CN106978507A - Diagnosis of glaucoma molecular marked compound lncRNAsENST00000508241, kit and application - Google Patents
Diagnosis of glaucoma molecular marked compound lncRNAsENST00000508241, kit and application Download PDFInfo
- Publication number
- CN106978507A CN106978507A CN201710423183.1A CN201710423183A CN106978507A CN 106978507 A CN106978507 A CN 106978507A CN 201710423183 A CN201710423183 A CN 201710423183A CN 106978507 A CN106978507 A CN 106978507A
- Authority
- CN
- China
- Prior art keywords
- lncrnas
- glaucoma
- diagnosis
- real
- expressions
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses molecular marked compound lncRNAs ENST00000508241, kit and the application for diagnosis of glaucoma.It is found by the applicant that relative to control group crowd, lncRNAs:ENST00000508241 up-regulated expressions in the aqueous humor of glaucoma patient.Prompting ENST00000508241 is the high expression lncRNAs in glaucoma, contributes to the biomarker of diagnosis of glaucoma.The present invention provides strong molecular biology mechanism for diagnosis of glaucoma, with far-reaching clinical meaning and generalization.
Description
Technical field
The present invention relates to molecular diagnostic techniques field, and in particular to a kind of to contribute to the long-chain non-coding of diagnosis of glaucoma
RNA marks, kit and application.
Background technology
Eyes are the highly important sense organs of human body, can receive the light stimulus of outside, and light impulsion is sent to greatly
Mesencephalic centre and cause vision.Leonardo da Vinci once said：" the eyes are the windows of the mind, by eyes, and people are able to embrace and appreciate the world
It is unlimited beautiful, soul is just able to live in peace in vivo ".Information age, people by sense organ from the information that the external world is obtained, greatly
About 90% is completed by eyes.The data of the World Health Organization shows that ophthalmology disease turns into after tumour, angiocardiopathy
The 3rd harm afterwards and the disease of influence people's life quality.In all ophthalmology diseases, glaucoma is then that first place can not
The blinding illness in eye reversed, the reason for it influences visual quality is to cause to lose by threatening and damaging optic nerve and its path
It is bright, so as to seriously threaten the Vision Health of the mankind, loss difficult to the appraisal is caused to personal, family and society.
The main harm that glaucoma is caused is influence visual performance, even in developed country, also only 50% or so
Glaucoma patient timely can be diagnosed and be treated, moreover, the pathogenic factors of glaucoma, genetics law etc. fail to understand
, therefore we will scientifically grasp its regularity of occurrence and development, so as to be early diagnosed and early treatment, it is to avoid glaucoma is suffered from
The blindness of person.At present, the inspection in terms of the diagnosis of glaucoma mainly relies on medical history, morphology and function assessment, such as tonometry,
Ultrasound biomicroscopy UBM, eye-ground photography, optical coherence tomography and perimetry etc..Although these inspections can diagnose green light
Eye, but research shows that the glaucoma diagnosed by morphology and function assessment means, the infringement of patient visual's function is alreadyd exceed
50%.And glaucoma related biochemical analysis, serological screening and examination criteria be still in relative space state, therefore find one
The mark of high sensitivity and high specific is planted to diagnosis of glaucoma and is monitored particularly important.
Genome plan research shows, in 3,000,000,000 base-pairs of composition human genome, only 1.5% nucleotides
Sequence is used for protein coding, and remaining 98.5% genome is non-protein coded sequence.These sequences were once considered as to enter
" determined garbage sequence " accumulated during change and do not paid close attention to, in human genome DNA's element encyclopedia of subsequent start-up
(encyclopedia of DNA elements, ENCODE) in the works, research shows that 75% gene order can be transcribed
Into RNA, wherein nearly 74% transcription product is non-coding RNA (non-coding RNAs, ncRNAs).In ncRNA, sequence
The transcript that length is more than 200 bases is long-chain non-coding RNAs (long noncoding RNA, lncRNAs), they by
Received much concern in rich and mechanism of action the diversity of function.LncRNAs can transcription, transcription after and translate it is multiple
The expression of protein coding gene is adjusted in aspect, so as to widely participate in the important life including cell differentiation and body development
Life process, generation of its unconventionality expression also with a variety of major diseases of the mankind is closely related.
LncRNA has well-conserved and tissue specificity, is enriched very much in brain content.LncRNA not only take part in
Growing and perfect in shape and function for nervous system, makes nervous system be carried out according to regular hour order and in certain space
Growth and development, and participate in performing the function of nervous system.LncRNA participates in the development of nervous system by number of mechanisms
And during function is performed, including it is used as cis-acting elements and trans-acting factor participation Genomic Imprinting, chromatin remodeling, cell week
The processes such as period regulation, montage regulation and control, mRNA degradeds and translational control.Therefore, the composition and expression for detecting lncRNAs are utilized
Change come the physiology and pathological state that reflect nervous system be feasible means.
It is tolerant that aqueous humor belongs to intraocular, is produced by ciliary body, and blood is eventually entered into by pupil, trabecular network etc., and in dynamic
Among state circulation, its composition constitutes closely related with eyeball local physiological and pathology environment.Excretion body is most important as body
Intermediary's material for mutually exchanging of iuntercellular, contain lncRNAs, mRNAs, protein and lipid etc..Included in excretion body
Material is due to special protection mechanism energy stable for extended periods of time state.Therefore, the lncRNAs equimoleculars in aqueous humor can be with excretion body
Form transmits intercellular mutual exchange of information, and can enter blood with the dynamic circulation of aqueous humor.Therefore glaucoma correlation
LncRNAs researchs are with the potential provided fundamental basis for the detection of glaucoma associated biomarkers.
The content of the invention
An object of the present invention is to provide a kind of long-chain non-coding RNA early diagnosed for glaucoma, to glaucoma
Morbidity detection it is significant.
The molecular marked compound lncRNAsENST00000508241, its sequence such as SEQ ID early diagnosed for glaucoma
NO:Shown in 1.
The second object of the present invention is to provide above-mentioned molecular marked compound lncRNAsENST00000508241 application.Detection
Application of the product of lncRNAsENST00000508241 expressions in glaucoma early diagnosis instrument is prepared.
The product of described detection lncRNAs ENST00000508241 expressions includes：Pass through real time fluorescent quantitative
PCR detects the preparation of lncRNAs ENST00000508241 expressions.
The described preparation bag that lncRNAs ENST00000508241 expressions are detected by real-time fluorescence quantitative PCR
Include specific amplification lncRNAs ENST00000508241 primer.
The specific amplification of lncRNAs ENST00000508241 expressions is detected with real-time fluorescence quantitative PCR
LncRNAs ENST00000508241 primer sequence is：
F:5'TTTGGGTTTGGCTGTTACTCA3’
R:5’GACCACATTTCCCAAGAACACT3’。
The third object of the present invention is to provide a kind of kit early diagnosed for glaucoma, includes detection lncRNAs
The reagent of ENST00000508241 expressions.Specifically include and lncRNAs is detected by real-time fluorescence quantitative PCR
The reagent of ENST00000508241 expressions.
The described reagent bag that lncRNAs ENST00000508241 expressions are detected by real-time fluorescence quantitative PCR
Containing the primer by real-time fluorescence quantitative PCR specific amplification lncRNAs ENST00000508241.
The described reagent bag that lncRNAs ENST00000508241 expressions are detected by real-time fluorescence quantitative PCR
Primer containing a pair by real-time fluorescence quantitative PCR specific amplification lncRNAs ENST00000508241, its primer sequence
For：
F:5'TTTGGGTTTGGCTGTTACTCA3’
R:5’GACCACATTTCCCAAGAACACT3’。
It is found by the applicant that relative to control group crowd, lncRNAs:Aqueous humors of the ENST00000508241 in glaucoma patient
Middle up-regulated expression.Prompting ENST00000508241 is the high expression lncRNAs in glaucoma, contributes to diagnosis of glaucoma
Biomarker.The present invention provides strong molecular biology mechanism for diagnosis of glaucoma, with far-reaching clinical meaning
And generalization.
Brief description of the drawings
Fig. 1 is lncRNAs and mRNAs express spectras in glaucoma patient aqueous humor；
A：LncRNAs expression pattern analysis dendrogram in glaucoma patient aqueous humor；B：MRNAs is expressed in glaucoma patient aqueous humor
Analysis of spectrum dendrogram.
Fig. 2 is the lncRNAs and mRNAs of differential expression in glaucoma patient aqueous humor；
A：For age-related cataract, the lncRNAs of 2 times of differential expressions in glaucoma patient aqueous humor；B：Compared with year
For age related cataract, the mRNAs of 2 times of differential expressions in glaucoma patient aqueous humor.
Fig. 3 is the CNC analysis charts of lncRNAs and mRNAs expression in glaucoma patient aqueous humor；
Red point represents lncRNAs, and blue dot represents mRNAs, and solid line represents positive correlation, and dotted line represents negative correlation.
Fig. 4 is expression quantity of the lncRNAs in glaucoma and patients with senile cataract aqueous humor；
A-D is：lncRNA:ENST00000564363, NR_026887, TCONS_00025577 and
The scatter diagram that ENST00000508241 is expressed in glaucoma and patients with senile cataract aqueous humor.
Fig. 5 is the ROC curve for diagnosing glaucoma in aqueous humor using lncRNAs；
A-D is：LncRNA ENST00000564363, NR_026887, TCONS_00025577 and
ENST00000508241 diagnoses under the ROC curve of glaucoma that Line Integral Wei not 1.000,0.920,0.940 and in aqueous humor samples
0.880。
Embodiment
The present invention is intended to further illustrate with reference to embodiments, is not intended to limit the present invention.
Embodiment 1：LncRNAs and mRNAs express spectra in glaucoma patient aqueous humor：
1.1 materials and reagent
1.1.1 key instrument
Conventional centrifuge and refrigerated centrifuge are purchased from Eppendorf companies；Supercentrifuge is purchased from Beckman companies；
Real-Time PCR instruments device is purchased from ABI companies；Pipettor and electrical pipette rifle are purchased from Eppendorf companies；Q5000 is purchased from
Quawell Technology companies；Ice machine is purchased from Sanyan companies.
1.1.2 material and reagent
The centrifuge tube and PCR pipe of different model are purchased from Axygen companies；DEPC water is purchased from prosperous company of ancient cooking vessel state；Trizol
Purchased from Invitrogen companies；TargetAmpTM1-Round aRNA Amplification kits are public purchased from epicentre
Department；Transcriptor First Strand cDNA Synthesis kits are purchased from Roche companies；Quick Amp
Labeling Kit, One-Color kit are purchased from Agilent Technologies companies；People lncRNAs microarray
Chip is purchased from Arraystar companies.
1.1.3 reagent is configured
Various Western blotting agents useful for same according to《Molecular cloning (third edition)》The method configuration of middle offer.
1.2 method
1.2.1 aqueous humor samples prepare
The research is examined by Ethics Committee of Xiangye No. 2 Hospital of Central South University.It is preoperative to know with the signature of all research objects
Feelings letter of consent, undiluted room is extracted before formal operating procedure starts using 1ml disposable sterilized injector in corneal limbus
This 0.1ml of water gauge, injects in autoclaved 0.5mlEP pipes immediately, be placed in -80 DEG C of low temperature refrigerators be kept in dark place it is standby.It is all
Selected patient is to be in hospital to need the glaucoma patient and patients with senile cataract that carry out operative treatment in our hospital.Include mark
It is accurate：1. primary open-angle glaucoma：A. intraocular pressure>21mmHg B. glaucomatous disks are damaged and/RNFL defects C. is typically blue or green
Light eye property defect of visual field D. anterior chamber angles are opened.With four above or with A therein, D, B or C person.2. normal tension is blue or green
Light eye：With the optic disk change similar to POAG, RNFL and visual field damage, 24h tonometries≤21mmHg, room angle is opened.
3. primary angle-closure glaucoma：Optic disk with glaucoma changes, RNFL and visual field damage, intraocular pressure>21mmHg, anterior chamber angle becomes
Narrow or 4. age-related cataracts of closing (control group)：Crystalline lens in cortex and/or caryogram is muddy and/or rear capsule under property mix
It is turbid.Exclusion standard：1. occur together systemic disease such as hypertension and diabetes etc..2. secondary glaucoma 3. may influence the visual field,
Optic nerve or the ophthalmology or neuropathy of colour vision.4. reliability standard is detected in the visual field：Fixation Loss Rate, false positive rate and/or
False negative rate>25%.5. age-related cataract：Exclude concurrency, traumatic, congenital cataract and exclude with other
Ophthalmic disease person, exclusion overripe stage case.
1.2.2 RNA is extracted
Take aqueous humor 0.1ml to add 0.5mlTrizol reagents, acutely add 0.1 milliliter of chloroform after concussion.And after through centrifugation,
10 microlitres of DPEC water are dissolved in after precipitation and the cleaning of 75% ethanol, through each pipe RNA concentration of Q5000 apparatus measures.
1.2.3 RNA amplification
Use TargetAmpTM1-Round aRNA Amplification Kit 103 (epicentre) press raw manufacturer and said
Step shown in bright book is expanded to RNA.Substantially step is as follows：Synthesize single into single-stranded cDNA according to RNA samples first:RNA is miscellaneous
Product is handed over, the use of RNase H enzymes is then small fragment sequence by the digestion of above-mentioned hybrid product, these small fragment sequences can assist double
Chain cDNA synthesis.It is last that antisense RNA is synthesized by double-strand cDNA transcriptions.
1.2.4 cDNA is synthesized and marked
Raw manufacturers instruction is pressed using Transcriptor First Strand cDNA Synthesis Kit (Roche)
Shown step synthesizes cDNA.It is right using Quick Amp Labeling Kit, One-Color (Agilent Technologies)
The cDNA of synthesis is marked.
1.2.5 labeling effciency quality testing
1.5 microlitres of marked cDNA samples are taken, fluorescent label efficiency is detected using NanoDrop ND-1000.
1.2.6 chip hybridization
At the standard conditions by the probe marked and superchip (Human lncRNA microarray V4.0,
Arraystar companies) hybridized.The chip detects 40173 kinds of lncRNAs and 20730 kinds of mRNAs expressions altogether.
1.2.7 IMAQ and data analysis
The fluorescence intensity of chip is scanned using GenePix 4000B chip scanners, and experimental result is converted into numeral
Type data are preserved.P values<0.05 is that difference is statistically significant.
1.3 result
1.3.1 in glaucoma patient aqueous humor lncRNAs and mRNAs express spectra
In 10 parts of glaucoma patient aqueous humor samples average detected to 20653 ± 569.9 kinds of lncRNAs and 11265 ±
268.3 kinds of mRNAs.Wherein, the lncRNAs detected in 10 parts of glaucoma patient aqueous humor samples is 11728 kinds, is detected
MRNAs be 6686 kinds.
1.3.2 in glaucoma patient aqueous humor differential expression lncRNAs and mRNAs
For age-related cataract, the lncRNAs of 2 times of up-regulated expressions is 4372 kinds, 2 in glaucoma patient aqueous humor
The lncRNAs for lowering expression again is 2602 kinds.For age-related cataract, 2 times of upper mileometer adjustments in glaucoma patient aqueous humor
The mRNAs reached is 2783 kinds, and 2 times of mRNAs for lowering expression are 1617 kinds.
1.4 result
Because its easily taking property, individual specificity and relative other organ by body is influenceed less feature, aqueous humor is a kind of
The larger research object of value of eye disease biomarker correlative study.Although also, a variety of research reports existing at present
The related epidemiology of glaucoma and science of heredity hazards, but the correlative study using aqueous humor as research object is relatively fewer.Cause
This, it is believed that aqueous humor has the potential for being applied to glaucoma correlated inheritance research from now on.Due to the limitation of sampling, humanized
Aqueous humor samples small volume.To overcome the problem, we increase RNA amplification step before chip hybridization is carried out, so with guarantee
Subsequent step is smoothed out.By using lncRNAs chip microarray analysis methods, 11728 kinds of lncRNAs and 6686 kinds
MRNAs is detected in 10 parts of Aqueous Humor of Glaucomas samples, in this age-related cataract patient aqueous humor lncRNAs and
There is mRNAs express spectras lncRNAs and mRNAs express spectras in significant difference, therefore aqueous humor to show individual specificity and disease
Specificity.As far as we know, this is first Aqueous Humor of Glaucomas correlation lncRNAs and mRNAs express spectras research.
Embodiment 2：The correlation of specific lncRNAs and mRNAs in clear and definite aqueous humor is analyzed by CNC
Further to inquire into the lncRNAs expressed in glaucoma patient aqueous humor possibility function, we use CNC
(coding-noncoding gene co-expression) analysis clearly has with the mRNAs expression of glaucoma related gene
The lncRNAs of significant correlation.CNS analyses are a kind of by lncRNA and mRNA coexpression data, and lncRNA and mRNA is joined
The analysis method that system gets up.Analyzed by CNC it can be found that there is the mRNA of identical expression pattern with some lncRNA, by this
A little mRNA function, can connect lncRNA with signal specific path or disease condition, consequently facilitating prediction lncRNA
Function, and disclose its mechanism of action.
2.1 method
Select differential expression in aqueous humor and occur mRNAs of the development with correlation with glaucoma, these mRNAs are existed
Expression data in different glaucoma patient's aqueous humor are averaged；Seek the data and green light after the mRNAs standardization picked out
Pearson correlation coefficient (Pearson Correlation in eye patient's aqueous humor between the lncRNAs related datas of differential expression
Coefficient, PCC) and false discovery rate (False Discovery Rate, FDR)；Pick out PCC >=0.90 and FDR
≤ 0.05 record；Using relative recording, drawn using Cytoscape2.8.3 instruments.
2.2 result
For age-related cataract, in glaucoma patient aqueous humor differential expression and with glaucoma occur development tool
The mRNAs for having correlation is following ten kinds：Bone morphogenetic protein 2 (bone morphogenetic protein 2, BMP2),
Endyma related gene 1 (ependymin related 1, EPDR1), transforminggrowthfactor-β1 (transforming growth
Factor beta 1, TGFB1), jaw albumen E3 (forkhead box E3, FOXE3), secretagogue receptor
(growth hormone secretagogue receptor, GHSR), jaw PROTEIN C 1 (forkhead box C1,
FOXC1), cross-film and coiled-coil domain 1 (transmembrane and coiled-coil domains 1, TMCO1),
PH domains A7 (pleckstrin homology domain containing A7, PLEKHA7), optic nerve albumen
(optineurin, OPTN) and integrin subunit β 5 (integrin subunit beta 5, ITGB5).In glaucoma patient room
In water, being more than 0.9 and lncRNAs of the false discovery rate less than 0.05 with the Pearson correlation coefficient that these mRNAs are expressed has
10 kinds.
Embodiment 3
Our 10 kinds using qRT-PCR in glaucoma and age related cataract patient aqueous humor in checking embodiment 2
In lncRNAs, differential expression measurers of 7 kinds of lncRNAs in two class aqueous humors has significant difference, and 3 kinds of lncRNAs are in two class rooms
Differential expression amount no difference of science of statistics in water.Then the lncRNA with significant difference is chosen:ENST00000564363、
NR_026887, TCONS_00025577 and ENST00000508241 are further verified.
Embodiment 4
We verify lncRNA with qRT-PCR detection methods:ENST00000564363、NR_026887、TCONS_
Expression of the 00025577 and ENST00000508241 molecules in aqueous humor, and it is analyzed in glaucoma patient and control group
The difference of expression quantity in crowd.
4.1 materials and reagent
4.1.1 key instrument
Conventional centrifuge and refrigerated centrifuge are purchased from Eppendorf companies；Supercentrifuge is purchased from Beckman companies；
Real-Time PCR instruments device is purchased from ABI companies；Pipettor and electrical pipette rifle are purchased from Eppendorf companies；Q5000 is purchased from
Quawell Technology companies；Ice machine is purchased from Sanyan companies.
4.1.2 material and reagent
The centrifuge tube and PCR pipe of different model are purchased from Axygen companies；DEPC water is purchased from prosperous company of ancient cooking vessel state；Trizol
Purchased from Invitrogen companies；Reverse Transcriptase kit and fluorescence quantitative kit are purchased from Roche companies.
4.1.3 reagent is configured
Various Western blotting agents useful for same according to《Molecular cloning (third edition)》The method configuration of middle offer.
4.2 method
4.2.1 aqueous humor samples prepare
Aqueous humor samples step as described in 1.2.1 prepares.
4.2.2 RNA is extracted
0.1 milliliter of aqueous humor adds 0.5 milliliter of Trizol reagent, acutely adds 0.1 milliliter of chloroform after concussion.And after pass through from
20 microlitres of DPEC water are dissolved in after the heart, precipitation and the cleaning of 75% ethanol, through each hole RNA concentration of Q5000 apparatus measures.
4.2.3 qRT-PCR
Reverse transcriptase is relied on by RNA reverse transcriptions into cDNA according to raw manufacturers instruction first, then expanded with PCR method
CDNA, the product amount of quantitative amplification is detected by determining fluorescence intensity signals in real time.
4.2.2 data analysis
Data processing is carried out using SPSS19.0 editions statistics softwares.Measurement data is with median ± interquartile range table
Show, glaucoma/cataract represents two groups of median ratios, compare progress Mann-whitney U inspections.P values<0.05 is difference
It is statistically significant.
4.3 result
Exist further to expand aqueous humor samples amount checking correlation lncRNAs expression and probing into specific lncRNAs
Expression quantity in glaucoma patient aqueous humor, we detect 20 aqueous humor samples (10 glaucoma patient aqueous humor samples using qRT-PCR
This, the patients with senile cataract aqueous humor sample that 10 ages match with sex) in ENST00000564363, NR_
026887th, TCONS_00025577 and ENST00000508241 expressions.As a result show, in two class aqueous humor samples,
ENST00000564363, NR_026887, TCONS_00025577 and ENST00000508241 expression quantity have statistics poor
Different, its expression quantity in glaucoma patient aqueous humor is followed successively by the expression quantity in patients with senile cataract aqueous humor
1.6200th, 1.9500,1.9302 and 1.8378 times (table 1) (Fig. 4).To further appreciate that ENST00000564363, NR_
026887th, TCONS_00025577 and ENST00000508241 diagnose the validity of glaucoma in aqueous humor, and we utilize gained
Data draw Receiver Operating Characteristics (receiver operating characteristic, ROC) curve (Fig. 5).It was found that
ENST00000564363, NR_026887, TCONS_00025577 and ENST00000508241 diagnose green light in aqueous humor samples
Line Integral Wei 1.000,0.920,0.940 and 0.880 under the ROC curve of eye.When ENST00000564363, NR_026887,
The diagnostic value of TCONS_00025577 and ENST00000508241 in aqueous humor is set to 0.0068,0.0056,0.0074 and
When 0.0048, its diagnose sensitiveness/specificity be followed successively by 1.000/1.000,0.900/0.900,0.900/0.900 and
0.800/0.800 (table 2).
Expression quantity of the lncRNAs of table 1 in aqueous humor
| lncRNAs | Glaucoma groups | Cataract group | Glaucoma/cataract | P values |
| ENST00000564363 | 0.0081±0.0020 | 0.0050±0.0013 | 1.6200 | 0.001 |
| NR_026887 | 0.0078±0.0021 | 0.0040±0.0015 | 1.9500 | 0.001 |
| TCONS_00025577 | 0.0083±0.0050 | 0.0043±0.0018 | 1.9302 | 0.001 |
| ENST00000508241 | 0.0068±0.0027 | 0.0037±0.0017 | 1.8378 | 0.004 |
The lncRNAs of table 2 diagnoses the Sensitivity and Specificity of glaucoma in aqueous humor
SEQUENCE LISTING
<110>Central South University
<120>Diagnosis of glaucoma molecular marked compound lncRNAsENST00000508241, kit and application
<130>Nothing
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 540
<212> DNA
<213> lncRNA：ENST00000508241 sequence
<400> 1
aaggtacact ctactatgta tgcacagcca cagaaaaatc atagtgtgta cattgcttga 60
atgatccttt tgggtttggc tgttactcac agatgaagga gacatttcca aggttgtaac 120
cagagtcatt ctaagcacag tccttgcagc agtagagaca atcccaatga ctacaggaaa 180
tcctcaactc tcatccagaa cctgtaagct caggacatgc atcataggaa ggatgtgaat 240
tgctgaagtg cttccatggt agtcttttgc tccctgccta cgtgggcaag aagctgtaga 300
ctctgggata atttggacga tcccagcacg ggtatactcc actctgcttc atggcactta 360
ccaaggctgg agagagacca cacccatccc ttctgttttc cattgcattc ccttccccaa 420
actttccatc cagaaattct tctttggttg accctgccac attgtatatt cttgttctcc 480
ccccatgatg cattttattt cagtatcctt agattcctaa taaatcaatt atttaaacat 540
<210> 2
<211> 21
<212> DNA
<213>Specific amplification lncRNAs ENST00000508241 primer sequence F
<400> 2
tttgggtttg gctgttactc a 21
<210> 3
<211> 22
<212> DNA
<213>Specific amplification lncRNAs ENST00000508241 primer sequence R
<400> 3
gaccacattt cccaagaaca ct 22
Claims (9)
1. molecular marked compound lncRNAs ENST00000508241, its sequence such as SEQ ID NO for diagnosis of glaucoma:1 institute
Show.
2. detect application of the product of lncRNAs ENST00000508241 expressions in diagnosis of glaucoma instrument is prepared.
3. application according to claim 2, it is characterised in that described detection lncRNAs ENST00000508241 tables
Include up to horizontal product：The system of lncRNAs ENST00000508241 expressions is detected by real-time fluorescence quantitative PCR
Agent.
4. application according to claim 3, it is characterised in that detect lncRNAs with real-time fluorescence quantitative PCR
The preparation of ENST00000508241 expressions includes specific amplification lncRNAs ENST00000508241 primer.
5. application according to claim 4, it is characterised in that detect lncRNAs with real-time fluorescence quantitative PCR
The specific amplification lncRNAs ENST00000508241 of ENST00000508241 expressions primer sequence is：
F:5'TTTGGGTTTGGCTGTTACTCA3’
R:5’GACCACATTTCCCAAGAACACT3’。
6. a kind of kit for diagnosis of glaucoma, it is characterised in that include detection lncRNAs ENST00000508241 tables
Up to horizontal reagent.
7. the kit according to claim 6 for diagnosis of glaucoma, it is characterised in that comprising fixed by real-time fluorescence
Measure the reagent that PCR detects lncRNAs ENST00000508241 expressions.
8. the kit according to claim 7 for diagnosis of glaucoma, it is characterised in that described to pass through real-time fluorescence
The reagent of quantitative PCR detection lncRNAs ENST00000508241 expressions is included by real-time fluorescence quantitative PCR specificity
Expand lncRNAs ENST00000508241 primer.
9. the kit for diagnosis of glaucoma according to claim 7 or 8, it is characterised in that described by real-time
The reagent of fluorescence quantitative PCR detection lncRNAs ENST00000508241 expressions passes through real time fluorescent quantitative comprising a pair
PCR specific amplification lncRNAs ENST00000508241 primer, its primer sequence is：
F:5'TTTGGGTTTGGCTGTTACTCA3’
R:5’GACCACATTTCCCAAGAACACT3’。
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710423183.1A CN106978507B (en) | 2017-06-07 | 2017-06-07 | Diagnosis of glaucoma molecular marked compound lncRNAsENST00000508241, kit and application |
| US16/619,946 US20210285047A1 (en) | 2017-06-07 | 2018-05-25 | Two molecular markers, kits and applications for glaucoma diagnosis |
| EP18812953.0A EP3636772A4 (en) | 2017-06-07 | 2018-05-25 | Two molecular markers for diagnosis of glaucoma, kit, and application |
| PCT/CN2018/088322 WO2018223846A1 (en) | 2017-06-07 | 2018-05-25 | Two molecular markers for diagnosis of glaucoma, kit, and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710423183.1A CN106978507B (en) | 2017-06-07 | 2017-06-07 | Diagnosis of glaucoma molecular marked compound lncRNAsENST00000508241, kit and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106978507A true CN106978507A (en) | 2017-07-25 |
| CN106978507B CN106978507B (en) | 2018-10-26 |
Family
ID=59344783
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710423183.1A Active CN106978507B (en) | 2017-06-07 | 2017-06-07 | Diagnosis of glaucoma molecular marked compound lncRNAsENST00000508241, kit and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106978507B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022022060A1 (en) * | 2020-07-31 | 2022-02-03 | 上海市精神卫生中心（上海市心理咨询培训中心） | Mci diagnostic marker, mci diagnostic kit, and corresponding detection method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101633923A (en) * | 2009-07-10 | 2010-01-27 | 四川大学 | Long non-coding RNA sequence relevant to human melanoma cells and application thereof |
| CN103789309A (en) * | 2014-02-13 | 2014-05-14 | 福建农林大学 | Long-chain non-coding RNA IncRNA-BcrAR and application thereof in cell canceration resistance |
| CN105002182A (en) * | 2014-11-18 | 2015-10-28 | 南京医科大学眼科医院 | Application of LncRNA-GAS5 in preparing glaucoma diagnosis reagent |
-
2017
- 2017-06-07 CN CN201710423183.1A patent/CN106978507B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101633923A (en) * | 2009-07-10 | 2010-01-27 | 四川大学 | Long non-coding RNA sequence relevant to human melanoma cells and application thereof |
| CN103789309A (en) * | 2014-02-13 | 2014-05-14 | 福建农林大学 | Long-chain non-coding RNA IncRNA-BcrAR and application thereof in cell canceration resistance |
| CN105002182A (en) * | 2014-11-18 | 2015-10-28 | 南京医科大学眼科医院 | Application of LncRNA-GAS5 in preparing glaucoma diagnosis reagent |
Non-Patent Citations (1)
| Title |
|---|
| 赵芳坤等: "长链非编码RNA在眼科疾病中的研究进展", 《国际眼科杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022022060A1 (en) * | 2020-07-31 | 2022-02-03 | 上海市精神卫生中心（上海市心理咨询培训中心） | Mci diagnostic marker, mci diagnostic kit, and corresponding detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106978507B (en) | 2018-10-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105002182B (en) | Applications of the LncRNA GAS5 in diagnosis of glaucoma reagent is prepared | |
| CN107028972B (en) | LncRNAsENST00000607393 SiRNA prepare the application for the treatment of glaucoma agents | |
| US20220259658A1 (en) | miRNA MARKER FOR DIAGNOSIS AND/OR TREATMENT OF ALZHEIMER'S DISEASE | |
| CN106978509B (en) | Diagnosis of glaucoma molecular marked compound lncRNAs ENST00000607393, kit and application | |
| CN111926074B (en) | Biomarker for detecting ischemic retinopathy, detection kit and application | |
| CN107142316B (en) | Diagnosis of glaucoma molecular marked compound lncRNAsT267384, kit and application | |
| CN106987651B (en) | Diagnosis of glaucoma molecular marked compound lncRNAsNR_026887, kit and application | |
| CN108450002A (en) | Method for diagnosing the illness caused by fetal alcohol syndrome | |
| CN107043824B (en) | Diagnosis of glaucoma molecular marked compound lncRNAsT342877, kit and application | |
| CN106978507B (en) | Diagnosis of glaucoma molecular marked compound lncRNAsENST00000508241, kit and application | |
| CN107034303B (en) | Diagnosis of glaucoma molecular marked compound lncRNAsENST00000564363, kit and application | |
| CN107974500A (en) | LncRNAGAS5 is as the application in age related macular degeneration diagnosis marker | |
| CN111733227B (en) | Molecular marker circRNA for diagnosing idiopathic optic neuritis, kit and application | |
| WO2010010951A1 (en) | Method for detection of expression of indicator mrna acting as indicator for endometriosis-related diseases, and probe for use in the method | |
| CN106978508B (en) | Diagnosis of glaucoma molecular marked compound lncRNAsTCONS_00025577, kit and application | |
| EP3636771A1 (en) | Three molecular markers for diagnosis of glaucoma, kit, and application | |
| EP3636772A1 (en) | Two molecular markers for diagnosis of glaucoma, kit, and application | |
| CN116103387A (en) | Biomarker for detecting advanced myopia complicated choroidal neovascularization, detection kit and application | |
| Colligris et al. | Recent patents and developments in glaucoma biomarkers | |
| CN107447008A (en) | For the enhancer RNA combinations of acatalepsia reason recurrent miscarriage, primer sets and application and kit | |
| EP3643794A1 (en) | Two molecular markers for diagnosis of glaucoma, kit, and application | |
| CN107385099A (en) | Biomarker for diagnosis and treatment gastric gland metastasis of cancer | |
| CN107385100A (en) | Purposes of the MCM8 as sdenocarcinoma of stomach Metastatic Marker | |
| CN106811532A (en) | ACTA1 as Dendritic cell diagnosis and treatment mark purposes | |
| CN106906285A (en) | ANKRD1 as Dendritic cell diagnosis and treatment target |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |