CN106978503A - A kind of LAMP detections primer sets and detection method for being used to detect salmonella - Google Patents
A kind of LAMP detections primer sets and detection method for being used to detect salmonella Download PDFInfo
- Publication number
- CN106978503A CN106978503A CN201710303012.5A CN201710303012A CN106978503A CN 106978503 A CN106978503 A CN 106978503A CN 201710303012 A CN201710303012 A CN 201710303012A CN 106978503 A CN106978503 A CN 106978503A
- Authority
- CN
- China
- Prior art keywords
- lamp
- salmonella
- primer
- seq
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to technical field of biological, it is related to a kind of LAMP detection primer sets for being used to detect salmonella, LAMP detection primer group includes four specific primers, is respectively positive inner primer FIP:SEQ ID NO.1, reverse inner primer BIP:SEQ ID NO.2, positive Outside primer F3:SEQ ID NO.3 and reverse inner primer B3:SEQ ID NO.4.Detection method includes：1st, testing sample DNA is extracted；2nd, LAMP detection reaction systems are prepared；3rd, the DNA extracted using in step 1 carries out LAMP amplified reactions as masterplate, and amplification is identified with real-time nephelometry.The present invention can reach 6.13 × 10 to salmonella qualitative detection sensitivity2CFU/mL (bacterial concentration), high 10 times of its remolding sensitivity regular-PCR and reaction result are easy to observation.LAMP primer group that the present invention is designed and the LAMP detection method for the salmonella set up have the advantages that specific good, sensitivity is high, quick, low-cost, can be applied to that basic unit is real-time, fast and accurately detect comma bacillus.
Description
Technical field：
The present invention relates to technical field of biological, more particularly to a kind of LAMP detections for being used to detecting salmonella are with drawing
Thing group and detection method.
Background technology：
Food security is the significant problem that each state all pays close attention to, and global economy is fast-developing, and the material life of people is gradually carried
Height, the consumption figure of animal derived food is consequently increased, the thing followed, is the visual field for stepping into people, is more closed by people
The food-safety problem triggered by animal derived food of note.The statistical number shown according to national food origin disease monitoring network
According to food-borne pathogens are the one of the main reasons of food origin disease.In animal derived food, food posioning is most normal
See.Salmonella is an important Pseudomonas in enterobacteriaceae, is the encountered pathogenic bacteria of humans and animals, the mankind can be caused a variety of
Disease, such as food poisoning, gastroenteritis, bacteremia, enteric fever.According to statistics, 85% food poisoning is by sand in the world at present
Caused by door Salmonella, prostatitis is occupy.
At present, to traditional detection methods such as the detection of the biochemical test of salmonella and serological Identifications, it is necessary to longer reality
Test the cycle, reagent is more and miscellaneous, there is certain limitation in terms of quick, specific detection, and various detection methods are sensitive, fast
Speed, but needs expensive huge instrument and equipment, complicated cumbersome electrophoresis process etc., and then make detection in the inspection limited by condition
In work, hardly result in commonly used.Therefore, detection method that is easy to operate, quick and precisely, easily promoting is developed to Cholera
Monitoring and control it is significant.
Ring mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) is Notomi etc.
A kind of new constant temperature nucleic acid amplification technology of the people in invention in 2000.Traditional round pcr be unable to do without heating and cooling repeatedly, and this consumes
When the process that consumes energy, and response procedures setting is also cumbersome.By contrast, LAMP technology overcomes these problems.According to LAMP
The principle of technology, it may be implemented under constant temperature (typically at 60~65 DEG C) quick continuous amplification, realizes experimentation fast
Speed, simplicity, instrument and equipment are simple, portable, the high advantage of testing result high specificity, sensitivity.LAMP amplification watchers
Formula is more, gel imaging system observation result, visual color change and Lateral Flow Strip, it is possible to use real-time fluorescence method and reality
When nephelometry, Real Time Observation is carried out to amplification by real-time fluorescence PCR instrument or real-time transmissometer.
The content of the invention：
It is an object of the invention to provide drawing for the LAMP detection method of the high salmonella of quick, specific good, sensitivity
Thing group；It is a further object to provide a kind of LAMP detection method of salmonella.
It is a kind of to be used to detect the LAMP detections primer sets and detection method of salmonella, by inner primer to FIP/BIP and
Outer primer is constituted to F3/B3, and FIP, BIP, F3, B3 are specific as follows：
A kind of LAMP detection method that salmonella is detected using foregoing primer sets, is comprised the following steps：
Step 1, extraction testing sample DNA；
Step 2, preparation LAMP detection reaction systems, reaction system include primer：SEQ ID NO.1、SEQ ID NO.2、
SEQ ID NO.3、SEQ ID NO.4；
Step 3, the DNA extracted using in step 1 carry out LAMP amplified reactions as masterplate, with real-time nephelometry identification amplification knot
Really.
It is preferred that, LAMP detections reaction system is specially：2 × reaction solution RM 12~13uL, FIP, BIP each 3.7~
4.3uL, F3, B3 each 0.4~0.6uL, Bst 0.9~1.2uL of archaeal dna polymerase, testing sample DNA1.8~2.2uL, are mended ultrapure
Water is to 25uL.
It is preferred that, FIP, BIP concentration are 40umol/L, and F3, B3 concentration are 5umol/L.
It is preferred that, 50.0 DEG C of the preheating temperature before the reaction of LAMP amplified reactions, the reaction temperature of LAMP amplified reactions is
64.0 DEG C and progress 40min, 95 DEG C of progress 2min of reacted enzyme deactivation temperature of LAMP amplified reactions.
In above-mentioned LAMP detection method, testing result measures turbidity value to judge that nucleic acid has in real time by real-time transmissometer
Without amplification.
The present invention uses above-mentioned technical proposal, according to salmonella gene hut sequence, and 4 specificity LAMP of design draw
Thing, for setting up salmonella LAMP detection method, as a result shows, the detection of the LAMP detection method of foundation to salmonella is special
It is different in nature good, and the sensitivity of method is high.The inventive method is not limited by condition of culture, and nucleic acid can be completed in 50min
Detection.The present invention can reach 6.13 × 10 to salmonella qualitative detection sensitivity2CFU/mL, better than general PCR detection method,
Its detection sensitivity is 10 times of regular-PCR.
Brief description of the drawings：
Accompanying drawing 1 is LAMP primer screening test figure, NO.1-5 be respectively blank control, invE primer sets, hilA primer sets,
InvA primer sets, hut primer sets.
The influence Test Drawing that temperature is reacted LAMP when accompanying drawing 2 is 60 DEG C.
The influence Test Drawing that temperature is reacted LAMP when accompanying drawing 3 is 61 DEG C.
The influence Test Drawing that temperature is reacted LAMP when accompanying drawing 4 is 62 DEG C.
The influence Test Drawing that temperature is reacted LAMP when accompanying drawing 5 is 63 DEG C.
The influence Test Drawing that temperature is reacted LAMP when accompanying drawing 6 is 64 DEG C.
The influence Test Drawing that temperature is reacted LAMP when accompanying drawing 7 is 65 DEG C.
The influence Test Drawing that the time is reacted LAMP when accompanying drawing 8 is 30min.
The influence Test Drawing that the time is reacted LAMP when accompanying drawing 9 is 40min.
The influence Test Drawing that the time is reacted LAMP when accompanying drawing 10 is 50min.
The influence Test Drawing that the time is reacted LAMP when accompanying drawing 11 is 60min.
Accompanying drawing 12 is primer specificity qualification test figure, and NO.2-8 is followed successively by Salmonella paratyphi A, B-mode secondary wound
Cold salmonella, salmonella typhimurium, salmonella separation strains DZJ-YS-001, salmonella separation strains DZJ-YS-002,
Staphylococcus aureus, Shigella dysenteriae amplification curve diagram；The NO.9 of the NO.1 and Right reactive tanks of Left reactive tanks is sky
White control.
Accompanying drawing 13 is primer specificity qualification test figure, and NO.10-16 is followed successively by the rugged bacillus of slope, salmonella, enterorrhagia
Row Escherichia coli O 157:H7, pathogenic ETEC, enterotoxigenic escherichia coli, Listeria monocytogenes, shigella boydii
Amplification curve diagram；The NO.9 of the NO.1 and Right reactive tanks of Left reactive tanks is blank control.
Accompanying drawing 14 is LAMP reaction sensitivity Test Drawings, and NO.1 is blank control, and NO.2-8 is that bacterial concentration is respectively
6.13×108、107、106、105、104、103、102CFU/ml。
Accompanying drawing 15 is LAMP reaction sensitivity Test Drawings, and NO.9 is blank control, and NO.10 is that bacterial concentration is 10CFU/
ml。
Accompanying drawing 16 is common PCR reaction sensitivity test figure, and M is DL1000Marker, and swimming lane 1-8 is bacterial concentration respectively
For 6.13 × 108、107、106、105、104、103、102、10CFU/ml。
Embodiment：
Test method used in described below is conventional method unless otherwise specified；Used material, reagent
Deng being the reagent and material commercially obtained unless otherwise specified.
First, design of primers
According to LAMP primer design principle, the salmonella specific gene group sequence in GenBank databases is carried out
Multiple Sequence Alignment, finds one section of high conservative region as amplification object, then passes through molecular biology software LAMPD
Designer5 designs 4 groups of primers, using HPLC way of purification.It is molten that primer after synthesis is diluted to 100pmol/pL with ultra-pure water
Liquid, -20 DEG C save backup.Each primer sequence is shown in Table 1.
The LAMP detection primers of the salmonella of table 1
2nd, the foundation of the LAMP examination criteria methods of salmonella
Bacterial genomes DNA Rapid extractions kit is Sangon Biotech (Shanghai) Co., Ltd.) limited company's product, LAMP
2 × reaction solution RM, Bst archaeal dna polymerase of amplification system are Rong Yan biotechnologies (China) Co., Ltd product.
Japanese Rong Yan LT-16alpha constant-temperature amplification gene detection systems, ABI Veriti 96Well Thermal
Cycler nucleic acid augmentative instruments, Biorad GelDoc XR gel imaging systems.
Salmonella experiment reference culture preserves center and Beijing road and bridge technical concern purchased from Chinese industrial microorganism to be had
Limit company (is shown in Table 2).
The experiment strain name of table 2 and numbering
1st, the extraction of sample DNA
Sample is comma bacillus, EHEC O157:H7, pathogenic ETEC, enterotoxigenic escherichia coli, Dan Zeng
The rugged bacillus of Listeria, Shigella dysenteriae, staphylococcus aureus, shigella boydii, slope, Salmonella paratyphi A, second
Type salmonella paratyphi, salmonella typhimurium, salmonella separation strains DZJ-YS-001, salmonella separation strains DZJ-
The liquid pure culture of 12 plants of reference cultures of YS-002 and 2 plants of salmonella separation strains.
DNA extracting method is specific to walk according to requirement progress is extracted on DNA of bacteria in DNA extraction kit specification
It is rapid as follows：
(1) bacterial solution of 1mL incubated overnights is drawn, is added in 1.5mL centrifuge tubes, room temperature 8000rpm centrifugation 1min are abandoned
Supernatant, collects thalline.400uL Buffer Digestion are added, concussion is mixed.65 DEG C of water-bath 1h are cracked completely to cell.
(2) 200uL Buffer PB are added, fully reverse to mix, -20 DEG C of refrigerators place 5min.
(3) room temperature 10000rpm centrifuges 5min, supernatant is transferred in new 1.5mL centrifuge tubes.
(4) isometric isopropanol is added, 5~8 times is overturned and is allowed to fully mixing, be stored at room temperature 2~3min.Room temperature
10000rpm centrifuges 5min, abandons supernatant.
(5) 1mL75% ethanol is added, rinsing 1~3min, 10000rpm centrifugation 2min is overturned, abandons supernatant.
(6) repeat step 5 is once.
(7) ethanol that room temperature of uncapping is inverted 5~10min extremely residuals volatilizees completely.
(8) DNA obtained 50~100uLTE Buffer dissolve.
260/280 ratio of the DNA profiling of acquisition is between 1.8~2.0, and concentration is in 200~500ng/uL.Extract
DNA mass and concentration are higher, are adapted to follow-up amplified reaction.
2nd, LAMP reaction systems
Reaction system is：2 × reaction solution RM 12.5uL, inner primer FIP, BIP each 0.5uL of each 4uL, outer primer F3, B3,
Bst archaeal dna polymerases 1uL, DNA masterplate 2.0uL, moisturizing to 25uL.
Inner primer FIP, BIP concentration are 40umol/L, and outer primer F3, B3 concentration are 5umol/L.
DNA masterplates are extracted by the culture of each bacterium and obtained.
3rd, the screening of optimal primer
By 4 groups of primers (invA, hilA, hut, invE) of table 1 using salmonella DNA as template, in Rong Yan LT-
LAMP reactions are carried out on 16alpha constant-temperature amplification gene detection systems simultaneously, and sets NO.1-5 in blank control, Fig. 1 and is respectively
Blank control, invA primer sets, hilA primer sets, hut primer sets and invE primer sets.
The program of amplified reaction is：Reaction temperature is 64 DEG C, and the reaction time is 40min, and reaction terminates rear reading numerical values.Knot
Fruit shows that primer sets invA amplifications time started (Tt values) are earliest (see Fig. 1), and peak of curve height (Df) value highest, primer
Group invA amplifications time started (Tt values) and peak of curve height (Df values) concrete numerical value are shown in Table 3.
The LAMP primer screening test Tt values of table 3 and Df values
4th, the optimization of LAMP reaction conditions
4.1st, the optimization of reaction temperature:Optimal primer sets hut using above-mentioned screening is as amplimer, with salmonella
DNA is template, and 95 DEG C of enzymes inactivate 2min, do 6 groups of controls, respectively by reactant mixture be placed on 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C, 64
DEG C, carry out LAMP reactions under 65 DEG C of reaction conditions, and set blank control, accompanying drawing 2~7 is respectively 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C,
64 DEG C, 65 DEG C of amplification curve diagrams, the NO.9 of the NO.1 and Right reactive tanks of Left reactive tanks is blank control, reaction time
For 40min, reaction terminates rear reading numerical values.As a result show, when reaction temperature is 64 DEG C, expanding effect is best, each reaction group
Amplification time started (Tt values) and peak of curve height (Df values) concrete numerical value are shown in Table 4.Therefore, primer sets hut amplified reactions
Optimum temperature is 64 DEG C.
The LAMP reaction temperatures Optimum Experiment Tt values of table 4 and Df values
4.2nd, the optimization in reaction time：The optimal primer sets hut of screening is as amplimer above, with salmonella DNA
For template, with above-mentioned optimal 64 DEG C for reaction temperature, 95 DEG C of enzymes inactivate 2min, do 4 groups of controls, are respectively placed on reactant mixture
LAMP reactions are carried out under 30min, 40min, 50min, 60min reaction condition, and set blank control, accompanying drawing 8~11 is respectively
30min, 40min, 50min, 60min amplification curve diagram, the NO.9 of the NO.1 and Right reactive tanks of Left reactive tanks is blank
Control, reaction terminates rear reading numerical values.As a result show, when reacted between be 40 DEG C when, expanding effect preferably, the used time is most short, respectively
Reaction group amplification time started (Tt values) and peak of curve height (Df values) concrete numerical value are shown in Table 5.Therefore, primer sets hut is expanded
The optimum temperature of reaction is 40min.
The LAMP reaction time Optimum Experiment Tt values of table 5 and Df values
By experimental verification repeatedly, the LAMP reaction conditions of salmonella are adjusted, the LAMP after adjusting and optimizing is anti-
It is 64 DEG C to answer temperature, and the reaction time is 40min, and 95 DEG C of enzymes inactivate 2min.
3rd, the specificity identification of primer:
In order to verify the specificity of design primer Salmeterol fluticasone propionate, with Part II (foundation of examination criteria method) institute
Reaction system and optimization postcondition are stated, is extracted with 8 kinds of nonsalmonella bacteriums and 5 strain positive control Salmonella cultures
DNA is that template carries out LAMP augmentation detections, and sets blank control, and NO.2-8 (a) is followed successively by Salmonella paratyphi A, second
Type salmonella paratyphi, salmonella typhimurium, salmonella separation strains DZJ-YS-001, salmonella separation strains DZJ-
YS-002, staphylococcus aureus, Shigella dysenteriae amplification curve diagram, NO.10-16 (b) are followed successively by the rugged bacillus of slope, cholera arc
Bacterium, enterorrhagia row Escherichia coli O 157:H7, pathogenic ETEC, enterotoxigenic escherichia coli, Listeria monocytogenes,
Shigella boydii amplification curve diagram, the NO.9 of the NO.1 and Right reactive tanks of Left reactive tanks is blank control, and reaction terminates
Reading numerical values afterwards.
Testing result is shown in accompanying drawing 12~13, it can be seen that the DNA profiling only extracted with salmonella pure culture has expansion
Increase curve to occur, other reacting holes occur without amplification curve, other samples are feminine gender.As a result show, primer sets hut is to sramana
Salmonella has selectivity, available for the specific detection to salmonella.
4th, sensitivity experiment：
1st, original bacteria liquid concentration is quantified
The salmonella bacterium solution in exponential phase through 37 DEG C of incubated overnights, is serially diluted again with physiological saline 10,
Plate count, calculates original bacteria liquid concentration.By the method for plate culture count measure salmonella original bacteria liquid concentration for 6.13 ×
108Cfu/ml, colony counting the results are shown in Table 6.
The enterorrhagia Bacillus coil 0157 of table 6：H7 plate counts
2nd, the dilution of template and LAMP reactions：:By the original bacteria liquid that (quantifying for original bacteria liquid concentration) measures in previous step
10 times of gradient dilutions are taken turns doing, dilution factor is 10-1~10-7, No. 1, No. 2, No. 3, No. 4, No. 5, No. 6, No. 7 is respectively labeled as, so
Each dilution factor takes 2uL as template afterwards, is entered with Part II (foundation of examination criteria method) described reaction system and condition
Row LAMP reacts, and reaction terminates rear reading numerical values.Meanwhile, also expanded using traditional PCR method, reaction condition is：95
DEG C pre-degeneration 5min；95 DEG C of denaturation 40s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s, carry out 30 circulations；72 DEG C extend 5min, 4
DEG C preserve reaction product, reaction terminate after, take reaction product carry out detected through gel electrophoresis, PCR primer length be 194bp.
3rd, testing result is shown in that NO.1 is blank control in accompanying drawing 14~16, Figure 14, and NO.2-8 is that bacterial concentration is respectively
6.13×108、107、106、105、104、103、102CFU/ml；NO.9 is blank control in accompanying drawing 15, and NO.10 is bacterial concentration
For 10CFU/ml, M is DL1000Marker in Figure 16, and swimming lane 1-8 is that bacterial concentration is 6.13 × 10 respectively8、107、106、105、
104、103、102、10CFU/ml.As a result show：The sensitivity testing result 1 of traditional PCR amplifications, 2,3,4,5, No. 6 swimming lanes have
Specific band, the sensitivity minimization of amplification of other swimming lanes without specific amplification, i.e. PCR is 6.13 × 103CFU/ml。LAMP
Amplified reaction result is shown in that accompanying drawing 14,15, NO.2-8 reacting holes have amplification curve outlet, and LAMP amplification sensitivity minimizations are
6.13×102CFU/ml, compared with regular-PCR, sensitivity improves 10 times.
A kind of final LAMP detection primer sets for being used to detect salmonella that the present invention is determined are tested more than,
FIP/BIP and outer primer are made up of to F3/B3 inner primer, FIP, BIP, F3, B3 are specific as follows：
A kind of LAMP detection method that salmonella is detected using foregoing primer sets, is comprised the following steps：
Step 1, extraction testing sample DNA；
Step 2, preparation LAMP detection reaction systems, reaction system include primer：SEQ ID NO.1、SEQ ID NO.2、
SEQ ID NO.3, SEQ ID NO.4,2 × reaction solution RM 12.5uL, FIP, BIP concentration is 40umol/L and each 4uL, F3,
B3 concentration is 5umol/L and each 0.5uL, Bst archaeal dna polymerase 1.0uL, testing sample DNA2.0uL, mends ultra-pure water extremely
25uL；
Step 3, the DNA extracted using in step 1 carry out LAMP amplified reactions as masterplate, before the reaction of LAMP amplified reactions
50.0 DEG C of preheating temperature, the reaction temperature of LAMP amplified reactions is 64.0 DEG C and carries out 40min, after the reaction of LAMP amplified reactions
95 DEG C of enzyme deactivation temperature progress 2min, identify amplification with real-time nephelometry.
Sequence table
<110>Ningxia Entry-Exit Inspection and Quarantine Bureau inspection and quarantine complex art center
<120>A kind of LAMP detections primer sets and detection method for being used to detect comma bacillus
<170>PatentIn version 3.5
<160>4
<210>1
<211>44
<212>DNA
<213>Artificial sequence
<400>1
GTTCCCCTTCCGTTAGCGGCTTTTTACCTGACGCAGGATTACCG 44
<210>2
<211>44
<212>DNA
<213>Artificial sequence
<400>2
CGCAAGAGTGCGCGTGGTTATTTTGTACGACGAATGAGCAGACA 44
<210>3
<211>18
<212>DNA
<213>Artificial sequence
<400>3
GCGGATATTGCCGTGGAT 18
<210>4
<211>19
<212>DNA
<213>Artificial sequence
<400>4
TGAGAAACAATCCGCGACG 19
Claims (5)
1. a kind of LAMP detections primer sets and detection method for being used to detect salmonella, it is characterised in that by inner primer pair
FIP/BIP and outer primer are constituted to F3/B3, and FIP, BIP, F3, B3 are specific as follows：
2. the primer sets described in a kind of utilization claim 1 detect the LAMP detection method of salmonella, it is characterised in that including
Following steps：
Step 1, extraction testing sample DNA；
Step 2, preparation LAMP detection reaction systems, reaction system include primer：SEQ ID NO.1、SEQ ID NO.2、SEQ
ID NO.3、SEQ ID NO.4；
Step 3, the DNA extracted using in step 1 carry out LAMP amplified reactions as masterplate, and amplification is identified with real-time nephelometry.
3. the primer sets described in a kind of utilization claim 1 as claimed in claim 2 detect the LAMP detection sides of salmonella
Method, it is characterised in that LAMP detects that reaction system is specially：2 × reaction solution RM 12~13uL, FIP, BIP each 3.7~
4.3uL, F3, B3 each 0.4~0.6uL, Bst 0.9~1.2uL of archaeal dna polymerase, testing sample DNA1.8~2.2uL, are mended ultrapure
Water is to 25uL.
4. the primer sets described in a kind of utilization claim 1 as claimed in claim 3 detect the LAMP detection sides of salmonella
Method, it is characterised in that FIP, BIP concentration are 40umol/L, and F3, B3 concentration are 5umol/L.
5. the primer sets described in a kind of utilization claim 1 as claimed in claim 2 detect the LAMP detection sides of salmonella
Method, it is characterised in that 50.0 DEG C of the preheating temperature before the reaction of LAMP amplified reactions, the reaction temperature of LAMP amplified reactions is
64.0 DEG C and progress 40min, 95 DEG C of progress 2min of reacted enzyme deactivation temperature of LAMP amplified reactions.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710303012.5A CN106978503A (en) | 2017-05-03 | 2017-05-03 | A kind of LAMP detections primer sets and detection method for being used to detect salmonella |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710303012.5A CN106978503A (en) | 2017-05-03 | 2017-05-03 | A kind of LAMP detections primer sets and detection method for being used to detect salmonella |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106978503A true CN106978503A (en) | 2017-07-25 |
Family
ID=59341884
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710303012.5A Pending CN106978503A (en) | 2017-05-03 | 2017-05-03 | A kind of LAMP detections primer sets and detection method for being used to detect salmonella |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106978503A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108103212A (en) * | 2017-12-30 | 2018-06-01 | 华南农业大学 | A kind of method of ring mediated isothermal amplification rapid detection of salmonella |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102424842A (en) * | 2011-12-21 | 2012-04-25 | 中国人民解放军疾病预防控制所 | Salmonella LAMP (loop-mediated isothermal amplification) detection method, and special primer and kit thereof |
| CN102912021A (en) * | 2012-10-23 | 2013-02-06 | 北京出入境检验检疫局检验检疫技术中心 | Molecular motor biosensor kit for molecular subtyping of salmonella |
| CN104278102A (en) * | 2014-10-23 | 2015-01-14 | 上海交通大学 | Quadruple PCR (polymerase chain reaction) detecting method of salmonella |
| CN106367493A (en) * | 2016-08-30 | 2017-02-01 | 上海生物信息技术研究中心 | Method for rapidly detecting salmonella at constant temperature, primer and applications of primer |
-
2017
- 2017-05-03 CN CN201710303012.5A patent/CN106978503A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102424842A (en) * | 2011-12-21 | 2012-04-25 | 中国人民解放军疾病预防控制所 | Salmonella LAMP (loop-mediated isothermal amplification) detection method, and special primer and kit thereof |
| CN102912021A (en) * | 2012-10-23 | 2013-02-06 | 北京出入境检验检疫局检验检疫技术中心 | Molecular motor biosensor kit for molecular subtyping of salmonella |
| CN104278102A (en) * | 2014-10-23 | 2015-01-14 | 上海交通大学 | Quadruple PCR (polymerase chain reaction) detecting method of salmonella |
| CN106367493A (en) * | 2016-08-30 | 2017-02-01 | 上海生物信息技术研究中心 | Method for rapidly detecting salmonella at constant temperature, primer and applications of primer |
Non-Patent Citations (2)
| Title |
|---|
| 谭贵良等: "《现代分子生物学及组学技术在食品安全检测中的应用》", 30 June 2014, 中山大学出版社 * |
| 陈贤林等: "TaqMan实时荧光PCR快速检测沙门氏菌的初步研究", 《现代预防医学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108103212A (en) * | 2017-12-30 | 2018-06-01 | 华南农业大学 | A kind of method of ring mediated isothermal amplification rapid detection of salmonella |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102605055B (en) | Multiplex quantitative PCR (polymerase chain reaction) detection kit for vibrio parahaemolyticus and detection method | |
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN103409546B (en) | Kit for detecting streptococcus suis type 2 and application of kit | |
| CN112725480B (en) | Primer group, detection method and kit for rapidly detecting salmonella typhi by LAMP (loop-mediated isothermal amplification) technology | |
| CN107338314B (en) | Closed-tube visual eel-derived aeromonas hydrophila loop-mediated isothermal amplification detection method | |
| CN102094090B (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN108588248A (en) | Multiple PCR primer group, kit and detection method for detecting 5 kinds of fimbriae genes of enterotoxigenic escherichia coli | |
| CN110106266A (en) | Identify the method for pseudomonas aeruginosa and pseudomonas putida | |
| CN105039541A (en) | Primer and probe sequence used for LAMP-LFD detection of vibrio fluvialis and application of primer and probe sequence | |
| CN103436602A (en) | Kit and method for simultaneous detection of Staphylococcus aureus gene and Escherichia coli gene by using dual molecular beacon-LAMP process | |
| CN104846078A (en) | Campylobacter jejuni constant-temperature fluorescence detection primer group, kit, and detection method which are capable of avoiding false negative | |
| CN107365869B (en) | Method and primer for detecting Klebsiella pneumoniae by loop-mediated isothermal amplification technology | |
| CN106282375A (en) | The LAMP primer group of a kind of Salmonella typhimurium and test kit and using method | |
| CN107022638A (en) | The LAMP primer group of quick detection salmonella and its application | |
| CN102912037B (en) | RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection method for transmissible gastroenteritis of swine TGE | |
| CN100410389C (en) | Method for detecting Brucellosis and primer thereof | |
| CN103571943A (en) | Nucleic acid detection method for salmonella typhimurium | |
| CN106978503A (en) | A kind of LAMP detections primer sets and detection method for being used to detect salmonella | |
| CN106987644A (en) | A kind of LAMP detections primer sets and detection method for being used to detect staphylococcus aureus | |
| CN107385077A (en) | For detecting the specific primer, the kit containing the primer and its application of S. pullonum | |
| CN103993090A (en) | Specific nucleotides for providencia O31, O41, O42, O43 and O50 and application of specific nucleotides | |
| CN111440887A (en) | Pseudomonas proteorum TaqMan real-time fluorescence quantitative PCR detection kit and preparation method thereof | |
| CN116287344A (en) | Primer pair, kit and method for detecting Cronobacter sakazakii | |
| CN106978502A (en) | A kind of LAMP detections primer sets and detection method for being used to detect comma bacillus | |
| CN109355408A (en) | A kind of primer, kit and its method of PSR detection Escherichia coli type I shiga toxin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170725 |