CN106978429B - A kind of bovine enterokinase light chain load magnetic bead and its preparation method and application - Google Patents

A kind of bovine enterokinase light chain load magnetic bead and its preparation method and application Download PDF

Info

Publication number
CN106978429B
CN106978429B CN201710158025.8A CN201710158025A CN106978429B CN 106978429 B CN106978429 B CN 106978429B CN 201710158025 A CN201710158025 A CN 201710158025A CN 106978429 B CN106978429 B CN 106978429B
Authority
CN
China
Prior art keywords
bek
magnetic bead
protein
enterokinase
egfp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201710158025.8A
Other languages
Chinese (zh)
Other versions
CN106978429A (en
Inventor
杨安钢
阎博
胡志嵩
赵晶
欧阳清
杜晓
李昂
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fourth Military Medical University FMMU
Original Assignee
Fourth Military Medical University FMMU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fourth Military Medical University FMMU filed Critical Fourth Military Medical University FMMU
Priority to CN201710158025.8A priority Critical patent/CN106978429B/en
Publication of CN106978429A publication Critical patent/CN106978429A/en
Application granted granted Critical
Publication of CN106978429B publication Critical patent/CN106978429B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424—Serine endopeptidases (3.4.21)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/14—Extraction; Separation; Purification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21—Serine endopeptidases (3.4.21)
    • C12Y304/21009—Enteropeptidase (3.4.21.9), i.e. enterokinase

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kind of bovine enterokinase light chain load magnetic beads and its preparation method and application, belong to technical field of bioengineering.The present invention designs synthesizing biotinylated enzyme identification peptide and bEKLThe nucleotide sequence of amalgamation and expression prepares the bEK of biotin modification by the method in E. coli and renaturation in vitroL, then using extremely strong affinity between biotin and streptavidin, by bEKLSteady load is in the magnetic-particle of coupling streptavidin.The bEK prepared using this methodLLoading magnetic bead specific can cut the substrate containing enterokinase cleavage site, can be used in the excision of recombinant protein fusion tag.BEKL load magnetic bead prepared by the present invention improves the service efficiency of enzyme, reduces use cost, provides strong tool for the research of bioengineering pharmacy industry, biochemistry and molecular biology etc..

Description

A kind of bovine enterokinase light chain load magnetic bead and its preparation method and application
Technical field
The invention belongs to technical field of bioengineering, and in particular to a kind of bovine enterokinase light chain load magnetic bead and its preparation side Method and application.
Background technique
Enterokinase (Enterokinase, EC 3.4.21.9) is present in the duodenal mucosa of mammal, is to make pancreas Proproteinase hydrolysis becomes the endopeptidase (endo-peptidase) of active chymotrypsin.Ox intestine kinase is by a heavy chain The heterodimer that (799AA) and a light chain (235AA) are formed by connecting by covalent bond.Ox intestine kinase heavy chain is lived without catalysis Property, there are multiple transmembrane domains, be positioned at duodenum brush edge film surface, guarantee enterokinase to the special of trypsinogen Property cutting.And its light chain has catalytic action, can identify under conditions of not depending on its heavy chain and contain DDDDK amino acid sequence More peptide or proteins, and cut lysine and its c-terminus close to the peptide bond between amino acid.Therefore, bovine enterokinase light chain (bovine Enterokinase light chain,bEKL) it is usually used in aminoterminal by fusion tag sequence from destination protein Excision obtains the destination protein without containing any nonessential amino acid residue.
Initial enterokinase preparation extracts from the duodenal mucosa of ox or pig, because its limited source and quality stability are poor The problems such as, it cannot achieve extensive use.With the development of biotechnology, bEKLIn the engineering cells such as Escherichia coli or yeast into Row heterogenous expression is achieved.The bEK of heterogenous expressionLAlbumen have endopeptidase enzyme spcificity identical with original enterokinase and Activity, can be realized large scale preparation and quality is stablized, and be increasingly becoming the principal mode of commercialization enterokinase preparation, bEKLIn The application of bioengineering field is also more and more extensive.
Currently, bEKLIt has become researcher and cuts off the nonessential peptide fragments such as fusion tag during protein expression and purification One of preferred endopeptidase.Enterokinase enzymatic reaction efficiency is higher, the bEK of usual Gamma MagnitudeLSufficient amount can be prepared Destination protein is tested for function assessment.If desired a large amount of destination protein is obtained, the experiment in the directions such as structural research, bEK are carried outL Consumption be consequently increased, reach a milligram rank.Although being compared using engineering cell heterogenous expression from animal tissue extraction, bEKL Preparation cost be remarkably decreased, but be commercialized enterokinase preparation price it is still higher, a large amount of bEKLUse be section It grinds work belt and carrys out no small expenditure.Enzyme as a kind of biocatalyst, its own before the reaction after content and vigor will not occur Change.Therefore, the enterokinase after endonuclease reaction is completed, still with enough vigor for reaction next time.But mesh Preceding commercialization bEKLPreparation can not be realized by easy-to-use operating procedure and be recycled to enzyme, objectively be caused pair The waste of enzyme preparation.
Using bEKLTo fusion protein complete label peptide fragment excision after, in order to not influence the purity of final product, need by bEKLIt is separated with destination protein.Common coupling bEKLThe resin of antibody is to the bEK in endonuclease reaction systemLIt is removed.But quotient Product bEKLAdsorb resin price it is higher, and can not Reusability, strongly limit such product in bEKLRemoval step is answered With.Currently, some suppliers provide the bEK that fusion has 6 × His sequence labelL, can after carrying out the excision of label peptide fragment using it By nickel column by bEK in endonuclease reaction systemLRemoval.It is incorporated into the bEK of fillerLAfter elution, nickel column may be implemented to make repeatedly With use cost declines to a great extent compared with the absorption resin of coupled antibody.But no matter use absorption resin or nickel column removal bEKL, It requires to increase additional operating procedure in protein purification procedures, not only complicates purifying process, but also destination protein Yield also decreases.
Summary of the invention
In order to overcome the problems of the above-mentioned prior art, it is negative that the purpose of the present invention is to provide a kind of bovine enterokinase light chains Magnetic bead and its preparation method and application is carried, can effectively solve the problem that existing bovine enterokinase light chain preparation can not be recycled and complete At being not easy the problem of removing after endonuclease reaction.
The present invention is to be achieved through the following technical solutions:
The invention discloses a kind of preparation methods of bovine enterokinase light chain load magnetic bead, comprising the following steps:
1) gene chemical synthesis biotinylation enzyme identifies peptide fragment Avitag and bEKLThe nucleotide sequence of amalgamation and expression, using fixed The nucleotide sequence is inserted into pET-28a plasmid to PCR cloning PCR, building obtains recombinant plasmid pET-28a-Avi-bEKL；
2) by recombinant plasmid pET-28a-Avi-bEKLIt is transformed into Escherichia coli, the bEK of inducing expression biotin modificationL Inclusion body protein, then ultrasound cracks broken bacterium, prepares inclusion body, using dilution refolding method, obtains biotin modification bEKL；
3) by the bEK of biotin modificationLIt is incubated for streptavidin magnetic bead, utilizes pole between biotin and streptavidin Strong affinity, is prepared bEKLLoad magnetic bead.
Preferably, in step 1), biotinylation enzyme identifies peptide fragment Avitag and bEKLThe nucleotide sequence of amalgamation and expression NcoI restriction enzyme site is contained at overall length 867bp, 5 ' ends, and XhoI restriction enzyme site is contained at 3 ' ends, and sequence is as shown in SEQ ID NO.1.
Preferably, in step 2), bacterium, ultrasound cracking parameter are crushed with ultrasound cracking instrument are as follows: diameter 6mm vibration amplitude arm, 30% power, open 3 seconds/stop 3 seconds, ultrasonic pyrolysis time be 20 minutes.
Preferably, the streptavidin magnetic bead is Beaver Nanotechnology's product, is by strepto- Avidin is coupled at Magnetic Microspheres-Carrier surface by covalent bond and is prepared, can efficiently in conjunction with biotin modification nucleic acid, The molecules such as albumen.
The invention also discloses load magnetic bead using bovine enterokinase light chain made from above-mentioned preparation method.
The invention also discloses load magnetic bead as enterokinase preparation in protein expression using above-mentioned bovine enterokinase light chain Application in purification technique.
The bovine enterokinase light chain load magnetic bead being capable of substrate of the specificity cutting containing enterokinase cleavage site.
The substrate containing enterokinase cleavage site is the recombinant protein containing the nonessential peptide fragment such as fusion tag.It is common Recombinant protein sequence label be Fc, 6*His, GST, FLAG etc..
The recombinant protein is the Fc-EGFP fusion protein containing Fc sequence label, and the fusion protein is by recombinant plasmid PcDNA3.1-Fc-EGFP transfection expression obtains；Wherein:
The recombinant plasmid pcDNA3.1-Fc-EGFP is by encoding human IgG heavy chain secreting signal peptide-Fc (human IgG1) The genetic fragment of albumen and the EGFP gene segment containing enterokinase cleavage site, are connected into pcDNA3.1 using directional cloning method It is obtained in (-) plasmid；
The genetic fragment of encoding human IgG heavy chain secreting signal peptide-Fc (human IgG1) albumen, overall length 729bp, 5 ' ends are contained XhoI restriction enzyme site is contained at NheI restriction enzyme site, 3 ' ends, and sequence is as shown in SEQ ID NO.2；
Encode the EGFP gene segment containing enterokinase cleavage site, overall length 753bp, 5 ' ends containing XhoI restriction enzyme site, 3 ' ends contain and BamHI restriction enzyme site, and sequence is as shown in SEQ ID NO.3.
The recombinant protein contains FCThe Fc-IL2 fusion protein of sequence label, the fusion protein is by recombinant plasmid PcDNA3.1-Fc-IL2 transfection expression obtains；Wherein:
The recombinant plasmid pcDNA3.1-Fc-IL2 is will to encode the IL2 genetic fragment containing enterokinase cleavage site, is adopted It is connected into pcDNA3.1-Fc-EGFP recombinant plasmid and is obtained with directional cloning method；
The IL2 genetic fragment containing enterokinase cleavage site is encoded, overall length 435bp, XhoI restriction enzyme site, 3 ' are contained in 5 ' ends End contains and BamHI restriction enzyme site, and sequence is as shown in SEQ ID NO.4.
Compared with prior art, the invention has the following beneficial technical effects:
The present invention provides the preparation methods that one kind is capable of the bovine enterokinase light chain load magnetic bead of Reusability, specifically set Count synthesizing biotinylated enzyme identification peptide (Avitag) and bEKLThe nucleotide sequence of amalgamation and expression, by high in Escherichia coli The method of effect expression and renaturation in vitro, prepares the bEKL of biotin modification, then utilizes pole between biotin and streptavidin Strong affinity, by bEKLSteady load is in the magnetic-particle of coupling streptavidin.The bEK prepared using this methodLLoad magnetic Pearl specific can cut the substrate containing enterokinase cleavage site, can be used in the excision of recombinant protein fusion tag.
Compared to the bEK being commercialized at presentLProduct, bEK prepared by the present inventionLLoading magnetic bead tool, there are two remarkable advantages: the One, it, can be by simple step Magnetic Isolation by bEK after the completion of the cutting of the fusion tag of recombinant proteinLMagnetic bead is loaded from reaction It is removed in system, simplifies purifying process, ensure that the yield of destination protein；Second, the bEK of Magnetic Isolation recyclingLLoad magnetic Pearl digestion vigor, being capable of Reusability without being remarkably decreased.The present invention passes through bEKLLoad magnetic bead cutting Fc-EGFP fusion protein with And bEKLIt loads magnetic bead and prepares the experimental verification without label IL2, bEKLMagnetic bead cleavage activity with higher is loaded, and can be anti- It is multiple to use, it is able to maintain stable digestion vigor.BEK prepared by the present inventionLLoad magnetic bead improves the service efficiency of enzyme, reduces Use cost, for the research of bioengineering pharmacy industry, biochemistry and molecular biology etc. provides strong tool.
Detailed description of the invention
Fig. 1 is bEKLLoad the structural schematic diagram of magnetic bead；
Fig. 2 is recombinant plasmid pET-28a-Avi-bEKLStructural schematic diagram；
Fig. 3 is bEKLProkaryotic expression and magnetic bead load front and back bEKLProtein Detection result；Wherein, A figure, which shows to apply, examines horse This brilliant blue colouring method detects bEKLProkaryotic expression situation, B figure show affine using the strepto- of horseradish peroxidase-labeled Element detection bEKLProkaryotic expression and bEKLBiotin modification situation, C figure, which is shown, detects magnetic bead using coomassie brilliant blue staining method Load front and back bEKLAlbumen situation of change, D figure, which is shown, detects magnetic bead using the Streptavidin of horseradish peroxidase-labeled Load front and back bEKLAlbumen situation of change；
Fig. 4 is the structural schematic diagram of recombinant plasmid pcDNA3.1-Fc-EGFP and pcDNA3.1-Fc-IL2；
Fig. 5 is that Western Bolt detects bEKLIt loads magnetic bead and cuts Fc-EGFP fusion protein effect picture；
Fig. 6 is bEKLLoad magnetic bead Detection of Stability result during Reusability；
Fig. 7 is Fc-IL2 expressing fusion protein, digestion and IL2 protein purification electrophoresis result；
Fig. 8 is that CTLL-2 cell proliferation experiment verifies IL2 protein active result.
Specific embodiment
Below with reference to specific embodiment, the present invention is described in further detail, it is described be explanation of the invention and It is not to limit.
The present invention is able to solve current bEKLWhat preparation can not be recycled and complete to be not easy after endonuclease reaction to remove Problem, reaching reduces bEKLUse cost and the purpose for simplifying destination protein purifying process.
In order to achieve the above objectives, the present invention is achieved by following technological means:
Firstly, the nucleotide sequence of the identification of gene chemical synthesis biotinylation enzyme peptide fragment (Avitag) and bEKL amalgamation and expression, It is inserted into pET-28a plasmid with directed cloning method, constructs prokaryotic expression carrier pET-28a-Avi-bEKL, structure is referring to figure 2；Then, in Escherichia coli inducing expression biotin modification bEKLInclusion body protein；Then, ultrasound cracks broken bacterium, Inclusion body is prepared, biologically active bEK is obtained by the method for dilution refoldingL；Finally, by the bEK of biotin modificationLWith Streptavidin magnetic bead is incubated for, and using affinity extremely strong between biotin and streptavidin, bEK is preparedLLoad magnetic Pearl, structure are as shown in Figure 1.
In order to verify bEKLThe digestion activity of magnetic bead is loaded, the present invention constructs the Fc- containing enterokinase cleavage site EGFP fusion protein eukaryotic expression vector pcDNA3.1-Fc-EGFP, and expressed in mammalian cell HEK293-F, with ProteinA affinity chromatography filler purifies Fc-EGFP fusion protein.Use the bEK of various doseLLoad magnetic bead and 50 μ g Fc- EGFP fusion protein mixed at room temperature 16 hours, Western Blot detect Fc-EGFP fusion protein by bEKLLoad magnetic bead cutting Efficiency.Referring to Fig. 5, the results show that bEKLMagnetic bead cleavage activity with higher is loaded, 10 μ L magnetic beads can be by fusion protein It cuts completely through.
bEKLLoad magnetic bead not only has efficient cleavage activity, but also combines and consolidate between enterokinase and magnetic bead, has The ability of Reusability.Take 10 μ L bEKLAfter loading magnetic bead and 50 μ g Fc-EGFP fusion proteins progress endonuclease reaction, pass through magnetic Property separation and recovery bEKLMagnetic bead is loaded, the magnetic bead of recycling is subjected to endonuclease reaction with 50 μ g fusion proteins again, it is multiple repeatedly Digestion 5 times.Western Blot detection is carried out to supernatant samples after digestion, referring to Fig. 6,5 endonuclease reactions are equal as the result is shown Substrate protein can be cut completely through, bEKLLoad magnetic bead does not dissociate during Reusability, is able to maintain stable Digestion vigor.
bEKLIt, can be by simple step Magnetic Isolation by bEK after loading the cutting that magnetic bead completes fusion proteinLLoad magnetic Pearl removal, simplifies purifying process, ensure that the yield of destination protein.Interleukin 2 (interleukin-2, IL2) is compiled Code gene cloning enters in the carrier for expression of eukaryon containing Fc sequence label and enterokinase cleavage site, construction recombination plasmid PcDNA3.1-Fc-IL2, and expressed in mammalian cell HEK293-F.Fc-IL2 fusion protein uses ProteinA filler After one-step method affinity chromatography, bEK is usedLLoad magnetic bead cuts Fc sequence label.Sample is gone through Magnetic Isolation after digestion Except bEKLAfter loading magnetic bead, mixed again with ProteinA filler, cut off the IL2 of Fc fusion tag not with ProteinA filler In conjunction with it is the IL2 albumen for being free of fusion tag that affinity chromatography, which flows through sample,.Electrophoresis detection flows through in sample without label IL2 ratio Example is 95% or more, and has no enterokinase electrophoretic band.CTLL-2 cell proliferation experiment the result shows that, using bEKLLoad magnetic bead Preparation has bioactivity similar with two kinds of commercialization IL2 without label IL2.bEKLLoading magnetic bead can be as strong work Tool provides great convenience during the recombinant protein of preparation removal fusion tag.
Present invention test material as used in the following examples is unless otherwise specified from routine biochemistry reagent shop It is commercially available.Quantitative test in following embodiment is respectively provided with four repetitions and tests, and results are averaged.
Experimental material source:
PET-28a carrier used in the present invention is Novagen Products, pcDNA3.1 is that Invitrogen company produces Product, pEGFP-C1 carrier are Clontech Products.People IL2 gene (NCBI registration code: NM_000586) ORF full-length cDNA Purchased from Sino Biological Inc..HEK293-F cell line is purchased from Thermo Fisher company.IL2 is relied on Mouse T cell CTLL-2 cell line be purchased from Shanghai Inst. of Life Science, CAS cell resource center.For The serum-free mammalian cell culture and Sinofection transfection reagent of HEK293-F cell culture stick up mind purchased from Beijing justice State Bioisystech Co., Ltd.BamHI, NcoI, NheI, XhoI restriction endonuclease are U.S. NEB Products.HS archaeal dna polymerase, T4DNA ligase are TAKARA Products.The small extraction reagent kit of plasmid, agarose Gel DNA QIAquick Gel Extraction Kit is purchased from TIANGEN Biotech (Beijing) Co., Ltd..Rabbit-anti people Fc (IgG1) antibody is purchased from Sigma- Aldrich, the anti-rabbit secondary antibody of near-infrared fluorescent label are purchased from LI-COR company, the strepto- parent of horseradish peroxidase-labeled It is purchased from green skies biotech company with element, ECL luminescent solution is purchased from Millipore company.BCA protein quantification kit is purchased from Thermo Fisher company.Streptavidin magnetic bead is purchased from Beaver Nanotechnology (Suzhou) Inc..The purchase of IL2 recombinant protein From eBioscience company and PeproTech company.CCK-8 cell Proliferation detection reagent is purchased from Japanese colleague's chemistry institute. Primer synthesis and gene synthesis technology service are completed by the prosperous Biotechnology Co., Ltd of Beijing AudioCodes.
1 bEK of embodimentLLoad the preparation of magnetic bead
1, the building of enterokinase prokaryotic expression carrier
(1) Avitag amino acid sequence is GLNDIFEAQKIEWHE；bEKLAmino acid sequence is retrieved from UniProt number According to library, accession number Q6B4R4.Splice after often carrying out reversely compiling to above-mentioned two sections of sequences with codon according to Escherichia coli, and NcoI restriction enzyme site, 3 ' end addition XhoI restriction enzyme sites is added at 5 ' ends of nucleic acid sequence, obtains Avitag and is merged with bEKL The gene order of expression is detailed in sequence as shown in SEQ ID NO.1.The gene order is limited by the prosperous biotechnology of Beijing AudioCodes Company's synthesis.
(2) DNA fragmentation obtained with restriction enzyme NcoI and XhoI double digestion pET-28a plasmid and step (1), point The DNA fragmentation of about 5.2Kb and 770bp are not recycled；
(3) DNA fragmentation that step (2) are recycled is attached under the action of T4DNA ligase, obtains recombinant plasmid pET-28a-Avi-bEKL；
(4) to recombinant plasmid pET-28a-Avi-bEKLIt is sequenced.Sequencing result shows that fusion has the intestines of Avitag Kinase-encoding gene has been successively inserted into pET-28a plasmid.Recombinant plasmid pET-28a-Avi-bEKLStructural schematic diagram referring to figure 2。
2, the bEKL of inducing expression biotin modification
(1) by recombinant plasmid pET-28a-Avi-bEKLIt is transformed into Bacillus coli expression host strain BL21 (DE3)；
(2) picking conversion positive bacteria is fallen in the LB culture solution of 5mL amicillin resistance, and 220rpm37 DEG C is shaken overnight Bacterium prepares seed liquor；
(3) it draws 2mL seed liquor to be transferred in the LB culture solution of 200mL amicillin resistance, 37 DEG C of 220rpm are shaken bacterium Reach 0.6~0.8 to OD600；
(4) D-Biotin, 220rpm of the IPTG and 0.05mmol/L of final concentration of 0.1mmol/L are added in culture bottle 37 DEG C are continued culture 4 hours；
(5) bacterium solution is centrifuged 10min with 6000 × g, collects thallus, records thallus weight.
3, inclusion body preparation and renaturation
(1) ratio that 10mL splits bacterium buffer (50mmol/L Tris-HCl, pH7.0) is added with 1g thallus, bacterium is resuspended Body；
(2) thallus suspension is set on ice, is crushed bacterium with ultrasound cracking instrument.Ultrasound cracking parameter are as follows: diameter 6mm vibration amplitude arm, 30% power, open 3 seconds/stop 3 seconds, ultrasonic pyrolysis time 20 minutes；
(3) cellular lysate liquid is centrifuged 10min with 13400 × g, collects inclusion body precipitating；
(4) with 10ml inclusion body cleaning solution I (50mmol/L Tris-HCl, 0.5mol/L NaCl, 20mmol/L EDTA, 2%TritonX-100, pH7.0) inclusion body is resuspended, 13400 × g is centrifuged 10min, collects inclusion body precipitating；
(5) it is resuspended and is wrapped with 10ml inclusion body cleaning solution II (50mmol/L Tris-HCl, 20mmol/L EDTA, pH7.0) Contain body, 13400 × g is centrifuged 10min, collects inclusion body precipitating, and record forgives body weight；
(6) with 1g inclusion body be added 20mL denaturing liquid I (7.5mol/L GuHCl, 50mmol/L Tris-HCl, 100mmol/L beta -mercaptoethanol, pH9.0) ratio be resuspended, dissolve inclusion body；
(7) with concentrated hydrochloric acid adjustment inclusion body denaturing liquid pH value to 4.0, and it is placed on citric acid solution (5mmol/L lemon Lemon acid, pH4.0) dialysed overnight；
(8) after dialysing, 13400 × g is centrifuged 10min, collects and albumen is precipitated, and records weight；
(9) with 1g be precipitated albumen be added 10mL denaturing liquid II (7.5mol/L GuHCl, 50mmol/L Tris-HCl, PH4.0 ratio) is resuspended, and room temperature acts on 6 hours, solution modeling albumen；
(10) (0.5mol/L is slowly added in renaturation solution for albuminous degeneration liquid is precipitated with 1:100 (V/V) ratio dropwise Arginine-HCl, 50mmol/L Tris-HCl, 20mmol/L CaCl2,5mmol/L cystine-HCl, 0.5mmol/L Cystine, pH8.3), 4 DEG C renaturation 24 hours；
(11) after renaturation solution being concentrated by ultrafiltration 20 times, dialysis to enterokinase storage buffer (50mmol/L Tris-HCl, 50mmol/L NaCl, pH7.5)；
(12) after dialysing, 13400 × g is centrifuged 10min removal and precipitating is precipitated, and supernatant is the intestines of biotin modification Kinases, using its protein concentration of BCA protein quantification kit measurement.
4, with the enterokinase of streptavidin magnetic bead load biotin modification
(1) 100 μ L streptavidin magnetic beads (Beaver Nanotechnology (Suzhou) Inc., article No. 22305-10) are drawn extremely In EP pipe, 1mL enterokinase storage buffer is added, magnetic bead is resuspended in sufficiently oscillation, Magnetic Isolation 5 minutes, inhales and abandons supernatant；Repetition is washed Wash magnetic bead three times；
(2) the enterokinase solution of 1mL biotin modification is added into magnetic bead, mixes well magnetic bead.Centrifuge tube is set into rotation Mixed instrument is incubated at room temperature 1 hour, the enterokinase of biotin modification is made to be carried on streptavidin magnetic bead；
(3) it after loading, Magnetic Isolation 5 minutes, inhales and abandons supernatant；With 1mL enterokinase storage buffer, sufficiently oscillation weight Outstanding magnetic bead.It Magnetic Isolation 5 minutes, inhales and abandons supernatant；Wash repeatedly magnetic bead three times；
(4) magnetic bead is resuspended with 100 μ L enterokinase storage buffers, completes bEKLLoad the preparation of magnetic bead.bEKLLoad magnetic bead Structural schematic diagram referring to Fig. 1.
5, SDS-PAGE electrophoresis coomassie brilliant blue staining and bEKLThe detection of biotin modification situation
(1) coomassie brilliant blue staining: being added 5 × reduced form sample-loading buffer, prepare electrophoresis Sample in test sample, carries out SDS-PAGE electrophoresis；After electrophoresis, gel is immersed in Coomassie brilliant blue dye liquor and is dyed 2 hours；Then, it is soaked with destainer Bubble, overnight, gel imager acquires experimental result for decoloration.
(2) bEK is detected with the following methodLBiotin modification situation: it after protein sample carries out SDS-PAGE electrophoresis, uses Wet robin, 100V constant pressure transferring film 1.5 hours；With 3% bovine serum albumin solution room temperature closing 30 minutes；It is diluted with 1:5000 The Streptavidin of horseradish peroxidase-labeled is incubated at room temperature 1 hour；After TBST buffer washes film 3 times, ECL luminescent solution is used Exposure image.
(3) to bEKLProtein sample carries out electrophoresis coomassie brilliant blue staining and biology in prokaryotic expression and magnetic bead loading process Element modification situation testing result is shown:
After a.IPTG induction, bEKLCan in Escherichia coli great expression, primarily form inclusion body be present in split bacterium after sink (scheme referring to A in Fig. 3) in the sample of shallow lake；
B. the bEK of generation is expressedLIt can be modified and (scheme referring to B in Fig. 3) by biotin molecule；
C. inclusion body protein has obtained the bEK for the biotin modification that purity is 85% or more after renaturationLSoluble protein, It can be used in magnetic bead load (referring to C is schemed in Fig. 3)；
D. protein sample before being loaded compared to magnetic bead, bEK in sample after loadLAlbumen substantially reduces, and shows bEKLAlbumen has become Function is loaded to Streptavidin MagneSphere (referring to C is schemed in Fig. 3, scheming D).
In Fig. 3, bEKLProkaryotic expression and magnetic bead load front and back bEKLProtein Detection.Scheme A, the inspection of coomassie brilliant blue staining method Survey bEKLProkaryotic expression situation；Scheme B, the Streptavidin of horseradish peroxidase-labeled detects bEKLProkaryotic expression and bEKLIt is raw Object element modifies situation；M in figure, Marker；1, full bacterium sample is not induced；2, full bacterium sample after induction；3, ultrasound splits supernatant after bacterium Sample；4, ultrasound splits upper deposit sample after bacterium.Scheme C, coomassie brilliant blue staining method detects magnetic bead load front and back bEKLAlbumen becomes Change situation；Scheme D, the Streptavidin detection magnetic bead load front and back bEK of horseradish peroxidase-labeledLAlbumen situation of change；Figure In, M, Marker；1, bEK before magnetic bead loadsLProtein sample；2, bEK after magnetic bead loadLProtein sample.
Embodiment 2 applies bEKLIt loads magnetic bead and cuts Fc-EGFP fusion protein
1, the building of recombinant plasmid pcDNA3.1-Fc-EGFP
(1) by the prosperous Biotechnology Co., Ltd's composite coding human IgG heavy chain secreting signal peptide-Fc (people of Beijing AudioCodes IgG1) the genetic fragment of albumen, overall length 729bp, particular sequence is as shown in SEQ ID NO.2.Contain at 5 ' ends of the genetic fragment XhoI restriction enzyme site is contained at NheI restriction enzyme site, 3 ' ends.
(2) EGFP gene segment of the coding containing enterokinase cleavage site is to use P1 using pEGFP-C1 plasmid as template With the primer pair (sequence is shown in Table 1) of P2 composition, InPCR amplification is carried out under the action of HS archaeal dna polymerase, The EGFP gene segment overall length 753bp containing enterokinase cleavage site, particular sequence such as SEQ ID NO.3 that electrophoresis recycling obtains It is shown.Contain XhoI and BamHI restriction enzyme site respectively in the 5 ' of the segment and 3 ' ends.
(3) with restriction enzyme NheI and BamHI double digestion pcDNA3.1 (-) plasmid, with restriction enzyme NheI The DNA fragmentation obtained with XhoI double digestion step (1) is obtained with restriction enzyme XhoI and BamHI double digestion step (2) The DNA fragmentation of about 5.4Kb, 720bp and 750bp is separately recovered in DNA fragmentation.
(4) DNA fragmentation that step (3) are recycled is attached under the action of T4DNA ligase, obtains recombinant plasmid pcDNA-Fc-EGFP。
(5) recombinant plasmid pcDNA-Fc-EGFP is sequenced.Sequencing result shows encoding human IgG heavy chain secretion signal Peptide-Fc (human IgG1)-enterokinase cleavage site-EGFP fusion protein genetic fragment is successively inserted into pcDNA3.1 (-) plasmid.Weight The structural schematic diagram of group plasmid pcDNA-Fc-EGFP is shown in Fig. 4.
1 primer sequence of table
Primer Primer sequence (5 ' to 3 ' direction)
P1 aaactcgaggacgacgacgacaagatggtgagcaagggcgaggagctg
P2 gcgggatccttacttgtacagctcgtccatgccg
P3 ggactcgaggacgacgacgacaaggcacctacttcaagttctacaaag
P4 gcgggatcctcaagtcagtgttgagatgatgc
2, the expression of Fc-EGFP fusion protein
(1) it is suspended with serum-free mammalian cell culture (SMM 293-TIS) and cultivates HEK293-F cell, cultivate item Part is 37 DEG C, CO2Concentration 8%, 120 revs/min of shaking speed, cell culture shaking flask specification is 125mL, dress liquid product 30mL；
(2) 1 × 10 is expanded to cell density6When/mL, transfection procedure is carried out；
(3) it prepares transfection cocktail: 15 μ g recombinant plasmid pcDNA-Fc-EGFP is drawn, with 1.5mL150mmol/L NaCl Solution mixes, and is stored at room temperature 5 minutes；75 μ L Sinofection transfection reagents are added into mixed liquor again, room temperature is quiet after mixing It sets 20 minutes；
(4) transfection cocktail that step (3) are prepared is added dropwise in Tissue Culture Flask, is mixed well；
(5) after continuing culture 7 days, 1000 revs/min of centrifugations, sedimentation cell, after culture supernatant is using 45 μm of filter filterings Carry out protein purification.
3, Fc-EGFP fusion protein is purified using proteinA affinity chromatography method
(1) take 0.5mL proteinA affinity chromatography filler, using 5mL equilibrating buffer (50mmol/L boric acid, 4.0mmol/L NaCl, pH 9.0) it pre-equilibrates；
(2) culture supernatant that 20mL contains Fc-EGFP fusion protein is drawn, 4.64g NaCl is added, until NaCl final concentration For 4mol/L；Solution acid alkalinity is measured, pH to 9.0 is adjusted；12000rpm is centrifuged 10 minutes, collects supernatant；
(3) supernatant solution that step (2) obtain is mixed with the proteinA affinity chromatography filler after step (1) balance； With 0.5mL/min flow velocity, collection flows through sample；Chromatographic stuffing is washed using 10mL equilibrating buffer；It is eluted using 2.5mL slow Solution (50mmol/L tertiary sodium phosphate, 50mmol/L sodium citrate, 4.0mmol/L NaCl, pH 3.0) elution Fc-EGFP is rushed to melt 0.3mL 1.5mol/L Tris-HCl buffer solution (pH8.8) is added immediately and reconciles acid for hop protein, the protein sample afforded Basicity is to neutrality；
(4) the Fc-EGFP fusion protein solutions overnight of preparation is dialysed to enterokinase storage buffer；
(5) concentration mensuration is carried out to Fc-EGFP fusion protein sample using BCA protein quantification kit, using retention point It is 0.5mg/mL that sample to protein concentration, which is concentrated by ultrafiltration, in son amount 10kDa Amicon Ultra-4 super filter tube (Millipore).
4、bEKLIt loads magnetic bead and cuts Fc-EGFP fusion protein
(1) 100 μ L Fc-EGFP fusion proteins are added in 1.5mL centrifuge tube, are obtained according to 2 extraction embodiment of table, 1 step 4 The bEK obtainedLLoad magnetic bead is mixed with Fc-EGFP fusion protein；
2 bEK of tableLIt loads magnetic bead and cuts Fc-EGFP fusion protein
EK magnetic bead (μ L) 0 1 2 5 10 15 20
Fc-EGFP(μL) 100 100 100 100 100 100 100
(2) centrifuge tube is placed in rotary mixer, low speed rotation, room temperature acts on 16 hours；
(3) after endonuclease reaction, Magnetic Isolation 5 minutes, by bEKLLoad magnetic bead is separated from digestion system；
(4) bEK that Magnetic Isolation recyclesLMagnetic bead is loaded, resuspension is vibrated sufficiently with 1mL enterokinase storage buffer； It Magnetic Isolation 5 minutes, inhales and abandons supernatant；After washing repeatedly three times, magnetic bead, 4 DEG C of preservations are resuspended with enterokinase storage buffer.
(5) sample carries out SDS-PAGE electrophoresis after digestion, detects for Western Blot；Western Blot detection makes It is diluted rabbit-anti people Fc (IgG1) antibody of 1:2500, (2) of remaining step with 1 step 5 of embodiment with primary antibody；Using Quantity One software carries out gray scale scanning to Western Blot result, analyzes Fc-EGFP fusion protein by bEKLLoad The efficiency of magnetic bead cutting；
(6) result is referring to Fig. 5, it can be seen that bEKLLoad magnetic bead can high efficiency cutting Fc-EGFP fusion protein, be added 1 The endonuclease reaction to 60% or more fusion protein can be completed in μ L magnetic bead；10μL bEKLLoading magnetic bead can be in 16 hour, will The Fc-EGFP fusion protein of 50 μ g is cut completely through.
5、bEKLLoad magnetic bead Reusability stability experiment
(1) bEK of 10 μ L embodiment, 1 step 4 acquisition is drawn respectivelyLIt loads magnetic bead and 100 μ L embodiment, 2 step 3 obtains Fc-EGFP fusion protein into 1.5mL centrifuge tube, be placed in rotary mixer, low speed rotation, room temperature acts on 16 hours；
(2) after endonuclease reaction, Magnetic Isolation 5 minutes, by bEKLLoad magnetic bead is separated from digestion system；
(3) sample after digestion is used to prepare protein electrophoresis sample；The bEK that Magnetic Isolation recyclesLMagnetic bead is loaded, with 1mL enterokinase storage buffer sufficiently vibrates resuspension；It Magnetic Isolation 5 minutes, inhales and abandons supernatant；Repeated washing is three times；
(4) step (1) to step (3) is repeated, the bEK obtained using recyclingLLoading magnetic bead, digestion Fc-EGFP is merged repeatedly Albumen 5 times.According to (5) method of step 4, Western Blot detection, gray scale scanning meter are carried out to supernatant samples after digestion It calculates Fc-EGFP fusion protein and cuts ratio, analyze bEKLLoad stability of magnetic bead during Reusability.
(5) Fig. 6 is the results show that the same a collection of magnetic bead of application carries out 5 endonuclease reactions to Fc-EGFP fusion protein repeatedly, Substrate protein can be cut completely through, show to combine between the enterokinase of biotin modification and streptavidin magnetic bead it is firm, bEKLLoad magnetic bead does not dissociate during Reusability, is able to maintain stable digestion vigor, has Reusability Ability.
Embodiment 3 applies bEKLMagnetic bead preparation is loaded without label IL2
1, the building of recombinant plasmid pcDNA3.1-Fc-IL2
(1) IL2 genetic fragment of the coding containing enterokinase cleavage site is using human IL-2's gene ORF full-length cDNA as mould Plate, the primer pair (sequence is shown in Table 1) formed using P3 and P4, InIt is carried out under the action of HS archaeal dna polymerase PCR amplification, the IL2 genetic fragment overall length about 435bp containing enterokinase cleavage site, sequence such as SEQ ID that electrophoresis recycling obtains Shown in NO.4.Contain XhoI and BamHI restriction enzyme site respectively in the 5 ' of the segment and 3 ' ends.
(2) pcDNA3.1-Fc-EGFP constructed with 2 step 1 of restriction enzyme XhoI and BamHI double digestion embodiment The DNA fragmentation that recombinant plasmid and step (1) obtain, is separately recovered the DNA fragmentation of about 6.1Kb and 430bp.
(3) DNA fragmentation that step (2) are recycled is attached under the action of T4DNA ligase, obtains recombinant plasmid pcDNA3.1-Fc-IL2。
(4) above-mentioned recombinant plasmid is sequenced.
Sequencing result shows that the genetic fragment of encoding human IL2 successfully replaces EGFP gene segment, pcDNA3.1-Fc-IL2 Plasmid construction success, structural schematic diagram are shown in Fig. 4.
2, the expression of Fc-IL2 fusion protein
Protein expression step is the same as 2 step 2 of embodiment.
3, Fc-IL2 fusion protein is purified using proteinA affinity chromatography method
Protein purification steps are the same as 2 step 3 of embodiment.
4、bEKLLoad magnetic bead cutting Fc-IL2 fusion protein and IL2 protein purification
(1) bEK of 100 μ L embodiment, 1 step 4 acquisition is drawn respectivelyLWhat load magnetic bead and 3 step 3 of 1mL embodiment obtained Fc-IL2 fusion protein is placed in rotary mixer, low speed rotation into 1.5mL centrifuge tube, and room temperature acts on 16 hours；
(2) after endonuclease reaction, Magnetic Isolation 5 minutes, by bEKLLoad magnetic bead is separated from digestion system；
(3) bEK that Magnetic Isolation recyclesLMagnetic bead is loaded, resuspension is vibrated sufficiently with 1mL enterokinase storage buffer； It Magnetic Isolation 5 minutes, inhales and abandons supernatant；After washing repeatedly three times, magnetic bead, 4 DEG C of preservations are resuspended with enterokinase storage buffer.
(4) sample volume after calculating digestion, is added NaCl powder, until the final concentration of 4mol/L of NaCl；
(5) above-mentioned sample is mixed with the proteinA affinity chromatography filler pre-equilibrated through equilibrating buffer；With 0.5mL/min flow velocity, collection flow through sample；Flowing through sample is the IL2 albumen for being free of fusion tag；
(6) will flow through sample overnight dialyse to D-PBS buffer (2.67mmol/L KCl, 1.47mmol/L KH2PO4, 137.93mmol/L NaCl, 8.06mmol/L Na2HPO4, pH7.4)；Using BCA protein quantification kit to IL2 albumen sample Product carry out concentration mensuration, and sample is concentrated by ultrafiltration using molecular cut off 3kDa Amicon Ultra-4 super filter tube (Millipore) It is 0.5mg/mL to protein concentration.
(7) SDS-PAGE is carried out to sample in Fc-IL2 expressing fusion protein, purifying, digestion and IL2 protein purification procedures Electrophoresis and coomassie brilliant blue staining, as a result as shown in Figure 7.One-step method affinity chromatography is carried out using ProteinA filler, it can be right Fc-IL2 fusion protein is effectively purified, and ratio of the Fc-IL2 fusion protein in elution samples is greater than 85%；Fusion protein With bEKLAfter load magnetic bead is incubated for altogether, Fc-IL2 fusion protein electrophoretic band almost disappears, and two and Fc segment and IL2 occurs The newborn band that molecular size range is consistent, prompting Fc-IL2 fusion protein, it is effectively cut；After digestion sample again with The mixing of ProteinA filler, the Fc segment that digestion generates in conjunction with chromatographic stuffing, can cut off the IL2 of Fc label no longer with ProteinA filler combines, and it is the IL2 albumen for being free of fusion tag that affinity chromatography, which flows through sample,；It flows through in sample without label IL2 ratio is 90% or more, and has no enterokinase electrophoretic band.The above results show bEKLLoading magnetic bead can not only be effective Cleavage of fusion proteins, and combination that can be stable between enterokinase and magnetic bead, will not fall off during endonuclease reaction, pass through Simple Magnetic Isolation can be by bEKLMagnetic bead removal is loaded, purifying process is simplified, reduces the loss of destination protein.
5, CTLL-2 cell proliferation experiment verifies IL2 protein active
(1) CTLL-2 cell line is purchased from Shanghai Inst. of Life Science, CAS cell resource center, to train completely Nutrient solution (RPMI-1640+10% fetal calf serum+2ng/mL recombined human IL2) secondary culture；
(2) three times with the CTLL-2 cell of serum-free RPMI-1640 washing logarithmic growth phase；According to 1 × 105/hole Density is seeded in 96 orifice plates, and 200 μ L IL2 defect culture solutions (RPMI-1640+10% fetal calf serum) are added in every hole；
(3) IL2 sample, eBioscience company or the production of PeproTech company prepared by step 4 are added into orifice plate IL2 product, until final concentration of 0.5ng/mL, not add IL2 as a control group, 4 multiple holes of every group of setting, 5%CO2 37 DEG C incubator is incubated overnight；
(4) 20 hole μ L/ of CCK-8 detection reagent, 5%CO is added237 DEG C of incubators are incubated for 4 hours, are detected using microplate reader Light absorption value, Detection wavelength 450nm.
(5) interpretation of result
The light absorption value mean value and variance of each group sample are calculated, mean value is bigger, and expression CTLL-2 cell Proliferation is faster.Using SPSS software compares between each group whether have significant difference with one-way analysis of variance method.As a result as shown in figure 8, according to this The IL2 that the IL2 sample and eBioscience company and PeproTech company that embodiment obtains are produced is not relative to being added IL2's Control group can remarkably promote the proliferation of CTLL-2 cell.In the identical situation of addition concentration, what the present embodiment obtained IL2 sample light absorption value and commercialization IL2 product at 450nm is quite even slightly higher, shows the IL2 tool obtained according to the present embodiment There is bioactivity similar with commercialization IL2.
4 protein electrophoresis result of combining step prompt, using bEK provided by the inventionLThe IL2 albumen of magnetic bead preparation is loaded, Fusion tag is not only successfully eliminated, and there is stronger biologic viability.
Nucleotides sequence list
<110>the Fourth Military Medical University of P.L.A
<120>a kind of bovine enterokinase light chain load magnetic bead and its preparation method and application
<160>4
<210> 1
<211> 773
<212> DNA
<213>artificial synthesized
<400> 1
1 ccatgggcag cagcggcctg aacgacatct tcgaggctca gaaaatcgaa tggcacgaaa
61 tcgtgggcgg cagcgacagc cgcgagggcg cctggccctg ggtggtggcc ctgtacttcg
121 acgaccagca ggtgtgcggc gccagcctgg tgagccgcga ctggctggtg agcgccgccc
181 actgcgtgta cggccgcaac atggagccca gcaagtggaa ggccgtgctg ggcctgcaca
241 tggccagcaa cctgaccagc ccccagatcg agacccgcct gatcgaccag atcgtgatca
301 accgccacta caacaagcgc cgcaagaaca acgacatcgc catgatgcac ctggagatga
361 aggtgaacta caccgactac atccagccca tctgcctgcc cgaggagaac caggtgttcc
421 cccccggccg catctgcagc atcgccggct ggggcgccct gatctaccag ggcagcaccg
481 ccgacgtgct gcaggaggcc gacgtgcccc tgctgagcaa cgagaagtgc cagcagcaga
541 tgcccgagta caacatcacc gagaacatgg tgtgcgccgg ctacgacgcc ggcggcgtgg
601 acagctgcca gggcgacagc ggcggccccc tgatgtgcca ggagaacaac cgctggctgc
661 tggccggcgt gaccagcttc ggctaccagt gcgccctgcc caaccgcccc ggcgtgtacg
721 cccgcgtgcc ccgcttcacc gagtggattc agagcttcct gcactgactc gag
<210> 2
<211>729
<212> DNA
<213>artificial synthesized
<400> 2
1 gctagcgcca ccatggagtt tgggctgagc tgggttttcc tcgttgctct tttaagaggt
61 gtccagtgtc cagcacctga actcctgggg ggaccgtcag tcttcctctt ccccccaaaa
121 cccaaggaca ccctcatgat ctcccggacc cctgaggtca catgcgtggt ggtggacgtg
181 agccacgaag accctgaggt caagttcaac tggtacgtgg acggcgtgga ggtgcataat
241 gccaagacaa agccgcggga ggagcagtac aacagcacgt accgtgtggt cagcgtcctc
301 accgtcctgc accaggactg gctgaatggc aaggagtaca agtgcaaggt ctccaacaaa
361 gccctcccag cccccatcga gaaaaccatc tccaaagcca aagggcagcc ccgagaacca
421 caggtgtaca ccctgccccc atcccgggag gagatgacca agaaccaggt cagcctgacc
481 tgcctggtca aaggcttcta tcccagcgac atcgccgtgg agtgggagag caatgggcag
541 ccggagaaca actacaagac cacgcctccc gtgctggact ccgacggctc cttcttcctc
601 tacagcaagc tcaccgtgga caagagcagg tggcagcagg ggaacgtctt ctcatgctcc
661 gtgatgcacg aggctctgca caaccactac acgcagaaga gcctctccct gtctccgggt
721 aaactcgag
<210>3
<211>753
<212> DNA
<213>artificial synthesized
<400>3
1 aaactcgagg acgacgacga caagatggtg agcaagggcg aggagctgtt caccggggtg
61 gtgcccatcc tggtcgagct ggacggcgac gtaaacggcc acaagttcag cgtgtccggc
121 gagggcgagg gcgatgccac ctacggcaag ctgaccctga agttcatctg caccaccggc
181 aagctgcccg tgccctggcc caccctcgtg accaccctga cctacggcgt gcagtgcttc
241 agccgctacc ccgaccacat gaagcagcac gacttcttca agtccgccat gcccgaaggc
301 tacgtccagg agcgcaccat cttcttcaag gacgacggca actacaagac ccgcgccgag
361 gtgaagttcg agggcgacac cctggtgaac cgcatcgagc tgaagggcat cgacttcaag
421 gaggacggca acatcctggg gcacaagctg gagtacaact acaacagcca caacgtctat
481 atcatggccg acaagcagaa gaacggcatc aaggtgaact tcaagatccg ccacaacatc
541 gaggacggca gcgtgcagct cgccgaccac taccagcaga acacccccat cggcgacggc
601 cccgtgctgc tgcccgacaa ccactacctg agcacccagt ccgccctgag caaagacccc
661 aacgagaagc gcgatcacat ggtcctgctg gagttcgtga ccgccgccgg gatcactctc
721 ggcatggacg agctgtacaa gtaaggatcc cgc
<210>4
<211>435
<212> DNA
<213>artificial synthesized
<400>4
1 ggactcgagg acgacgacga caaggcacct acttcaagtt ctacaaagaa aacacagcta
61 caactggagc atttactgct ggatttacag atgattttga atggaattaa taattacaag
121 aatcccaaac tcaccaggat gctcacattt aagttttaca tgcccaagaa ggccacagaa
181 ctgaaacatc ttcagtgtct agaagaagaa ctcaaacctc tggaggaagt gctaaattta
241 gctcaaagca aaaactttca cttaagaccc agggacttaa tcagcaatat caacgtaata
301 gttctggaac taaagggatc tgaaacaaca ttcatgtgtg aatatgctga tgagacagca
361 accattgtag aatttctgaa cagatggatt accttttgtc aaagcatcat ctcaacactg
421 acttgaggat cccgc

Claims (9)

1. a kind of preparation method of bovine enterokinase light chain load magnetic bead, which comprises the following steps:
1) gene chemical synthesis biotinylation enzyme identifies peptide fragment Avitag and bEKLThe nucleotide sequence of amalgamation and expression, using orientation gram The nucleotide sequence is inserted into pET-28a plasmid by grand method, and building obtains recombinant plasmid pET-28a-Avi-bEKL；Biotinylation Enzyme identifies peptide fragment Avitag and bEKLNcoI restriction enzyme site is contained at the nucleotide sequence overall length 867bp of amalgamation and expression, 5 ' ends, XhoI restriction enzyme site is contained at 3 ' ends, and sequence is as shown in SEQ ID NO.1；
2) by recombinant plasmid pET-28a-Avi-bEKLIt is transformed into Escherichia coli, the bEK of inducing expression biotin modificationLForgive Body protein, then ultrasound cracks broken bacterium, prepares inclusion body, using dilution refolding method, obtains the bEK of biotin modificationL；
3) by the bEK of biotin modificationLIt is incubated for streptavidin magnetic bead, using extremely strong between biotin and streptavidin BEK is prepared in affinityLLoad magnetic bead.
2. the preparation method of bovine enterokinase light chain load magnetic bead according to claim 1, which is characterized in that in step 2), With ultrasound cracking instrument be crushed bacterium, ultrasound cracking parameter are as follows: diameter 6mm vibration amplitude arm, 30% power, open 3 seconds/stop 3 seconds, ultrasound is split Solving the time is 20 minutes.
3. the preparation method of bovine enterokinase light chain load magnetic bead according to claim 1, which is characterized in that the strepto- Avidin magnetic bead is to be coupled at Magnetic Microspheres-Carrier surface by covalent bond by streptavidin to be prepared.
4. loading magnetic bead using bovine enterokinase light chain made from preparation method described in any one of claims 1 to 3.
5. bovine enterokinase light chain load magnetic bead as claimed in claim 4 is as enterokinase preparation in protein expression and purification technology Using.
6. application as claimed in claim 5, which is characterized in that the bovine enterokinase light chain load magnetic bead specific can be cut Substrate containing enterokinase cleavage site.
7. application as claimed in claim 6, the substrate containing enterokinase cleavage site is the weight containing nonessential peptide fragment Histone.
8. application as claimed in claim 6, which is characterized in that the recombinant protein is the Fc-EGFP containing Fc sequence label Fusion protein, the fusion protein are obtained by recombinant plasmid pcDNA3.1-Fc-EGFP transfection expression；Wherein:
The recombinant plasmid pcDNA3.1-Fc-EGFP is by encoding human IgG heavy chain secreting signal peptide-Fc (human IgG1) albumen Genetic fragment and the EGFP gene segment containing enterokinase cleavage site, pcDNA3.1 (-) is connected into using directional cloning method It is obtained in plasmid；
The genetic fragment of encoding human IgG heavy chain secreting signal peptide-Fc (human IgG1) albumen, overall length 729bp, NheI enzyme is contained at 5 ' ends XhoI restriction enzyme site is contained at enzyme site, 3 ' ends, and sequence is as shown in SEQ ID NO.2；
The EGFP gene segment containing enterokinase cleavage site, overall length 753bp are encoded, XhoI restriction enzyme site, 3 ' ends are contained in 5 ' ends Containing with BamHI restriction enzyme site, sequence is as shown in SEQ ID NO.3.
9. application as claimed in claim 6, which is characterized in that the recombinant protein is that the Fc-IL2 containing Fc sequence label melts Hop protein, the fusion protein are obtained by recombinant plasmid pcDNA3.1-Fc-IL2 transfection expression；Wherein:
The recombinant plasmid pcDNA3.1-Fc-IL2 is will to encode the IL2 genetic fragment containing enterokinase cleavage site, using fixed It is connected into pcDNA3.1-Fc-EGFP recombinant plasmid and obtains to cloning process；
The IL2 genetic fragment containing enterokinase cleavage site, overall length 435bp are encoded, 5 ' ends contain containing XhoI restriction enzyme site, 3 ' ends Have with BamHI restriction enzyme site, sequence is as shown in SEQ ID NO.4.
CN201710158025.8A 2017-03-16 2017-03-16 A kind of bovine enterokinase light chain load magnetic bead and its preparation method and application Active CN106978429B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710158025.8A CN106978429B (en) 2017-03-16 2017-03-16 A kind of bovine enterokinase light chain load magnetic bead and its preparation method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710158025.8A CN106978429B (en) 2017-03-16 2017-03-16 A kind of bovine enterokinase light chain load magnetic bead and its preparation method and application

Publications (2)

Publication Number Publication Date
CN106978429A CN106978429A (en) 2017-07-25
CN106978429B true CN106978429B (en) 2019-11-15

Family

ID=59338144

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710158025.8A Active CN106978429B (en) 2017-03-16 2017-03-16 A kind of bovine enterokinase light chain load magnetic bead and its preparation method and application

Country Status (1)

Country Link
CN (1) CN106978429B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113416716A (en) * 2021-05-28 2021-09-21 南方科技大学 Method and kit for separating and purifying recombinant TPH2 protein

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101717449A (en) * 2008-10-09 2010-06-02 重庆富进生物医药有限公司 Recombinant TRAIL-Fc fusion protein as well as preparation and application thereof
CN102010875A (en) * 2009-09-08 2011-04-13 广州复能基因有限公司 Method for preparing biotinylated protein
CN102994489A (en) * 2012-10-09 2013-03-27 山西农业大学 Biotin-avidin system immobilized glucoamylase and preparation method thereof
CN103444979A (en) * 2013-08-09 2013-12-18 南昌大学 Method for lowering albumen allergenicity by immobilized enzyme hydrolysis
CN103834630A (en) * 2014-01-17 2014-06-04 中国药科大学 Method for preparing recombinant bovine enterokinase catalytic subunit
CN104561063A (en) * 2015-01-27 2015-04-29 河北科技大学 cDNA fragment, high-efficiency expression recombinant plasmid and genetically engineered bacterium of bovine enterokinase and and expression method of genetically engineered bacterium
CN105400749A (en) * 2015-12-30 2016-03-16 北京中科紫鑫科技有限责任公司 Biotinylation inorganic pyrophosphatase expression method
CN105462939A (en) * 2015-12-30 2016-04-06 北京中科紫鑫科技有限责任公司 Expressing method for biotinylation luciferase
CN105950605A (en) * 2016-06-29 2016-09-21 潍坊医学院 Directional covalent immobilization method of biotin-protein ligases (BirA) on magnetic microsphere surface

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101717449A (en) * 2008-10-09 2010-06-02 重庆富进生物医药有限公司 Recombinant TRAIL-Fc fusion protein as well as preparation and application thereof
CN102010875A (en) * 2009-09-08 2011-04-13 广州复能基因有限公司 Method for preparing biotinylated protein
CN102994489A (en) * 2012-10-09 2013-03-27 山西农业大学 Biotin-avidin system immobilized glucoamylase and preparation method thereof
CN103444979A (en) * 2013-08-09 2013-12-18 南昌大学 Method for lowering albumen allergenicity by immobilized enzyme hydrolysis
CN103834630A (en) * 2014-01-17 2014-06-04 中国药科大学 Method for preparing recombinant bovine enterokinase catalytic subunit
CN104561063A (en) * 2015-01-27 2015-04-29 河北科技大学 cDNA fragment, high-efficiency expression recombinant plasmid and genetically engineered bacterium of bovine enterokinase and and expression method of genetically engineered bacterium
CN105400749A (en) * 2015-12-30 2016-03-16 北京中科紫鑫科技有限责任公司 Biotinylation inorganic pyrophosphatase expression method
CN105462939A (en) * 2015-12-30 2016-04-06 北京中科紫鑫科技有限责任公司 Expressing method for biotinylation luciferase
CN105950605A (en) * 2016-06-29 2016-09-21 潍坊医学院 Directional covalent immobilization method of biotin-protein ligases (BirA) on magnetic microsphere surface

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Functional Expression and Purification of Bovine Enterokinase Light Chain in Recombinant Escherichia coli;Lei Huang et al.;《Preparative Biochemistry and Biotechnology》;20070228;第37卷(第3期);第205-217页 *

Also Published As

Publication number Publication date
CN106978429A (en) 2017-07-25

Similar Documents

Publication Publication Date Title
AU2018394189B2 (en) IL-2 variant
JP6591511B2 (en) Split inteins, complexes and their use
CN103649317B (en) Therapeutic fusion proteins
JP6675417B2 (en) Chimeric antigen receptor
US20180320159A1 (en) Processable Single Chain Molecules and Polypeptides Made Using Same
DK2174946T3 (en) METHODS OF PREPARATION OF CHIMERIC synthesizing IMMUNGLOBULINPROTEINER
GB2568987A (en) Targeted protein degradation
WO2016174407A1 (en) Nucleic acid construct for expressing more than one chimeric antigen receptor
CN106399276A (en) Therapeutic nuclease compositions and methods
CN108465111A (en) immunoglobulin FC variant
CN110343711B (en) Chimeric antigen receptor and method of treating cancer
Ciglic et al. Origin of dimeric structure in the ribonuclease superfamily
CN106978429B (en) A kind of bovine enterokinase light chain load magnetic bead and its preparation method and application
JP4604184B2 (en) Novel sugar chain recognition protein and its gene
KR102450007B1 (en) Fusion protein platform using igm region
CN113840834A (en) MAGEA 1-specific T cell receptor and uses thereof
CN112823166A (en) Conditionally active chimeric antigen receptors for modified T cells
Sánchez et al. Fast folding of the two-domain semliki forest virus capsid protein explains co-translational proteolytic activity
Parrott et al. Role of conserved cysteines in the alphavirus E3 protein
CN113234165A (en) Engineered binding proteins for EpCAM and uses thereof
CN111087473B (en) SIRPa-Fc-IL21 fusion protein and application thereof
CN100515496C (en) Immunity regulator and its application
KR102636452B1 (en) Recombinant vector expressing proteins for COVID-19 vaccine in plants and Methods of preparing vaccine composition using the same
WO2014129876A1 (en) Method of isolating and purifying fusion protein comprising factor vii
CN1467222A (en) Human interleukin-17 receptor sampling molecule fusion protein and coding gene and expression cell line

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant