CN106967815A - The primer differentiated for animal fur and method of a kind of PCR-based technology - Google Patents
The primer differentiated for animal fur and method of a kind of PCR-based technology Download PDFInfo
- Publication number
- CN106967815A CN106967815A CN201710257630.0A CN201710257630A CN106967815A CN 106967815 A CN106967815 A CN 106967815A CN 201710257630 A CN201710257630 A CN 201710257630A CN 106967815 A CN106967815 A CN 106967815A
- Authority
- CN
- China
- Prior art keywords
- pcr
- animal fur
- dna
- ermine
- fur
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kind of animal fur discrimination method of PCR-based, belong to animal fur material discrimination field.Comprise the following steps：Enough DNA are extracted from the animal fur product of tanning, common ermine category is respectively adopted（Sable, pine marten, America ermine, Japanese ermine）, weasel category（Yellow weasel, polecat）Expanded with mink specific primer using round pcr, differentiate that detection limit is up to 20pg whether containing ermine category, weasel category or mink composition in animal fur.The present invention is with result is accurate, sensitivity is high, high specificity, the advantages of stablizing objective.The present invention can as fur material discrimination macroscopic observation method and microscope detection method confirmation method, provide objective results when producing query in transaction, or market surpervision provides technical support, has broad application prospects.
Description
Technical field
The present invention relates to material discrimination field, more particularly to a kind of PCR-based (polymerase chain reaction Polymerase
Chain Reaction, PCR) technology be used for animal fur differentiate primer and method.
Background technology
Animal fur is the leather with fleece stripped from animal, is typically used in fur form, mainly there is fur, fox
Skin, raccoon fur, beaver rabbit skin and raw weasel skin etc..Fur have the title of " king in fur coat ", and commodity value is high.China is global maximum hair
Skin animal-breeding country, hide yield accounts for more than half of the whole world.China's fur yield rapid development in recent years, according to China Leather
The Chinese ermine of leather association, fox, racoon dog take skin quantity statistics to report (2015)》Report show：Chinese mink takes skin quantity within 2015
44500000 or so, fox takes skin quantity 14,500,000 or so.Fur species is various, relatively conventional with mink, also stone marten, pine
The kinds such as ermine, fishing ermine, ermine of sweeping away snow, and sable is the most rare.Some businessmans lack high-grade fur knowledge using ordinary consumer,
The approximate titles or classification such as mountain ermine, gold ermine, Chinese mugwort fox ermine, blue or green root ermine are indicated on commodity, consumer is obscured.
At present, fur differentiates frequently with macroscopic observation method and microscope observation, there is no mark reliable, stably, repeatable
Quasi- discrimination method.The subjective factors such as cognition and experience due to observation by reviewer on animal fur are influenceed, some shapes
State is approached or the fur sample discriminating Jing Guo specially treated technique still suffers from difficult point.Particularly with the different lines fur coat of same kind
The discriminating of fur Down Fiber classification, although Application Optics microscope and by other instruments, remains difficult to difference.Therefore, such as where
Just, accurately and rapidly differentiate that fur species is always quality testing department and consumers in general's focus of attention.
DNA is the hereditary information of all species, with the development of molecular biology and bioinformatics means, using DNA as
The species on basis, which differentiate, to be quickly grown, and is realized that species differentiate in molecular biosciences level, is breached conventional method fine according to animal
Tie up the limitation that morphosis differentiates.But it is due to that animal fur is all handled by tanning, bleaching and dyeing, in Tanned skin
DNA content is few, and height is degraded, and containing substantial amounts of enzyme inhibitor, this method is directly applied into fur and differentiated, sufficient amount is extracted
DNA turn into PCR detect technological difficulties.
At present species based on DNA differentiate research be primarily upon finding different plant species specific gene carry out kind and with
Upper horizontal species differentiate.Current research can efficiently differentiate the species of difference very little.U.S. HamlymP.E. in 1992 etc.
Sheep specific PCR probe is devised first, can distinguish the DNA isolated from sheep's wool, cashmere, mohair yarn.Japan is spun
Knitting inspection association (JSIF) can the animal origin such as Qualitive test fox hair, fur, horse skin, pigskin and ox-hide using DNA analysis method
Or fur.Francesc et al. has successfully distinguished America ermine and European ermine and woods weasel using PCR-RFLP technologies.
The content of the invention
It is an object of the invention to provide a kind of PCR-based (polymerase chain reaction Polymerase Chain Reaction,
PCR) primer differentiated for animal fur and method of technology, to overcome the defect that prior art is present, meet association area
The need for.
To achieve these goals, the technical scheme is that：
The primer differentiated for animal fur of a kind of PCR-based technology, it is characterised in that including nucleotide sequence 1-6
At least one of.
Further, including nucleotide sequence 1-6, it is necessary to explanation, nucleotide sequence 1-2 belong to ermine category, nucleotides
Sequence 3-4 belongs to weasel category, and nucleotide sequence 5-6 belongs to mink.
A kind of PCR-based technology be used for animal fur reflect method for distinguishing, it is characterised in that including：
Step (1)：DNA in animal fur is extracted, and determines DNA mass；
Step (2)：Using the DNA of extraction as template, enter performing PCR using primer respectively and expand；
Step (3)：Pcr amplification product is through electrophoresis, according to the clip size judged result of the target of appearance.
Further, if necessary to further differentiate species, in addition to step (4)：Pcr amplification product is surveyed
Sequence, and sequences match analysis is carried out with the species specificity sequence in common data base, further distinguish source of species.
Specifically, the sequences match analysis refers to：The sequence information that sequencing is obtained, with the thing obtained in database
Plant sequence information to be compared, more than 95% sequence for being considered the species is reached with known array similarity.
Further, the method in the step (1) on being extracted to the DNA in animal fur is improvement CTAB
Method, is specifically included：CTAB lysates and Proteinase K are added, is placed in 50-60 DEG C of water-bath and cracks overnight；Add the chloromethane of phenol-three
Alkane-isoamyl alcohol, overturns and is centrifuged after mixing；Supernatant is taken, chloroform-isoamyl alcohol is added, centrifuged after mixing；Supernatant is shifted to another
In centrifuge tube, add isopropanol and mix, centrifuged at 2-8 DEG C, abandon supernatant, washed and centrifuged at precipitation, 2-8 DEG C with 70% ethanol, abandoned
Supernatant, dries at room temperature；Precipitation adds TE buffer solutions (Tris-HCl and EDTA)；According to Roche DNA extraction kit explanations
The DNA of extraction is crossed into post, the DNA of extraction preserves standby to 2-8 DEG C of environment.
Further, the step of being expanded in the step (2) on PCR be：PCR reaction systems include DNA profiling, PCR
Premixed liquid and primer；PCR reaction conditions are：90-95 DEG C of pre-degeneration 3-10min, 90-95 DEG C of denaturation 20-50s, 50-66 DEG C of annealing
20-50s, 70-75 DEG C of extension 20-50s, at least 30 circulations.
Further, in the step (3), pcr amplification product is through 2% agarose gel electrophoresis, 120V constant pressures, electrophoresis
30min。
The specific primer of animal fur composition discriminating is claimed in the present invention, and it is special that it contains ermine category, weasel category and mink
Property primer, its nucleotide sequence is as shown in table 1.
The kit or detection reagent of the primer is claimed in the present invention.
The present invention is claimed described composition and differentiated in animal fur and its application being made in clothes, accessories, described
Animal is ermine category (sable, pine marten, America ermine, Japanese ermine), weasel category (yellow weasel, polecat) and mink.
Application of the described primer in the identification of animal fur material is claimed in the present invention.
A kind of animal fur discrimination method of PCR-based is claimed in the present invention, using described primer, is moved with to be measured
The DNA of thing fur is template, is detected using PCR method, according to the purpose fragment size and sequencing result and sequence after electrophoresis
Row the matching analysis is judged.
Described animal fur DNA refers to：Sample is carried out what is obtained after CTAB extraction methods or kit extracting method
DNA, including chromosomal DNA and mitochondrial DNA.
Described PCR method refers to：Using PCR (PCR) in the presence of Taq archaeal dna polymerases, amplification
Specific DNA fragmentation.By agarose electrophoresis, the purpose fragment of amplification is separated, purpose fragment length is shown in Table 1.
Simultaneously sequences match analysis refers to for described sequencing：PCR fragment reactions are sequenced, complete sequence is obtained.Sequencing
Mitochondrial genomes sequence information in obtained sequence information and open database is compared, and is reached with the homology of certain species
To more than 95%, that is, assert the DNA in the source containing the species.
The present invention establishes the research and application to animal fur discrimination method using round pcr, can accurately, objectively
Testing result is provided, and this method has stability, repeatability.The present invention improves animal fur DNA extraction method, should
Method is simple, economical, efficient, it is adaptable to by the animal fur product of the procedure of processings such as tanning, dyeing and sample preparation.The present invention is set
Ermine category is counted and weasel belongs to universal primer, streamline operation, reduction experimental cost, raising detection efficiency.It is amplifiable that ermine belongs to primer
Go out sable, pine marten, America ermine, Japanese ermine mitochondria ND2 genes, weasel belong to primer it is amplifiable go out yellow weasel, polecat mitochondria ND4 bases
Cause, mink primer it is amplifiable go out mink COI genes；No cross reaction between each primer, specificity is good, and detection limit is
20pg.The foundation of the technical program is to identify that ermine category and weasel belong to the method for fur using round pcr, overcome macroscopic observation method,
The shortcoming of the artificial subjective judgement of microscope observation, the referee method that can differentiate as animal fur type.To standard market row
For promoting the smooth development of fur production and its trade both at home and abroad has practical significance, and wide application prospect.
Brief description of the drawings
Fig. 1 is that ermine belongs to primer amplification figure；
Fig. 2 is that ermine belongs to gene order comparison chart (sable)；
Fig. 3 is that ermine belongs to gene order comparison chart (ermine of sweeping away snow)；
Fig. 4 is that ermine category and weasel belong to gene magnification detection limit；
Fig. 5 is that weasel belongs to primer amplification figure；
Fig. 6 is that weasel belongs to gene order comparison chart (yellow weasel)；
Fig. 7 is that weasel belongs to gene order comparison chart (polecat)；
Fig. 8 is mink COI gene magnification figures；(wherein, 58-63 minks, 66,77 sables, 67,78 Ai Hu, 76,41,42 is yellow
Wolf, 75 blue or green root ermines, 79 sweep away snow ermine)
Fig. 9 is mink gene order comparison chart；
Figure 10 is mink gene magnification detection limit；
Figure 11-1 is fur garment mink specific gene amplification figure；
Figure 11-2 is that fur garment ermine belongs to specific gene amplification figure；
Figure 11-3 is that fur garment weasel belongs to specific gene amplification figure；(wherein, 58 mink, 77 sables, 67 Ai Hu, 42 is yellow
Wolf, 79 sweep away snow ermine, 81,82,90-96 be Clothing Sample numbering)
Figure 12 is that fur garment weasel belongs to gene order comparison chart.
Embodiment
The primer differentiated for animal fur of a kind of PCR-based technology, it is characterised in that including nucleotide sequence 1-6
At least one of, specifically：
Nucleotide sequence 1：ATCCATGCTCCTTATGCTAG；
Nucleotide sequence 2：GTATARGATAGATAAGGGGGCG；
Nucleotide sequence 3：CATCGTCTATATTGTTCTGTCTAGC；
Nucleotide sequence 4：TAGGGCAGTGATGATAATGTTTACT；
Nucleotide sequence 5：GGGGGCTTTGGAAACTGA；
Nucleotide sequence 6：GCTTCTTCCTTGAGTCTTA.
A kind of PCR-based technology be used for animal fur reflect method for distinguishing, including：
Step (1)：Representational position sample cutting is selected first, and the STb gene of animal fur sample is directly extracted,
And determine DNA mass；
Step (2)：Using animal fur DNA as template, belonged to respectively using ermine, weasel belongs to and the primer of mink enters performing PCR amplification；
Step (3)：Pcr amplification product is through agarose electrophoresis, according to whether the fragment for target sizes occur carrys out judged result；
Step (4)：If necessary to further differentiate species, it is necessary to which pcr amplification product is sequenced, and and common data
The species specificity sequences match analysis in storehouse, further discriminates between source of species.
The present invention extracts enough DNA using the CTAB methods of improvement from the animal fur product of tanning, then distinguishes
Belong to the specificity of (including common sable, pine marten, America ermine, Japanese ermine), weasel category (including yellow weasel, polecat) and mink using ermine
Whether primer, is expanded respectively using round pcr, differentiate afterwards in animal fur containing ermine category, weasel category or mink composition, inspection
Rising limit is 20pg.
In order to realize the testing goal of fast, economical, the present invention devises common ermine category, weasel category and the specificity of mink and drawn
Thing, each amplified production can be analyzed by the species specificity sequences match after sequencing with public database, further discriminate between thing
Plant source.
Described DNA is the STb gene in animal fur sample.
Embodiments of the invention are elaborated below, the present embodiment is carried out lower premised on technical solution of the present invention
Implement, give detailed embodiment and specific operating process.Protection scope of the present invention be related to inventive method, step or
The modifications or substitutions of condition, including but not limited to following embodiments.
Unless otherwise specified, chemical reagent used in embodiment is skill used in conventional commercial reagent, embodiment
The conventional meanses that art means are well known to those skilled in the art.
Key instrument equipment：PCR instrument (ABI, the U.S.), electrophoresis apparatus (Biorad, the U.S.), refrigeration grinding machine (SPEX
SamplePrep, the U.S.)；Ultramicrospectrophotometer (DeNovix companies, the U.S.), high speed tabletop centrifuge (Eppendorf
5417R, Germany), micropipettor (10 μ l, 100 μ l, 1000 μ l)；Main agents：CTAB lysates, chloroform：Isoamyl alcohol (24:
1), Tris saturated phenols, DNA extraction kit (Roche, Germany), PCR premixed liquids (Takara, China)
Specifically, methods described of the present invention, comprises the following steps：
Sample preparation：Each sample distinguishes clip 5x5cm sizes, as far as possible shreds sample, it is possible to use liquid nitrogen is crushed, and is obtained
More uniform sample to be tested.After being disposed, each sample weighs about 100mg in 2mL centrifuge tubes, is used as experiment sample.
Genome DNA extraction：Using modified CTAB method, 0.8mLCTAB lysates and 40 μ L Proteinase Ks are added, 56 DEG C of water are placed in
Cracked overnight in bath.Add isometric phenol-chloroform-isoamyl alcohol (25：24：1, v/v/v).After reverse mixing, 10
000g centrifuges 5min.Supernatant is taken, isometric chloroform-isoamyl alcohol (24 is added：1), 10000g centrifuges 5min, transfer after mixing
Supernatant adds 0.8 times of isopropanol and mixed into another centrifuge tube, and 10000g centrifugations 10min, abandons supernatant, use 70% ethanol at 4 DEG C
Once, 12000g centrifuges 10min to washing precipitation at 4 DEG C, abandons supernatant, dries at room temperature.Precipitation adds 200 0.1 × TE of μ L bufferings
Liquid (10mM Tris-HCl, 1mM EDTA；pH 8.0).Illustrate the DNA of extraction crossing post according to Roche DNA extraction kits,
It is standby that the DNA of extraction is diluted to 4 DEG C of 20ng/ μ L or so.
PCR is expanded：PCR reaction systems are 20 μ L, include DNA profiling 1~2 μ L (containing about 20ngDNA), the μ of PCR premixed liquids 10
L, each 0.4 μ L of upstream and downstream primer (10mmol/L), volume is supplied with ultra-pure water.PCR instrument reaction condition is：95 DEG C of pre-degenerations
5min, 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s (mink primer annealing temperature is 63 DEG C), 72 DEG C of extension 30s, 35 circulations.PCR
Product is through 2% agarose gel electrophoresis, 120V constant pressures, electrophoresis 30min.
Primer sequence is shown in Table 1：
The animal fur specific detection primer information table of table 1
Analysis of test results：It is 158bp that mink primer amplified fragments are observed after electrophoresis, and ermine belongs to primer amplified fragments and is
232bp, weasel belongs to primer amplified fragments for 251bp.Such as need further to obtain species information, PCR primer can be sequenced, and with after text
The species specificity sequences match listed is analyzed, and more than 95% sequence for being considered the species is reached with known array similarity
Row.
The ermine of embodiment 1 belongs to the specificity of primer
Sable, the hide 9 for ermine tanning of sweeping away snow of domestic large-scale mink sable plant and fur trade market are collected, with
And the common animal fur 15 for being easy to obscure, improved CTAB methods extract DNA, and PCR method amplifying marten primers, detection ermine belongs into
Point.Sample message refers to table 2.
Table 2. is used to detect that ermine belongs to specific sample message
As seen from Figure 1, positive, negative and blank control amplification is normal, and ermine belongs to sable in primer, ermine of sweeping away snow and amplifies target
Band, mink, blue or green root ermine, yellow wolf and Ai Hu etc. are feminine gender；Primer specificity is preferable.
Pcr amplification product is through sequence alignment, and sweep away snow ermine and pine marten (woods ermine) Martes martes mitochondria ND2 genes
Uniformity reaches 99%；Sable and sable (sable) Martes zibellina mitochondria ND2 gene identities reach 99%.
See Fig. 2, Fig. 3.
Ermine belongs to the detection limit detection of primer：Sable DNA (containing about 20ngDNA) is carried out 1:10 are diluted to 0.2pg step by step, enter
Row ermine belongs to composition detection.When sample is diluted into 20pg, target stripe can be amplified, detection ermine belongs to composition；When sample DNA is low
When 20pg, target stripe is not amplified, and ermine is not detected and belongs to composition, method detection is limited to 20pg.See Fig. 4.
The weasel of embodiment 2 belongs to the specificity of primer
Yellow wolf, the hide 18 of Ai Hu tannings of domestic large-scale fleece animal plant and fur trade market are collected, with
And the common animal fur 15 for being easy to obscure, improved CTAB methods extract DNA, and PCR methods amplification weasel belongs to primer, and detection weasel belongs into
Point.Sample message refers to table 3.
Table 3. is used to detect that weasel belongs to specific sample message
As seen from Figure 5, positive, negative and blank control amplification is normal, and weasel belongs to yellow wolf, Ai Hu in primer and amplifies target bar
Band, mink, blue or green root ermine, sable and ermine of sweeping away snow etc. are feminine gender；Primer specificity is preferable.
Pcr amplification product is through sequence alignment, yellow wolf and yellow weasel (yellow weasel) Mustela sibirica mitochondria ND4 bases
Because uniformity reaches 99%；Ai Hu and polecat Mustela eversmannii mitochondria ND4 gene identities reach 97%.
See Fig. 6, Fig. 7.
Weasel belongs to the detection limit detection of primer：Yellow wolf DNA (containing about 20ngDNA) is carried out 1:10 are diluted to 0.2pg step by step, enter
Row weasel belongs to composition detection.When sample is diluted into 20pg, target stripe can be amplified, detection weasel belongs to composition；When sample DNA is low
When 20pg, target stripe is not amplified, and weasel is not detected and belongs to composition, method detection is limited to 20pg.See Fig. 4.
The specificity of the mink primer of embodiment 3
Collect import, the hide 14 of hybridization mink tanning of domestic large-scale fleece animal plant and fur trade market
Bar, and the common animal fur 13 for being easy to obscure, improved CTAB methods extract DNA, PCR methods amplification mink primer, detection
Mink composition.Sample message refers to table 4.
Table 4. is used to detect the specific sample message of mink
As seen from Figure 8, positive, negative and blank control amplification is normal, and only mink amplifies target stripe in mink primer,
Yellow wolf, Ai Hu, sable and ermine of sweeping away snow etc. are feminine gender；Primer specificity is preferable.
Pcr amplification product reaches through sequence alignment, mink and mink Neovison vison mitochondrial COI gene uniformity
To 100%.See Fig. 9.
The detection limit detection of mink primer：Mink DNA (containing about 20ngDNA) is carried out 1:10 are diluted to 0.2pg step by step, enter
Water-filling ermine composition detection.When sample is diluted into 20pg, target stripe can be amplified, mink composition is detected；When sample DNA is low
When 20pg, target stripe is not amplified, mink composition is not detected, and method detection is limited to 20pg.See Figure 10.
The commercially available ready-made clothes animal component detection of embodiment 4
In Hebei great Ying furs market, Haining leather city and Taobao, Jingdone district etc., network shop buys fur garment 10 respectively
Part, by reviewer according to Shanghai City public organization standard《Leather and fur material discrimination universal method》, examined using conventional method
Animal fur is surveyed, judges whether the main material of clothes is consistent with labeled marker.Meanwhile, sampled from clothes, extract DNA, use
PCR method detection mink, ermine category and weasel belong to composition.Two methods are contrasted.Sample message is shown in Table 5.
The commercially available animal fur Clothing Sample table of table 5
Conventional method testing result:Using feel ocular estimate and microscope observation, fur garment material is differentiated, tied
Fruit is shown in Table 6.
The conventional detection method identification result of table 6
PCR methods differentiate fur garment composition result:Ready-made clothes is separately sampled at oxter, base, each 4cm2.Hide is cut into
Diameter 5mm or so fritter, using refrigeration grinding machine grind into powder, extracts DNA.Expand mink, ermine category and weasel respectively with PCR methods
Belong to gene.7 are the results are shown in Table, picture is shown in Figure 11-1 to 11-3.
The PCR methods of table 7 detect fur garment identification result
In 14 samples of 10 ready-made clothes, conventional method detection can determine 10 samples of material, and PCR method testing results are equal
It is consistent therewith.Completely the same only 5 of labeled marker content and material qualification result, wherein the label mark of only 1 ready-made clothes
Show completely the same with material qualification result.
The sample that conventional method detection can not be determined is 4 (accounting for 28.6%), is further divided by the detection of PCR methods
Analysis.Mink, the ermine designed and verified using us are belonged to, weasel Genus-specific primers, are expanded respectively, as a result two pieces spells ermine overcoat
In a detection mink composition and weasel belong to composition, one does not detect mink composition, detection weasel and belongs to composition；Also two pieces clothes are examined
Go out weasel and belong to composition, it is equal to compare homology through sequencing>98%.See Figure 12.
The specific embodiment of the present invention is described in detail above, but it is intended only as example, and the present invention is not limited
It is formed on particular embodiments described above.To those skilled in the art, it is any to the equivalent modifications that carry out of the present invention and
Substitute also all among scope of the invention.Therefore, the impartial conversion made without departing from the spirit and scope of the invention and
Modification, all should be contained within the scope of the invention.
Claims (8)
1. the primer differentiated for animal fur of a kind of PCR-based technology, it is characterised in that including in nucleotide sequence 1-6
At least one.
2. the primer differentiated for animal fur of PCR-based technology according to claim 1, it is characterised in that including
Nucleotide sequence 1-6, wherein, nucleotide sequence 1-2 belongs to ermine category, and nucleotide sequence 3-4 belongs to weasel category, nucleotide sequence 5-6
Belong to mink.
3. a kind of PCR-based technology be used for animal fur reflect method for distinguishing, it is characterised in that including：
Step（1）：DNA in animal fur is extracted, and determines DNA mass；
Step（2）：Using the DNA of extraction as template, enter performing PCR using primer respectively and expand；
Step（3）：Pcr amplification product is through electrophoresis, according to the clip size judged result of the target of appearance.
4. PCR-based technology according to claim 3 be used for animal fur reflect method for distinguishing, it is characterised in that also wrap
Include step（4）：Pcr amplification product is sequenced, and sequences match is carried out with the species specificity sequence in common data base
Analysis, further distinguishes source of species.
5. PCR-based technology according to claim 4 be used for animal fur reflect method for distinguishing, it is characterised in that it is described
Sequences match analysis refers to：The sequence information that sequencing is obtained, is compared with the species sequence information that is obtained in database,
Reached with known array similarity more than 95% the sequence for being considered the species.
6. PCR-based technology according to claim 3 be used for animal fur reflect method for distinguishing, it is characterised in that it is described
Step（1）In on the method extracted to the DNA in animal fur be modified CTAB method, specifically include：CTAB is added to split
Liquid and Proteinase K are solved, is placed in 50-60 DEG C of water-bath and cracks overnight；Add phenol-chloroform-isoamyl alcohol, overturn mix after from
The heart；Supernatant is taken, chloroform-isoamyl alcohol is added, centrifuged after mixing；Supernatant is shifted into another centrifuge tube, isopropanol is added and mixes
It is even, centrifuged at 2-8 DEG C, abandon supernatant, washed and centrifuged at precipitation, 2-8 DEG C with 70% ethanol, abandoned supernatant, dry at room temperature；Precipitation adds
Enter TE buffer solutions (Tris-HCl and EDTA)；Illustrate the DNA of extraction crossing post according to Roche DNA extraction kits, extraction
DNA preserves standby to 2-8 DEG C of environment.
7. PCR-based technology according to claim 3 be used for animal fur reflect method for distinguishing, it is characterised in that it is described
Step（2）In be the step of expanded on PCR：PCR reaction systems include DNA profiling, PCR premixed liquids and primer；PCR reacts
Condition is：90-95 DEG C of pre-degeneration 3-10min, 90-95 DEG C of denaturation 20-50s, 50-66 DEG C of anneal 20-50s, 70-75 DEG C
Extend 20-50s, at least 30 circulations.
8. PCR-based technology according to claim 3 be used for animal fur reflect method for distinguishing, it is characterised in that it is described
Step（3）In, pcr amplification product is through 2% agarose gel electrophoresis, 120V constant pressures, electrophoresis 30min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710257630.0A CN106967815A (en) | 2017-04-19 | 2017-04-19 | The primer differentiated for animal fur and method of a kind of PCR-based technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710257630.0A CN106967815A (en) | 2017-04-19 | 2017-04-19 | The primer differentiated for animal fur and method of a kind of PCR-based technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106967815A true CN106967815A (en) | 2017-07-21 |
Family
ID=59333888
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710257630.0A Pending CN106967815A (en) | 2017-04-19 | 2017-04-19 | The primer differentiated for animal fur and method of a kind of PCR-based technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106967815A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109900871A (en) * | 2019-03-20 | 2019-06-18 | 中山大学 | The DNA molecular discrimination method of leech medicinal material in a kind of cerebral ischemic preparation |
| CN110106253A (en) * | 2018-02-01 | 2019-08-09 | 东北林业大学 | A kind of identification method of the mink fur product true and false based on MGB probe |
| CN110117643A (en) * | 2018-02-07 | 2019-08-13 | 东北林业大学 | A kind of fluorescence PCR detecting method of the racoon dog fur products true and false |
| CN110117661A (en) * | 2018-02-07 | 2019-08-13 | 东北林业大学 | A kind of MGB Probe-detection methods that the sable fur products true and false identifies |
| CN114846327A (en) * | 2019-12-20 | 2022-08-02 | 日本电信电话株式会社 | Determination system, verification device, and determination method |
-
2017
- 2017-04-19 CN CN201710257630.0A patent/CN106967815A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110106253A (en) * | 2018-02-01 | 2019-08-09 | 东北林业大学 | A kind of identification method of the mink fur product true and false based on MGB probe |
| CN110117643A (en) * | 2018-02-07 | 2019-08-13 | 东北林业大学 | A kind of fluorescence PCR detecting method of the racoon dog fur products true and false |
| CN110117661A (en) * | 2018-02-07 | 2019-08-13 | 东北林业大学 | A kind of MGB Probe-detection methods that the sable fur products true and false identifies |
| CN109900871A (en) * | 2019-03-20 | 2019-06-18 | 中山大学 | The DNA molecular discrimination method of leech medicinal material in a kind of cerebral ischemic preparation |
| CN114846327A (en) * | 2019-12-20 | 2022-08-02 | 日本电信电话株式会社 | Determination system, verification device, and determination method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106967815A (en) | The primer differentiated for animal fur and method of a kind of PCR-based technology | |
| CN106755328A (en) | A kind of construction method of broad bean SSR finger-prints | |
| CN103409519B (en) | A kind of gene probe for differentiating sheep and goat derived component | |
| CN107604078B (en) | Molecular marker related to sheep wool fiber diameter character and specific primer pair and application thereof | |
| CN106434646B (en) | 4 pairs of EST-SSR primers and preparation method and its application in cherry platymiscium fingerprint map construction | |
| CN107746896B (en) | SNP (Single nucleotide polymorphism) marker related to peach fruit skin and villus character and application thereof | |
| CN104762370B (en) | The nucleotide sequence and method of Chinese Taxus kind and kind are distinguished in identification | |
| CN107841566A (en) | Composite amplification system, kit and the application of rapid mutation Y chromosome STR | |
| CN104673790B (en) | The molecular specificity labeled primers and authentication method of the long woods of oil tea breeding No. 18 | |
| CN103540678A (en) | Method for constructing sugarcane capillary electrophoresis DNA (deoxyribonucleic acid) fingerprint spectrum and authenticating sugarcane variety resource | |
| CN105821154A (en) | SSR primers and method for purity identification of luffa hybrid seeds | |
| CN108384879A (en) | A kind of SSR primers and method for watermelon hybrid object innovation | |
| CN110317898A (en) | A kind of method for identifying cucumber variety authenticity and its combination of dedicated SSR primer | |
| CN105296477B (en) | Mink in mink source Components identification and animal product, rabbit, dog ingredient multiple PCR detection kit | |
| Geng | Species-specific PCR for the identification of goat cashmere and sheep wool | |
| CN107354222A (en) | For identifying STR primers, PCR kit and the method for Eucalyptus clone | |
| CN107385052A (en) | For identifying STR primers and its application of Eucalyptus clone | |
| JP2004121229A (en) | Method for identifying mixing ratio of animal hair fiber in animal hair fiber product | |
| CN110468197A (en) | A kind of quick analysis detection kit of ALDH2 gene G1510A polymorphism and method | |
| JP6220332B2 (en) | Hop variety identification method | |
| CN115786575B (en) | SSR primer combination for identifying chestnut plant varieties such as chestnut and application thereof | |
| CN103789304B (en) | Based on IRAP mark and the application thereof of the exploitation of pears genome | |
| CN109777884A (en) | Sand melts goatweed 1Ssh chromosome specific molecular marker and its application | |
| CN103589783B (en) | SCAR (sequence characterized amplified region) primer and method for identifying felwort and adulterants thereof by using SCAR technology | |
| CN111411165B (en) | SNP (Single nucleotide polymorphism) site primer combination for identifying cucumber germplasm authenticity and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170721 |
|
| WD01 | Invention patent application deemed withdrawn after publication |