis.
Description
Technical field
The present invention relates to agricultural biological technical field, a kind of UV opsin genes in particular to rape aphid and
Primer is combined and applied.
Background technology
Cabbage type rape belongs to Cruciferae brassica plant, is commonly called as rape, originates in Europe.Rape is main in the world
One of oil crops, be also the maximum winter oil crops of China's sown area.Rapeseed area and total yield are planted throughout the year by China
Amount is at the forefront in the world, and national rapeseed sown area reaches 113,010,000 mu within 2015, and total output is about 14,930,000 tons, occupies generation
Boundary's second.
With being continuously increased for rapeseed cultivation area, insect pest is also on the rise, such as aphid, cabbage caterpillar.In recent years, it is national
To promote agricultural development mode to change, agricultural production security, agricultural product quality and safety and ecological environment security are ensured, promotes agricultural
Sustainable development, is formulated《To the year two thousand twenty fertilizer application amount zero growth rate action scheme》With《Increase to the year two thousand twenty Pesticide use amount zero
Long action scheme》And No.1 Central File in 2017 clearly proposes General Promotion agricultural product quality and food safety standard.With
The fast development of science and technology and the continuous improvement of people's quality of life, the requirement to nuisanceless safety food is also more and more stronger
Strong, the sustainable Control Technology of harmful organism is particularly important, therefore the research of the sustainable Control Technology of rape insect pest is to lake
The development of northern Rape industry is significant.
Aphid is one of serious insect of harm in agricultural and forestry production, and the crops of main harm have cotton, wheat, vegetable
Dish, rape etc..Its harmfulness can allow plant can not normal growth and development, such as plant nutrient lacks, growth deformity, under yield
Drop, compromised quality etc..The research such as Cui Shufang finds that aggrieved cotton plant is shorter than normal strain by 70% or so, and fruit branch number reduces 60% or so.
2010-2011,260,000 hm of China262.5% is subject to serious black peach aphid harm in wheat, causes the underproduction 15%~60%.Oil
The main species of aphid have black peach aphid (Myzus persicae), radish aphid (Lipaphis erysimi) and brevicoryne brassicae on dish
3 kinds of (Brevicoryne brassicae), inhales nutrient with adult aphid or larvae aphid thorn, not only endangers growth of rape, and propagate a variety of
Virosis, influences the yield and quality of rape, causes serious economic loss.Therefore, the aggravation of rape aphid, to whole rape
Industry can all cause damage, particularly the influence to economic benefit.
Current chemical pesticide is always one of most widely used, maximally effective means in control of insect.Because aphid is general
Taken food in plant leaf blade, preventing and treating of the selective insecticide to rape aphid is not thorough enough, but broad spectrum insecticide can murder day
Enemy, destroys the ecosystem.Although chemical prevention instant effect, easy to use, pest resistance to insecticide increase, environment can be caused dirty
A series of problems, such as dye, destruction ecosystem.Accordingly, it would be desirable to scientific and reasonable use chemical pesticide.
Biological control mainly reaches the purpose for killing rape aphid using the interaction between living species.Current report pair
The active material that aphid has control action has：Alkaloid, terpene, flavonoids, phenols, light-activated toxin class etc..These materials pair
Rape aphid have kill, tag, food refusal, repellent, anesthesia or attracting action.The research discovery such as Liu Yue, tree-of-heaven leaf extract pair
The desinsection quick-acting phases of aphid and lasting period are all long.The research such as Jiang Xingfu shows that vegetables aphid can be total to by Wolbachia
Endophytic bacteria is infected, so as to regulate and control the mode of reproduction of vegetables aphid, can reduce aphis population quantity, indirectly the anti-harm eliminated aphis.
But biological control effect is slow, and cost is high, demands strict technology, therefore be not suitable for being widely applied.
Physical control is the most direct means of prevention of green prevention and control.The effect of trapping can be reached using the phototaxis of insect
Really, such as yellow card's trap, black light lamp, frequency trembler lamps.There are many reports both at home and abroad, if trapping lamp is to organic tea garden insect
Prevention effect is obvious.The research such as Dong Ningyu shows solar insect-killing light and lures the yellow plate green prevention and control technology combination of worm effectively to prevent and treat
Vega main diseases and insect pests.The research such as Peng Ping shows that yellow plate baiting technique preventing and treating tea place Aleurocanthus spiniferus and false eye leafhopper are imitated
Fruit is substantially.Li Juan etc. successfully catches and kills cigarette aphid using yellow plate, and the average preventive effect to cigarette aphid reaches 89.2%.It is anti-using physical measure
Insect is controlled, pollutes small and does not produce resistance, " benefit evil ratio " is drastically increased, meets the basic demand of green prevention and control.
It is a kind of common green prevention and control means in agricultural production using the Phototactic behavior of aphid trap and kill, but aphid
The mechanism of Phototactic behavior is not also clear so far, causes further to bring not using the Phototactic behavior raising trapping effect of aphid
Just.
The content of the invention
It is an object of the invention to provide a kind of UV opsin genes of rape aphid, it can be anti-in aphid as mark
Control, the prediction of aphid insect pest situation or the field extensive use such as aphid early warning.
Another object of the present invention is to provide above-mentioned UV opsin genes as mark to become light determining rape aphid
Application in property.
Another object of the present invention is to the UV opsin genes for providing above-mentioned rape aphid are anti-in aphid as mark
Control, aphid insect pest situation prediction or aphid early warning in application.
Another object of the present invention is to provide the primer combination for detecting above-mentioned UV opsin genes.The primer is combined
Qualitative and quantitative detection can be carried out to UV opsin genes.
Another object of the present invention is to provide above-mentioned primer combination to determine rape aphid UV opsin gene expression quantity
In application.
Another object of the present invention is to provide application of the above-mentioned primer combination in rape aphid phototaxis is determined.
Another object of the present invention is to provide above-mentioned primer combination in control of aphids, the prediction of aphid insect pest situation or aphid early warning
In application.
What the present invention was realized in：
A kind of UV opsin genes of rape aphid, its base sequence is as shown in Seq ID No.5.
Application of the UV opsin genes of above-mentioned rape aphid as mark in rape aphid phototaxis is determined.
The UV opsin genes of above-mentioned rape aphid are pre- in control of aphids, the prediction of aphid insect pest situation or aphid as mark
Application in police.
A kind of primer combination for being used to detect the UV opsin genes of above-mentioned rape aphid, it includes：Seq ID No.1
Shown sense primer and the anti-sense primer shown in Seq ID No.2.
Application of the above-mentioned primer combination in rape aphid UV opsin gene expression quantity is determined.
Application of the above-mentioned primer combination in rape aphid phototaxis is determined.
Application of the above-mentioned primer combination in control of aphids, the prediction of aphid insect pest situation or aphid early warning.
Compared with prior art, the beneficial effects of the invention are as follows：
The UV opsin genes for the rape aphid that the present invention is provided, its base sequence is as shown in Seq ID No.5, the present invention
Result of study show UV opsin genes expression quantity and rape aphid phototaxis it is significantly correlated, its can as determine rape
The mark of aphid phototaxis, by the analysis and detection to the UV opsin gene expression quantity, can become to rape aphid
Photosensitiveness behavior is measured or anticipation, and the UV opsin genes can be as mark in control of aphids, the prediction of aphid insect pest situation or aphid
The fields such as worm early warning carry out extensive use, and basis and technical support are provided to improve trapping effect using the behavior of aphid phototaxis.
In addition, the primer of the UV opsin genes provided by the present invention for detecting above-mentioned rape aphid is combined, it includes：Seq ID
The anti-sense primer shown in sense primer and Seq ID No.2 shown in No.1, with reference to fluorescence quantitative PCR detection technique, can be determined
The relative expression quantity of UV opsin genes can Accurate Determining aphid phototaxis it is strong and weak, be that aphid early warning and green prevention and control are provided
Key technology is supported, and primer combination has highly important application value in control of aphids field.
Brief description of the drawings
In order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be attached to what is used required in embodiment
Figure is briefly described, it will be appreciated that the following drawings illustrate only certain embodiments of the present invention, therefore is not construed as pair
The restriction of scope, for those of ordinary skill in the art, on the premise of not paying creative work, can also be according to this
A little accompanying drawings obtain other related accompanying drawings.
Fig. 1 is the rape aphid UV opsin conserved domain analysis results that the embodiment of the present invention 1 is provided；
Fig. 2 is the rape aphid UV opsin hydrophobicity analysis results that the embodiment of the present invention 1 is provided；
Fig. 3 is the prediction of rape aphid UV opsins transmembrane structure and Subcellular Localization that the embodiment of the present invention 1 is provided；
Fig. 4 is that the adjacent method that the embodiment of the present invention 1 is provided builds rape aphid UV opsin phylogenetic trees；
Fig. 5 is the 18S amplification efficiency figures for the rape aphid that the embodiment of the present invention 2 is provided；
Fig. 6 is the rape aphid UV opsin gene amplification efficiency figures that the embodiment of the present invention 2 is provided；
Fig. 7 is expression result of variations figure of the UV opsin genes of the offer of the embodiment of the present invention 2 in different worm states.
Embodiment
, below will be in the embodiment of the present invention to make the purpose, technical scheme and advantage of the embodiment of the present invention clearer
Technical scheme be clearly and completely described.Unreceipted actual conditions person, builds according to normal condition or manufacturer in embodiment
The condition of view is carried out.Agents useful for same or the unreceipted production firm person of instrument, are the conventional production that can be obtained by commercially available purchase
Product.
The UV opsin genes and primer of a kind of rape aphid of the embodiment of the present invention are combined below and application has
Body explanation.
In a first aspect, the invention provides a kind of UV opsin genes of rape aphid, its base sequence such as Seq ID
Shown in No.5.
The result of study of the present invention discloses the phototaxis of the expression quantity height and rape aphid of UV opsin genes first
It is significantly correlated, by the analysis and detection to the UV opsin gene expression quantity, the phototaxis behavior of rape aphid can be entered
Row is determined or anticipation, and it in fields such as control of aphids, the prediction of aphid insect pest situation or aphid early warning can extensively should as mark
With to provide basis using aphid phototaxis behavior raising trapping effect.
Second aspect, rape aphid is being determined the invention provides the UV opsin genes of above-mentioned rape aphid as mark
Application in worm phototaxis.
Further, in some embodiments of the present invention, using the sense primer and Seq shown in Seq ID No.1
Anti-sense primer shown in ID No.2 determines the relative expression quantity of above-mentioned UV opsin genes by fluorescent quantitative PCR technique.
According to the height of measured relative expression quantity, predict that the phototaxis of rape aphid is strong and weak；If the relative expression
Amount is high, then the phototaxis of rape aphid is strong, if the relative expression quantity is low, the phototaxis of rape aphid is weak.
Further, the phototaxis power for determining rape aphid comprises the following steps：
Step (1)：Gather rape aphid；
Step (2)：The RNA of aphid sample is extracted, reverse transcription is cDNA；
Step (3)：As standard form, guiding will be combined into above-mentioned primer sets after cDNA gradient dilutions obtained by step (2)
Real-time fluorescence quantitative PCR is carried out, standard curve is drawn, threshold value is set；
Step (4)：CDNA using aphid sample to be measured is template, to reference gene and target gene (UV opsin genes)
Real-time fluorescence quantitative PCR amplification is carried out, corresponding Ct values are obtained；
Step (5)：WithMethod calculates the relative expression quantity of UV opsin genes, passes through the UV opsins of the aphid of detection
The relative expression quantity of gene, predicts that its phototaxis is strong and weak.
By the UV opsin genes expression quantity in quick detection aphid can Accurate Prediction aphid phototaxis, so as to be
Alluring colouration plate is installed in time foundation is provided.Also it is control of aphids, aphid insect pest situation is predicted or aphid early warning provides foundation.
Further, in step (4), the primer sequence of reference gene is expanded as shown in sequence table Seq ID No.3-4.
Seq ID No.3:18SqF1:5’-TCAACACGGGAAACCTCACCA-3’；
Seq ID No.4:18SqR1:5’-CACCACCCACCGAATCAAGAA-3’。
The third aspect, the invention provides the UV opsin genes of above-mentioned rape aphid as mark control of aphids,
Application in the prediction of aphid insect pest situation or aphid early warning.
Further, in some embodiments of the present invention, oil is determined using above-mentioned UV opsin genes as mark
The phototaxis of vegetable aphid worm, control of aphids, the prediction of aphid insect pest situation or aphid early warning are carried out according to phototaxis result is determined.
If being judged according to the measurement result of phototaxis, the phototaxis of rape aphid is strong, carries out control of aphids, aphid worm
Feelings are predicted or aphid early warning.For example in the phototaxis of rape aphid strong period or the worm state stage such as larvae aphid of high phototaxis
In period, trapped and killed, trapping effect can be improved.
Fourth aspect, the invention provides a kind of primer sets for being used to detect the UV opsin genes of above-mentioned rape aphid
Close, it includes：The anti-sense primer shown in sense primer and Seq ID No.2 shown in Seq ID No.1.
Seq ID No.1:UVqF1:5’-TTGGCGATGTGCGATTTTT-3’；
Seq ID No.2:UVqR1:5’-CATTTGTGGCTCCTGCTCC-3’。
Combined using the primer, with reference to fluorescence quantitative PCR detection technique, can accurately detect the relative table of UV opsin genes
Up to amount can Accurate Determining aphid phototaxis it is strong and weak, be control of aphids, the prediction of aphid insect pest situation, aphid early warning and green prevention and control
Aphid etc. provides key technology support.
5th aspect, the invention provides the combination of above-mentioned primer in rape aphid UV opsin gene expression quantity is determined
Using.
6th aspect, the invention provides application of the above-mentioned primer combination in rape aphid phototaxis is determined.
Further, using shown in the sense primer and Seq ID No.2 shown in the Seq ID No.1 in the primer
Anti-sense primer determines the relative expression quantity of rape aphid UV opsin genes by fluorescent quantitative PCR technique.
Wherein, the base sequence of UV opsin genes is as shown in Seq ID No.5.
Further, the phototaxis of detection rape aphid refers to following steps：
Step (1)：Gather rape aphid；
Step (2)：The RNA of aphid sample is extracted, reverse transcription is cDNA；
Step (3)：As standard form, guiding will be combined into above-mentioned primer sets after cDNA gradient dilutions obtained by step (2)
Real-time fluorescence quantitative PCR is carried out, standard curve is drawn, threshold value is set；
Step (4)：CDNA using aphid sample to be measured is template, to reference gene and target gene (UV opsin genes)
Real-time fluorescence quantitative PCR amplification is carried out, corresponding Ct values are obtained；
Step (5)：WithMethod calculates the relative expression quantity of UV opsin genes, passes through the UV opsins of the aphid of detection
The relative expression quantity of gene, predicts that its phototaxis is strong and weak.
In step (4), the primer sequence of reference gene is expanded as shown in sequence table Seq ID No.3-4.Seq ID
No.3:18SqF1:5’-TCAACACGGGAAACCTCACCA-3’；Seq ID No.4:18SqR1:5’-
CACCACCCACCGAATCAAGAA-3’.Amplification cDNA templates are closed with above-mentioned primer sets.
The method of the detection aphid phototaxis that the present invention is provided, detection time is short, and accuracy is high, it is to avoid traditional to determine
Workload present in photosensitiveness method is big, the used time is longer, easily by defects such as such environmental effects, is an important technical innovation,
Efficiency is significantly improved.And moderate cost, convenient and swift, environmental protection, it is suitable for the extensive detection of farmland aphid.
7th aspect, the invention provides the combination of above-mentioned primer in control of aphids, the prediction of aphid insect pest situation or aphid early warning
Application.
It should be noted that because different classes of aphid opsin gene sequence has higher homology, therefore this
Inventing the UV opsin genes provided and primer combination can also be widely applied in the forecast and preventing and treating of other crop aphids.
The feature and performance to the present invention are described in further detail with reference to embodiments.
Embodiment 1：The clone of rape aphid UV opsin genes
1 materials and methods
1.1 experiment material
1.1.1 sample collection
Rape aphid (i.e. black peach aphid (Myzus persicae)) is integrated from new rural village developmental research institute of Hubei Province needed for experiment
Demonstration Base Rapeseed Field is collected, and is raised in laboratory planting pot rape, after larvae aphid grows up to alatae, uses 2mL cryopreservation tubes
Liquid nitrogen frozen immediately is collected, -80 DEG C of ultra low temperature freezers are then stored in, in case being used as the material of subsequent experimental.
1.1.2 key instrument and reagent
RNA extracts kit invitrogen TRIzol Reagent are purchased from invitrogen companies, chloroform, isopropanol
Purchased from Shanghai Sheng Gong companies；Reverse transcription PrimeScript II 1st Strand cDNA Synthesis Kit, RLM-RACE
The Kit of kit SMARTer RACE 5 '/3 ' are purchased from Takara companies；Archaeal dna polymerase Easy Taq, glue reclaim kit, carrier
PEASY-T1Cloning Kit and competent escherichia coli cell Trans 5a are purchased from Beijing Quan Shijin biotech companies；
PCR primer is synthesized by Shanghai Sheng Gong companies；DNA sequencing is undertaken by the Hui Yuan bio tech ltd of Wuhan Tian one.Other reagents
It is that domestic analysis is pure.
1.2 experimental method
1.2.1 aphid Total RNAs extraction and cDNA reverse transcriptions
Need to wear masks when extracting rape aphid total serum IgE using Trizol reagents, wear gloves operation, and it is more hand-off in time
Set, it is to avoid the interference of RNase in experiment, causes RNA pollution.Comprise the following steps that：
(1) taken in -80 DEG C of ultra low temperature freezers and freeze sample 50mg or so and pour into mortar (in advance Liquid nitrogen precooler), fully ground
Mill.Powder is transferred in the clean centrifuge tube added with 1mL Trizol reagents after grinding is uniform, acutely concussion, then room temperature is placed
4 DEG C of centrifugation 10min of 10min, 12000rpm, take supernatant to be transferred to new centrifuge tube.
(2) 0.2mL chloroforms are added, 30s is shaken, room temperature places 10min.4 DEG C of centrifugation 10min of 12000rpm.
(3) take upper strata aqueous phase to new centrifuge tube, 400 μ L isopropanol (isopropanol shifts to an earlier date 4 DEG C of precoolings) is added, after mixing
Room temperature places 10min, 4 DEG C of centrifugation 10min of 12000rpm, abandons supernatant.
(4) 75% ethanol 1mL washing precipitations are added, 4 DEG C of centrifugation 5min of precipitation suspension 2min, 12000rpm abandon supernatant.
(5) repeat step (4).Drying at room temperature 10min.
(6) 40 μ L RNase-free ddH are added2O, is completely dissolved RNA.
(7) 1 μ L RNA samples are drawn, determine total using trace protein nucleic acid spectrophotometer Nano-drop2000c
RNA concentration and quality, compares OD260/OD280 ratio in judgement RNA purity.It is generally acknowledged that ratio shows RNA matter for 2.0
Amount is good, pollution-free without degraded.
(8) RNA quality is detected by 1.2% agarose gel electrophoresis, the brightness for comparing 28S and 18S judges RNA matter
Amount.It is generally acknowledged that the brightness of 28S bands is 2 times of 18S, show that RNA mass is good.
Reverse transcription needs also exist for avoiding pollution problem when generating cDNA, prevents RNA degraded.Generally enter in superclean bench
Row operation, superclean bench shifts to an earlier date ultraviolet-sterilization half an hour.Specific reverse transcription step is as follows：
(1) the RNA concentration measured according to Nano-drop2000c, takes part RNA to be diluted to 1 μ g/ μ L and makees template preparation instead
Transcription, it is standby that total serum IgE can be stored in -80 DEG C of refrigerators.
(2) 2 μ L template ribonucleic acids are taken, 6 μ L RNase free ddH are sequentially added2O, 1 μ L Oligo dT Primer (50 μ
M), 1 μ L dNTP Mixture (10mM), it is 10 μ L to make volume.Of short duration centrifugation after mixing, 65 DEG C of heating 5min in PCR instrument,
Subsequent cooled on ice 10min.
(3) 4.5 μ L RNase free ddH are sequentially added in PCR pipe2O, 4 μ 5 × PrimeScript of l II
Buffer, 0.5 μ L RNase Inhibitor (40U/ μ L), 1 μ L PrimeScript II RTase (200U/ μ L), final
Cumulative volume is 20 μ L.Of short duration centrifugation after mixing, 42 DEG C of warm bath 60min in PCR instrument are flicked, then carries out 70 DEG C and heats 15min's
Inactivation reaction.The cDNA subsequently generated can be stored in standby in -20 DEG C of refrigerators.
1.2.2 rape aphid opsin gene design of primers and gene cloning
Design degenerate primer：The cDNA sequence that the vision gene of insect is downloaded on NCBI is compared, and finds conserved region,
The degenerate primer (table 1) of redesign amplification intermediate segment.
The rape aphid opsin gene design of primers of table 1
| Primer | Sequence (5'-3') |
| UVF1 | ACNCAYATHCCNGARCAYTGG |
| UVR1 | CGTTCATYTTYTTNGCYTGYTC |
| UV3RAF1 | GATTACGCCAAGCTTCCAGCGGTGTTTGCCAAGACGGT |
| UV5RAR1 | GATTACGCCAAGCTTCAAACACCGCTGGTAGCATTGACGC |
PCR clone gene fragments：Using cDNA as template, PCR reaction systems and condition are as follows：
| ddH2O | 13.6μL |
| 10×Buffer | 2.0μL |
| dNTP(2.5mM) | 1.6μL |
| cDNA | 1.0μL |
| Sense primer UVF1 (10 μM) | 0.8μL |
| Anti-sense primer UVR1 (10 μM) | 0.8μL |
| Taq enzyme | 0.2μL |
| Total system | 20.0μL |
PCR reaction condition be：94 DEG C of pre-degeneration 5min；94 DEG C of 30s, 45 DEG C of 30s, 72 DEG C of 30s, totally 35 circulations；72
DEG C extension 10min.After PCR terminates, after 5 μ L PCR primers of absorption are mixed with 6 × loading buffer, 1.2% fine jade is clicked and entered
In sepharose hole, 120V, 60mA, electrophoresis detection testing goal band observe knot in DNA protein gel imaging systems
Really.
1.2.3 aphid opsin gene sequence is expanded
CDNA ends rapid amplifying (RACE) technology is amplified complete using round pcr by known partial sequence
5 '/3 ' cDNA end, so as to obtain cDNA total length.
5 '/3 ' RACE operating procedures are carried out according to RACE kit specifications, and whole process is operated on ice in superclean bench.
5 '/3 ' RACE processing are carried out to the rape aphid total serum IgE of extraction.Concrete operation step is as follows：
(1) the RNA concentration measured according to Nano-drop2000c, takes part RNA to be diluted to 1 μ g/ μ L and makees template preparation instead
Transcription, it is standby that total serum IgE is stored in -80 DEG C of refrigerators.
(2) 4 μ L 5X First-Strand Buffer, 0.5 μ L DTT (100mM), 1 μ L are added in clean PCR pipe
DNTPs (20mM), volume is 5.5 μ l, and of short duration centrifugation, is placed on ice after mixing.
(3) two clean PCR pipes are taken, respectively the RACE and 3 ' of mark 5 ' RACE.8 μ L are sequentially added in 5 ' RACE pipes
Sterile H2O, 25 '-CDS-Primer A of μ L RNA, 1 μ L, volume is 11 μ L.9 μ L are sequentially added in 3 ' RACE pipes
Sterile H2O, 23 '-CDS-Primer A of μ L RNA, 1 μ L, volume is 12 μ L.Of short duration centrifugation after mixing, 72 in PCR instrument
DEG C heating 3min, 42 DEG C of warm bath 2min, then 14000rpm centrifuge 10s, be immediately placed on ice.
(4) 1 μ L SMARTer II A Oligonucleotide are added in the reaction solution of 5 ' RACE pipes.
(5) 0.5 μ L RNase Inhibitor (40U/ μ L) and 2 μ L are added in the mixed liquor of step (1) respectively
SMARTScribe Reverse Transcriptase (100U), volume is 8 μ L, and of short duration centrifugation, is placed on ice after mixing.
(6) 8 μ L mixed liquor is added separately to 5 ' RACE pipes and 3 ' RACE is managed, cumulative volume is 20 μ L, of short duration after mixing
Centrifugation.
(7) 42 DEG C of warm bath 90min, 70 DEG C of heating 10min in PCR instrument.
(8) the appropriate Tricine-EDTA Buffer (concentration of total serum IgE is added according to RNA concentration>200ng, is added
90 μ L Tricine-EDTA Buffer), i.e., 5 '/3 ' RACE cDNA templates are made respectively, -20 DEG C of refrigerators can be stored in.
The intermediate segment sequence obtained according to expanding before, 5 '/3 ' are separately designed using Primer Premier 5.0
RACE primer (table 1).RACE PCR reaction systems are as follows：
Use touchdown PCR reaction condition for：94 DEG C of pre-degeneration 5min；94 DEG C of 30s, 72 DEG C of 2min, 5 are followed
Ring；94 DEG C of 30s, 70 DEG C of 30s, 72 DEG C of 2min, 5 circulations；94 DEG C of 30s, 68 DEG C of 30s, 72 DEG C of 2min, 25 circulations；72 DEG C are prolonged
Stretch 10min.Because the clip size of amplification is in 0.2-2kb scope, therefore extension of time is set to 2min.If 25 circulations are not expanded
Go out purpose band or band disperse, desirable 5 μ L are further added by 5 circulations, most global cycles are no more than 40.touchdown PCR
After end, product detects testing goal band through 1.2% agarose gel electrophoresis, in DNA protein gel imaging systems
Observe result.
1.2.4TA clone
PCR or RACE products, operating procedure are reclaimed using EasyPure Quick Gel Extraction Kit kits
It is as follows：
(1) take 60 μ L PCR primer or RACE products, add the Loading buffer of 5 times of volumes, loading after mixing,
Glue is run through 1.2% agarose gel electrophoresis, target DNA band is cut, is put into clean centrifuge tube and weighs, with empty centrifuge tube
For control.
(2) the Gel Solubilization Buffer (GSB) for adding 3 times of volumes melt glue, and such as 100mg adds 300 μ L.
(3) in water-bath 55 DEG C melt glue 6min, interruption mixing, until glue melts completely.Separately by Elution Buffer
(EB) 60 DEG C of water-baths are placed.
(4) isopropanol of 1 times of volume is added after melting, mixing is flicked, increases DNA yield.
(5) treat that solution is down to room temperature, be transferred in centrifugal column, stand 2min, 10000g centrifugations 1min.
(6) solution in centrifuge tube is transferred to centrifugal column again, stands 2min, 10000g centrifugations 1min.Increase DNA's
Yield.
(7) waste liquid is abandoned.Add 650 μ L Wash Buffer (WB), 10000g centrifugations 1min.
(8) solution in centrifuge tube is transferred to centrifugal column again, 10000g centrifugation 1min abandon waste liquid.
(9) to remove the WB remained, 10000g centrifuges 2min.
(10) centrifugal column is placed in new collecting pipe (1.5mL centrifuge tubes), uncaps and is stored at room temperature 5min, the second for residual of volatilizing
Alcohol.20 μ L EB (water-bath) are added in post center, 2min, 10000g centrifugations 1min is stored at room temperature.
(11) liquid in centrifuge tube is transferred to post center again, is stored at room temperature 2min, 10000g centrifugations 1min.
(12) concentration and quality of STb gene are determined using trace protein nucleic acid spectrophotometer Nano-drop2000c,
Again by 1.2% agarose gel electrophoresis testing goal band whether subsequent experimental.The DNA of elution is stored in -20 DEG C of refrigerators.
The target DNA product of elution is connected on pEASY-T1Cloning Vector, then is transferred to competent cell
In Trans 5a.Operating procedure is as follows：
(1) 2 μ L PCR or RACE products, 1 μ L carriers pEASY-T1Cloning are sequentially added in micro centrifugal pipe
Vector, supplement sterilized water to 5 μ L.(according to the amount of PCR or RACE products, can suitably adjust add product number, at most not
More than 4 μ L)
(2) after gently mixing, 25 DEG C of temperature controls react 8min (if purpose fragment is more than 1kb, 25 DEG C of temperature controls in PCR instrument
React 13min).
(3) centrifuge tube is positioned on ice by reaction after terminating.
(4) when competent cell just thaws, 50 μ L Trans1-T1 competent cells is taken, connection product is added
Enter, flick mixing, ice bath 30min.
(5) 42 DEG C of heat shock 50s in water-bath, are immediately placed on 3min on ice.
(6) the LB fluid nutrient mediums that 250 μ L are free of Amp are added, 37 DEG C of culture 1-2h on constant-temperature shaking incubator,
200rmp/min。
(7) in superclean bench, take 150 μ L bacterium solutions uniformly to apply flat board (the LB solid mediums containing Amp), by flat board just
30min is placed in face, after air-drying, is put into 37 DEG C of incubated overnights (12-16h) in constant incubator, until growing bacterium colony.
Monoclonal is selected in superclean bench, the LB fluid nutrient mediums containing Amp are added in 1.5mL centrifuge tube
500 μ L, the single bacterium colony selected is transferred to 1.5mL centrifuge tube, 37 DEG C of cultures 8h, 200rmp/min on constant-temperature shaking incubator,
Obtain bacterium solution.Reuse universal primer M13Forward Primer and M13Reverse Primer and do the bacterium colony PCR identification positives
Clone.Draw after 5 μ L PCR primers mix with 6 × loading buffer, in the Ago-Gel hole for clicking and entering 1.2%, 120V,
60mA, electrophoresis detection testing goal band observes result in DNA protein gel imaging systems, selects band after identification clear
Clear, sizeable positive bacterium solution is sent to the Hui Yuan bio tech ltd of Wuhan Tian one and is sequenced.Pass through DNAMAN softwares
CDNA sequence is spliced, and translates the amino of the sequential coding of rape aphid uv genes, cry1 genes and cry2 genes
Acid sequence.
1.2.5 opsin bioinformatic analysis
With the blast program (https of NCBI information banks://blast.ncbi.nlm.nih.gov/Blast.cgi) it is right
Rape aphid opsin gene carries out base homology analysis；NCBI ORF Finder programs are recycled to regard egg to rape aphid
White gene is open reading frame analysis (http://www.ncbi.nlm.nih.gov/projects/gorf/
Orfig.cgi), the structural analysis of opsin sequence preservative passes through SMART (http://smart.embl-heidelberg.de/)
Complete；The prediction of opsin molecular weight isoelectric point can pass through ExPASY (http://www.expasy.ch/tools/pi-
Tool.html) complete；Signal peptide (signal peptide) analysis of amino acid passes through (http://www.cbs.dtu.dk/
services/SignalP/)；The hydrophobicity of amino acid analyzes (http by ProtScale programs://us.expasy.org/
cgi-bin/protscale.pl)；Phosphorylation site analysis is carried out to protein sequence by NetPhos 3.1Server programs
(http://www.cbs.dtu.dk/services/NetPhos/)；Using TMHMM Server, v.2.0 program carries out albumen
Sequence transmembrane region analyzes (http://www.cbs.dtu.dk/services/TMHMM/)；With online software ExPASY
(http://prosite.expasy.org/) prediction albumen conserved domain is analyzed；With PBIL LYON-
GERLAND information banks carry out secondary structure prediction (http to protein sequence://npsa-pbil.ibcp.fr/cgi-bin/
npsa_automat.plPage=/NPSA/npsa_hnn.html)；The structure of 3D structures utilizes online website SWISS
MODEL WORKSPACE analyses complete (https://swissmodel.expasy.org/interactive)；With Mega
6.0 softwares and ClustalX softwares to the other insect opsin amino acid sequences obtained from NCBI data and we obtain
Rape aphid opsin sequence is compared, and is then developed with Mega 6.0 software application N-J methods (adjacent method) constructing system
Tree.
2 results and analysis
2.1 rape aphid total serum IgE quality testings
Quantitative and purity detecting is carried out to RNA, measure OD260/OD280 ratio is for 2.08, OD260/OD230 ratios
1.96, show that RNA purity is preferable.1.2% agarose gel electrophoresis detects total serum IgE quality, and band is very clear, does not go out
Existing conditions of streaking, illustrates RNA integralities preferably, can carry out reverse transcription and regular-PCR amplification.
2.2 aphid UV opsin genes are cloned and bioinformatic analysis
2.2.1 rape aphid UV opsin genes are cloned
It regard the total serum IgE of extraction as masterplate, the reverse transcription synthesis chains of cDNA first, then with the rape aphid opsin of design
Specific primer enters performing PCR amplification, and electrophoretogram shows that band is single bright, clear, meets the requirement of expected size.Regular-PCR
Uv genetic fragment sizes are expanded in 700bp or so；RACE amplification genetic fragment be respectively：The RACE of uv 3 ' sizes are left in 600bp
The right side, the RACE of uv 5 ' are in 1000bp or so.Pcr amplified fragment is reclaimed, TA clones, selected clone enters the detection of performing PCR bacterium solution, from
Selected in electrophoresis detection figure and meet the bacterium solution of purpose fragment and send company to be sequenced.
Expanded by RACE, obtain rape aphid UV opsin genes sequence (Seq ID No.5).Utilize Blast
Program is compared, and the high cDNA sequence of retrieving similarity is UV opsin genes, and what confirmation clone obtained is that rape aphid UV is regarded
GFP.Rape aphid UV opsin genes sequence and amino acid sequence are gone out by DNAMAN software translations, it is known that rape aphid
Worm UV opsin genes sequence is 1597bp, the wherein long 1116bp of ORFs, totally 371 amino acid.Initiation codon
Son is ATG, and terminator codon is TAA, and code area both sides are respectively 98bp 5 ' non-translational regions and 383bp 3 ' non-translational regions.
2.2.2 rape aphid UV opsins analysis of physical and chemical property
Rape aphid UV opsin analysis of physical and chemical property results show：UV opsin molecular masses (Molecular
Weight it is) 41616.69Daltons, isoelectric point (pI) has 26 for highly basic acidic amino acid (K, R) in 6.24,371 amino acid
Individual, strong acid acidic amino acid (D, E) has 29, and hydrophobic amino acid (A, I, L, F, W, V, P, M) has 188, uncharged polarity
Amino acid has (G, N, C, Q, S, T, Y) to have 140, and wherein leucine (Leu) accounting is maximum, is 10.5%.Liposoluble index
(Aliphatic index) is 101.24, and it is liposoluble albumen to show it.
2.2.3 aphid UV opsins conserved structure domain analysis
Using Smart to UV opsin conserved structure domain analysis, as a result show：UV opsins have g protein coupled receptor man
Race and 7 transmembrane receptor families (rhodopsin family) conserved domain (Fig. 1), conservative region site are protected respectively at 139-155
Sequence is kept for GAGaTNAATAYDRYStI；Another site is at 318-334, and conserved sequence is LPaVfAKTVAcfDPyvY.
2.2.4 rape aphid UV opsins hydrophobicity analysis
Parent/hydrophobicity of opsin is analyzed using ExPASy, is as a result shown：Rape aphid UV opsins are in 173 bit aminos
Hydrophobicity is most strong at acid, is scored at 3.522, hydrophily is stronger at 250 amino acids, is scored at -2.222, overall average is hydrophilic
Property (Grand average of hydropathy) be scored at 0.370, show that the hydrophobicitys of UV opsins is relatively strong (Fig. 2).
2.2.5 rape aphid UV opsins transmembrane structure is predicted and Subcellular Localization
Rape aphid opsin transmembrane structure is v.2.0 predicted using TMHMM Server.Analysis shows：Rape aphid UV
Opsin has 7 transmembrane structures, respectively in 57-79,92-112,127-149,169-188,216-238,282-304,314-
336；Rape aphid UV opsin Subcellular Localizations are on cell membrane (as shown in figure 3, in figure：(A) UV opsins cross-film knot
Structure；(B) UV opsins Subcellular Localization).
2.2.6 rape aphid UV opsins clustering
Rape aphid UV opsin phylogenetic trees are built using adjacent method.As a result show：Rape aphid UV opsins and
Acyrthosiphum pisim (Acyrthosiphon pisum), Diuraphis noxia (Diuraphis noxia) affiliation are family recently；The white back of the body
Plant hopper (Sogatella furcifera) is family, fig wasp (Ceratosolen solmsi) and little red ant (Monomorium
Pharaonis) it is family；Drosophila (Drosophila melanogaster) is family；Anthocharis scolymus (Anthocharis
Scolymus) it is family；Wherein (UV amino acid sequences are derived from Fig. 4, figure farther out with the genetic distance of Anthocharis scolymus
GeneBank accession number：Acyrthosiphum pisim (A.pisumUV) (XP_001951588.1), Diuraphis noxia (D.noxiaUV) (XP_
015375813.1), white backed planthopper (S.furciferaUV) (BAO03860.1), fig wasp (C.solmsiUV) (XP_
011496705.1), little red ant (M.pharaonisUV) (XP_012537046.1), drosophila (D.melanogasterUV) (NP_
524411.1), Anthocharis scolymus (A.scolymusUV) (BAM95293.1)).
Embodiment 2：The fluorescence quantitative PCR detection of aphid opsin gene
1 materials and methods
1.1 experiment material
1.1.1 sample collection
Aphid needed for experiment is black peach aphid (Myzus persicae) from new rural village developmental research institute of Hubei Province Integrated Demonstration base
Ground Rapeseed Field is collected, and is raised in laboratory planting pot rape, choose three kinds of different worm state rape aphids (alatae, adult aphid,
Larvae aphid), hungry half an hour in the rape aphid culture dish holding after collection, 3 processing, 3 repetitions are set.In different time section
Point is sampled, and is 8 respectively:00、10:00、12:00、14:00、16:00、18:00.It is cold that liquid nitrogen immediately is collected with 2ml cryopreservation tubes
Freeze, -80 DEG C of ultra low temperature freezers are then stored in, in case being used as the material of subsequent experimental.
1.1.2 key instrument and reagent
Reverse transcription reagent box TranScript One-Step gDNA Removal and cDNA Synthesis
SuperMix is purchased from Beijing Quan Shijin biotech companies.Real time fluorescent quantitative enzyme SYBR Premix Ex Taq II are purchased from
Takara companies.Quantification kit TransStart Tip Green qPCR SuperMix are purchased from the golden biotechnology of the full formula in Beijing
Company.The connecting leg of fluorescent quantitation eight, real-time fluorescence quantitative PCR instrument applied biosystems ViiA 7Real-time PCR
System is purchased from American AB I companies.
1.2 test method
1.2.1 Total RNAs extraction and cDNA reverse transcriptions
Total RNAs extraction be the same as Example 1.Genome cDNA reverse transcription is gone according to TranScript One-Step gDNA
Removal and cDNA Synthesis SuperMix specifications are operated, and are comprised the following steps that：
(1) the RNA concentration measured according to Nano-drop2000c, takes part RNA to be diluted to 1 μ g/ μ L and makees template preparation instead
Transcription, it is standby that total serum IgE can be stored in -80 DEG C of refrigerators.
(2) 2 μ L template ribonucleic acids are taken, 5 μ L RNase-free Water, 1 μ L Anchored Oligo (dT) is sequentially added18,
It is 10 μ L, of short duration centrifugation after mixing to make volume.65 DEG C are incubated 5min, subsequent cooled on ice 5min in PCR instrument.
(3) sequentially added in above-mentioned reaction solution the μ L of 2 × TS Reaction Mix 10, the μ L of gDNA Remover 1,
TransScript RT/RI Enzyme Mix 1 μ L, the μ L of cumulative volume 20, of short duration centrifugation after mixing.42 DEG C of warm bath in PCR instrument
30min, 85 DEG C of heating 5min, that is, obtain cDNA templates, can be stored in -20 DEG C of refrigerators standby.
1.2.2 fluorescence quantification PCR primer design and detection
Obtained rape aphid opsin gene sequence (Seq ID No.5) is cloned according to embodiment 1, software is used
Primer Premer5 and DNAMAN 8 designs fluorescence quantification PCR primer Seq ID No.1 and Seq ID No.2, amplified fragments
Size is 100 or so.Using 18S as the reference gene of quantitative fluorescent PCR, fluorescence quantification PCR primer Seq ID No.3 and Seq
ID No.4。
The detection of primer specificity：
Using three kinds of worm states of rape aphid as template, the detection of primer specificity is carried out on quantitative real time PCR Instrument, really
Fixed optimal primer, optimal Template concentration and reaction system.Each sample is repeated 3 times, and sets negative control per plate, it is determined that finally
The reaction condition of quantitative fluorescent PCR, it is ensured that solubility curve is Hypothesis of Single Curve Build Up and peak steady.
Quantitative fluorescent PCR reaction total system is 20 μ L, as follows：
PCR reaction condition be：95 DEG C of pre-degeneration 30s；95 DEG C of 5s, 50 DEG C of -60 DEG C of 15s, 72 DEG C of 20s, totally 40 circulations,
Wherein annealing temperature sets 5 gradients, respectively 50 DEG C, 52 DEG C, 55 DEG C, 58 DEG C, 60 DEG C.Solubility curve program.
1.2.3 the calculating of rape aphid opsin gene relative expression quantity
This experiment detects the differential expression of opsin gene in different samples, the meter of relative expression quantity using relative quantification method
Calculation method is△ △ Ct=(treatment group target gene Ct values-treatment group reference gene Ct values)-(control group target gene
Ct values-control group reference gene Ct values).
2 results and analysis
2.1 rape aphid total serum IgE quality testings
Trace protein nucleic acid spectrophotometer detects RNA quality, and OD260/OD280 is 2 or so, OD260/OD230
For 2 or so, concentration is all higher than 1 μ g/ μ L, therefore needs first to dilute during reverse transcription sampling.Because sample is more, part sample is listed below
Product RNA electrophoretograms, by analysis, the extraction quality of rape aphid total serum IgE is all good, and integrality preferably, does not drop
Solution, can carry out follow-up reverse transcription and quantitative experiment.
2.2 rape aphid UV opsin genes fluorogenic quantitative detections and amplification efficiency analysis
Using alatae as template, the reaction condition of fluorescent quantitative PCR experiment is explored, primer specificity detection is carried out, as a result
It is smooth Hypothesis of Single Curve Build Up to show solubility curve, and reference gene and target gene have good specificity.Again by amplified production
Detected with 2% agarose gel electrophoresis.As a result show, the quantitative primer of design has good specificity, and band is single, no
There is primer dimer, and the fragment of amplification is consistent with expection, send company to confirm as purpose band after being sequenced.
Using reverse transcription sample alatae as template, 5 concentration gradients, 10 times dilute successively, respectively to 5 pairs of gene primer structures
Standard curve is built, and calculates linear equation and amplification efficiency result such as Fig. 5 (in Fig. 5：(A) 18S solubility curves, (B) 18S amplifications
Efficiency, wherein, abscissa is extension rate, and ordinate is Ct values；) and Fig. 6 (in Fig. 6：(A) UV solubility curves, (B) UV amplifications
Efficiency, wherein, abscissa is extension rate, and ordinate is Ct values) shown in.As a result show, 18S amplification efficiency is 97%, UV
Amplification efficiency be 96%, meet quantitative fluorescent PCR scope (amplification efficiency E be higher than 90%, less than 110%).
Expression change of the 2.3 rape aphid opsin genes in the different worm states of UV opsin genes
Relative expression quantity of the rape aphid UV opsin genes in different worm states is that larvae aphid is higher than alatae, and alatae is high
In adult aphid (as shown in Figure 7).
In larvae aphid, the relative expression quantity highest of UV opsin genes, relative expression quantity has significant change (P<0.05).
The morning 8:00 up-regulation, 10:00 starts gradually to lower, and 14:Expression quantity is relatively low when 00, afterwards significantly up-regulation, 16:With respect to table when 00
Highest is reached up to amount, for control 8:19.63 times of 00 expression quantity, then decline.
In adult aphid, the relative expression quantity of UV opsin genes is very low, and expression quantity does not have significant change.From the morning 10:00
When relative expression quantity just gradually raise, upper modulation very little, 14:Expression quantity reaches higher level when 00, for control 8:00 table
Up to 1.89 times of amount, then progressively lower.
In alatae, the relative expression quantity of UV opsin genes is relatively low, and relative expression quantity does not have significant change.From the morning
10:00 starts gradually to raise, and 12:Expression quantity reaches higher level when 00, for control 8:3.82 times of 00 expression quantity, then progressively
Decline.
Embodiment 3：Aphid phototaxis and its relation with opsin gene expression quantity
Black peach aphid (Myzus persicae) is put into practice to the taxis of yellow to be confirmed, and is successfully applied to observe and predict and is prevented
Control.Indoor electrophysiological detection shows that the vision system of black peach aphid is by ultraviolet receptor, blue light receptor and green glow receptor group
Into, respectively to 320~330,440~480 and 530~560nm coloured light sensitivity (Irchner et al.Evidence for
trichromacy in the green peach aphid,Myzus persicae,(Sulz.)(Hemiptera:
Aphididae).Journal of Insect Physiology,2005,51:1255-1260)。
The method described according to embodiment 2 takes back interior in identical plot collection rape aphid (Myzus persicae)
Carry out phototaxis simultaneously to determine and gene expression amount experiment, so that clear and definite phototaxis is corresponding with opsin related gene expression amount
Relation.
The phototaxis assay method reference literature of rape aphid (pays what the black peach aphids such as state's need were reacted different monochromatic light taxis
Determine insect journals, 2009,52：1171-1176).Simply, phototaxis biometric apparatus is single armed sleeve structure, by light
Source and light path, optical filter and silicon rubber interface, the part of biologicall test sleeve pipe 3 composition.15 aphids are often handled, are repeated 5 times.Every group
Experiment first carries out unglazed blank determination, is not turned on light source by aphid free diffusing；Then optical filter is not installed, bromine tungsten filament lamp is carried out complete
Spectral response is determined；Finally choose UV optical filters and carry out monochromatic light reaction assay.When determining every time, 15 aphids are collected with banister bruss
Worm is released into after the release area of internal lining pipe, 30min simultaneously, and the shift length of every examination aphid is recorded respectively.Calculate each processing
Average displacement, can be with the phototaxis of subordinate act angle analysis black peach aphid using average displacement as evaluation index.
Further UV opsin gene expression quantity (x) and the phototaxis (y) of aphid are entered using statistic software SPSS 9.0
Row regression analysis, as a result shows, both have extremely significant positive contact, and regression equation is：Y=0.3372x+0.5814, is determined
Coefficient is 0.7733, reaches the pole level of signifiance, thus prediction is effective.
Therefore, rape aphid (Myzus persicae) the UV opsin genes (Seq ID No.5) provided with the present invention
As mark, the UV opsins that the primer combination (Seq ID No.1-2) provided by the present invention can be in quick detection aphid
Gene expression amount can Accurate Prediction aphid phototaxis so that in time install alluring colouration plate foundation is provided, can control of aphids,
Extensive use in the field such as the prediction of aphid insect pest situation or aphid early warning.
The preferred embodiments of the present invention are the foregoing is only, are not intended to limit the invention, for the skill of this area
For art personnel, the present invention can have various modifications and variations.Within the spirit and principles of the invention, that is made any repaiies
Change, equivalent substitution, improvement etc., should be included in the scope of the protection.
SEQUENCE LISTING
<110>Hubei Engineering University
<120>The combination of UV opsin genes and primer and application of a kind of rape aphid
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 19
<212> DNA
<213>Artificial sequence
<400> 1
ttggcgatgt gcgattttt 19
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence
<400> 2
catttgtggc tcctgctcc 19
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence
<400> 3
tcaacacggg aaacctcacc a 21
<210> 4
<211> 21
<212> DNA
<213>Artificial sequence
<400> 4
caccacccac cgaatcaaga a 21
<210> 5
<211> 1597
<212> DNA
<213>Artificial sequence
<400> 5
ctaatacgac tcactatagg gcaagcagtg gtatcaacgc agagtacatg ggggtagtag 60
tgactagtgt tttagactag cactaacaaa cgttaataat ggatttcaac cgaagtgtgt 120
cgagaccttt atcacaactt ggttctagtt tcatggaaaa tgaagacgaa cttcaattaa 180
tgggttggaa tcttactcca gaagatctta ctcacatacc agaacattgg ttgtcatacc 240
cagaagttag atcactctac cattatattt tggcatttgc ttatacaatt ttattttgtc 300
tcggtgtaat tggaaatggt ttggtgttat ggatattttg tgtatcaaaa ccattacgaa 360
caccttccaa tttgtttgtg ctcaatttgg cgatgtgcga tttttctatg gtattagtac 420
taccgatcct catttatgat tcaatagatc ataaatatcc aggccattta cagtgtcaga 480
tatttgcatt gtgtggatct attagtggga ttggagcagg agccacaaat gctgctattg 540
cttatgacag atatagtaca attgcaaaac catttgaagg tcgtatgact tatggtaaag 600
cattaatatt gatcatatgt atttggattt atgttttacc atggtgctta cttcccttaa 660
ccgaaaagtg gaatcgatat gttccggagg gttttttgac aagttgttct tttgactact 720
taacgcctac cgaggagact aaagcttttg ttggaaccat gtttgtgatt tgttacgtga 780
ttcccatgtc ttttataata tacttttatt cacaaattgt ctgtcacgta tttaaccacg 840
aaaaagcact tcgtgaacaa gctaaaaaga tgaacgttga atctttgcgg agtaatcaag 900
atgcaaacgc tcaatcagcg gaagtaagaa ttgctaaagc cgcaattacg atttgttttc 960
tgtttgtagc tgcctggaca ccatatgcag tggtcgctat gatcggtgct tttggagatc 1020
aatctctact aacgcctatc gcgtcaatgc taccagcggt gtttgccaag acggtggctt 1080
gtttcgaccc atacgtctac gcaatcagtc atcctaaata cagattagaa ctttcgaaac 1140
gtgtcccatg cttgggtatt accgaaaaac ctccggcaac gagcgataca caatcgatca 1200
ctactgcagc ttaatgtatt tcatgctagt ggacgacttg atttttccaa atttcattgt 1260
ttagatttta attaaaaaaa aaaaaattaa ctcgaatgga aaatttaata tttaaatgta 1320
aaaacagaaa ttaactatat acctacctaa tatattatat ttagtgtaag tatcagttac 1380
atgtattgca tgtctcactt atatgagtaa gtgttagacc aatattatac atttatattt 1440
tacctacatg tatatcttaa ttaaaataat tgtatttaaa ataggtaggt actacaaaaa 1500
aacttacatt ttctataaaa atatgatgta cctaatattg ttatttattt atttttagat 1560
ttaaaccttt tattattata atttataatt tattgtg 1597
Claims (10)
1. the UV opsin genes of a kind of rape aphid, it is characterised in that its base sequence is as shown in Seq ID No.5.
2. the UV opsin genes of the rape aphid described in claim 1 are as mark in rape aphid phototaxis is determined
Using.
3. application according to claim 2, it is characterised in that it includes：Using the sense primer shown in Seq ID No.1
The relative expression of the UV opsin genes is determined by fluorescent quantitative PCR technique with the anti-sense primer shown in Seq ID No.2
Amount.
4. the UV opsin genes of the rape aphid described in claim 1 are predicted as mark in control of aphids, aphid insect pest situation
Or the application in aphid early warning.
5. application according to claim 4, it is characterised in that rape is determined using the UV opsin genes as mark
The phototaxis of aphid, control of aphids, the prediction of aphid insect pest situation or aphid early warning are carried out according to phototaxis result is determined.
6. a kind of primer combination of the UV opsin genes of rape aphid for described in test right requirement 1, it is characterised in that
It includes：The anti-sense primer shown in sense primer and Seq ID No.2 shown in Seq ID No.1.
7. application of the primer combination in rape aphid UV opsin gene expression quantity is determined described in claim 6.
8. application of the primer combination in rape aphid phototaxis is determined described in claim 7.
9. application according to claim 7, it is characterised in that it includes：Seq ID in being combined using the primer
The anti-sense primer shown in sense primer and Seq ID No.2 shown in No.1 determines rape aphid by fluorescent quantitative PCR technique
The relative expression quantity of UV opsin genes.
10. application of the primer combination in control of aphids, the prediction of aphid insect pest situation or aphid early warning described in claim 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710409981.9A CN106987594A (en) | 2017-06-02 | 2017-06-02 | The combination of UV opsin genes and primer and application of a kind of rape aphid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710409981.9A CN106987594A (en) | 2017-06-02 | 2017-06-02 | The combination of UV opsin genes and primer and application of a kind of rape aphid |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106987594A true CN106987594A (en) | 2017-07-28 |
Family
ID=59422040
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710409981.9A Pending CN106987594A (en) | 2017-06-02 | 2017-06-02 | The combination of UV opsin genes and primer and application of a kind of rape aphid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106987594A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115053713A (en) * | 2022-07-18 | 2022-09-16 | 贵州省烟草科学研究院 | Method for inducing tobacco seedling to resist myzus persicae through UV-B irradiation |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013090356A2 (en) * | 2011-12-16 | 2013-06-20 | The Board Of Trustees Of The Leland Stanford Junior University | Opsin polypeptides and methods of use thereof |
-
2017
- 2017-06-02 CN CN201710409981.9A patent/CN106987594A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013090356A2 (en) * | 2011-12-16 | 2013-06-20 | The Board Of Trustees Of The Leland Stanford Junior University | Opsin polypeptides and methods of use thereof |
Non-Patent Citations (4)
| Title |
|---|
| GENBANK: "AF189715.1", 《NCBI》 * |
| NCBI: "XM_001951553.4", 《NCBI》 * |
| 付国需等: "桃蚜对不同单色光趋性反应的测定", 《昆虫学报》 * |
| 张纯胄等: "害虫趋光性及其应用技术的研究进展", 《华东昆虫学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115053713A (en) * | 2022-07-18 | 2022-09-16 | 贵州省烟草科学研究院 | Method for inducing tobacco seedling to resist myzus persicae through UV-B irradiation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109251963A (en) | The method and kit of mycoplasma contamination in Constant Temperature Detection cell culture fluid | |
| CN102634591B (en) | Genetically modified rice BT63 and LAMP (loop mediated isothermal amplification) detection primer group, detection kit and detection method of derived variety thereof | |
| CN108977508A (en) | Primer combination and its application based on LAMP detection succulent Pathogen | |
| CN109797157A (en) | A kind of resisting abiotic adverse circumstance transcription factor PbrbHLH92 and its primer, the albumen of coding and application | |
| CN116516058A (en) | Method and kit for visually detecting phytophthora sojae | |
| CN105861501B (en) | Brown Planthopper cause harm inducible promoter region separation and expression pattern identification | |
| CN103333887B (en) | A kind of functional label utilizing DNA melting temperature (Tm) analyzing rice Pita gene | |
| CN112981000B (en) | InDel molecular marker related to cotton drought resistance and application thereof | |
| CN106987594A (en) | The combination of UV opsin genes and primer and application of a kind of rape aphid | |
| CN103805610B (en) | Rhopalosiphum padi EF1-α reference gene partial sequence, cloning process and application thereof | |
| CN103773867A (en) | LAMP detection primer group of cry2Ab gene in transgenic crop and detection kit as well as detection method | |
| CN104651530A (en) | Method for capturing RT-PCR by multiple tubes | |
| CN107091933B (en) | A kind of method and primer and kit of detection aphid blue light phototaxis | |
| CN105296496A (en) | cDNA full-length sequence of Chouioia cunea Yang Hsp70 (Heat shock protein) and application | |
| CN106636132B (en) | A kind of ultraviolet stress-related genes of highland barley and its application | |
| CN109652585A (en) | Corn Zm-APX gene molecule marker, preparation method and the application in stem rot prevention and treatment | |
| CN103352085A (en) | Primers and probe of PCR detection for a transformant of insect resistant genetically modified cotton MON531 | |
| CN107475457A (en) | Duck batai virus ring mediated isothermal amplification detection primer group and kit | |
| CN102965436A (en) | Isothermal amplification method for detecting cry1Ac-transfected sugarcane | |
| Dong et al. | The use of FISH in chromosomal localization of transgenes in rice | |
| CN106636372A (en) | Molecular marker for identifying wheatear sprouting resistance based on TAMFT-3A gene and method thereof | |
| Rezaei et al. | Overexpression of stress-related genes in Cuscuta campestris in response to host defense reactions | |
| Saadia et al. | Expression of chloroplast-related DNA sequence in salt sensitive sunflower line by salt stress | |
| CN105296654A (en) | Method for detecting Chouioia cunea Yang Hsp60 gene expression by utilizing fluorescent RT-PCR technique | |
| CN104141006B (en) | A kind of method of utilizing the early stage Exact Forecast bacterial blight of rice of miRNA398b gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170728 |