CN106929578A - The evaluation method of planktonic bacteria group in a kind of Taihu Lake water body - Google Patents
The evaluation method of planktonic bacteria group in a kind of Taihu Lake water body Download PDFInfo
- Publication number
- CN106929578A CN106929578A CN201710128594.8A CN201710128594A CN106929578A CN 106929578 A CN106929578 A CN 106929578A CN 201710128594 A CN201710128594 A CN 201710128594A CN 106929578 A CN106929578 A CN 106929578A
- Authority
- CN
- China
- Prior art keywords
- water body
- taihu lake
- pcr
- planktonic bacteria
- evaluation method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Abstract
The present invention provides a kind of evaluation method of planktonic bacteria group in Taihu Lake water body, including carrying out microbe genome DNA extraction to 11 water samples of sampled point of Taihu Lake basin, DNA to extracting is expanded by regular-PCR, 16S rDNA abundance in the method quantitative analysis sample such as real-time fluorescence quantitative PCR；Product after being expanded to 16S rRNA gene PCRs is purified, and purified product is sequenced using second generation high throughput sequencing technologies, and the planktonic bacteria population in being used for water body after Data Management Analysis parses sequencing result.The method discloses the structure of community and the interactive relationship between environment of blue-green alga bloom from gene angle, and prediction environmental change may cause the situation that structure of community changes；Employ second generation high-flux sequence Miseq platforms to be determined the biological community structure in Taihu Lake water body and bed mud, more systematically auxiliary parses the structure of community and corresponding abundance of microorganism in the water body of Taihu Lake.
Description
Technical field
The present invention relates to a kind of evaluation method of planktonic bacteria group in Taihu Lake water body, using biology techniques in groups to too
Planktonic bacteria group is evaluated in Lake Water Body, belongs to microbiological analysis technical field.
Background technology
Blue-green alga bloom outburst is one of important sign of lake eutrophication, and a series of environment and ecology can be triggered to ask
Topic.Blue-green alga bloom aggregation can cause the water surface to cover so that water plant is difficult to effective photosynthesis, causes water body part
Anoxic, causes the aquatile mortality such as fish, may trigger when serious " lake is general "；During other blue-green alga bloom decline,
A large amount of Microcystins, harmful to human and water ecosystem safety can be discharged；Blue-green alga bloom decline can also trigger stench, see
Human body and environment are had undesirable effect in sense and smell.Because lake more than China's nearly half has been in eutrophication shape
State, blue-green alga bloom occurs again and again, has caused the great attention of governments at all levels.
At present, for the mechanism of production of blue-green alga bloom, domestic and foreign scholars have carried out numerous studies, various theoretical and technologies
Means are able to fully apply.But subject to conditions, on going result focuses mostly in macroscopic arts, and institutional framework, life to blue-green algae
The research of the microscopic fields such as long form and the correlation of envirment factor is less.
The content of the invention
The technical problem to be solved in the present invention is：In order to more systematically parse group's knot of microorganism in the water body of Taihu Lake
Structure, the present invention provides a kind of evaluation method of planktonic bacteria group in Taihu Lake water body, using biology techniques in groups to TAIHU LAKE
Ti Zhong planktonic bacterias group is evaluated.
The technical solution adopted for the present invention to solve the technical problems is：Planktonic bacteria group comments in a kind of Taihu Lake water body
Valency method, comprises the following steps：
(1) Taihu Lake basin totally 11 water samples of sampled point are gathered；
(2) 11 water samples in step (1) were collected with 0.45 μm of cellulose mixture membrane filtration and respectively respectively
The microbiological specimens for leaching, untill treating that filter membrane is blocked completely；
(3) 11 microbiological specimens filtered out in step (2) are carried out with the extraction of DNA respectively；
(4) its concentration and pure is determined using ultramicron protein nucleic acids instrument to the DNA sample extracted in step (3)
Degree, and DNA sample is stored at -20 DEG C；
(5) the regular-PCR amplification of 16S rDNA, and real-time fluorescence quantitative PCR are carried out to the DNA sample in step (4)
Quantitative analysis；
(6) the PCR amplifications of 16S rRNA genes are carried out to the DNA sample in step (4), the amplified production to obtaining is carried out
Purifying, obtains PCR purified products；
(7) Miseq high-flux sequences are carried out to the PCR purified products in step (6), sequencing result carries out the noise reduction of data
After treatment, genealogical classification is carried out on processing platform, microbiologic population's parsing is carried out to planktonic bacteria in the water body of Taihu Lake.
Further, in such scheme, in step (5), primer sequence (5 ' -3 ') used is：
Forward primer CGAATATGGAATCCCTAGTAACT,
Reverse primer GCCCACTCAGTTCGATACGC.
Further, in such scheme, in step (5), the pcr amplification reaction system of 16S rDNA is 25 μ L, reaction
Program is：After 94 DEG C of predegeneration 5min, 95 DEG C of denaturation 15s react 30s at 58 DEG C of annealing temperature, 72 DEG C extend 30s, totally 35
Circulation, 7min is extended at last 72 DEG C.
Further, in such scheme, in step (5), real-time fluorescence quantitative PCR (qPCR) is being carried out to 16S rDNA
When, thermal denaturation 15min at 95 DEG C of predegeneration；Subsequently into 45 amplification stages of circulation, including 95 DEG C of denaturation 15s, annealing temperature
30s, 72 DEG C of extension 30s are reacted at 57.5 DEG C of degree；Solubility curve temperature is between 60 DEG C to 95 DEG C.
Further, in such scheme, before high-flux sequence is done, in step (6), 16S rRNA genes are carried out
When PCR is expanded, selected primer is for sequence (5 ' -3 ')：
Forward primer AGAGTTTGATYMTGGCTCAG,
Reverse primer TGCTGCCTCCCGTAGGAGT.
Further, in such scheme, in step (6), 16S rRNA gene PCRs amplification system is 50 μ L, PCR amplifications
Process is：After 98 DEG C of predegeneration 5min, 98 DEG C of denaturation 30s react 30s at 50 DEG C of annealing temperature, 72 DEG C extend 40s, totally 20
Circulation, 10min is extended at last 72 DEG C.
Further, in such scheme, in step (6), the Duplicate Samples mixing after PCR is expanded is used
E.Z.N.A.Cylcle-Pure kits (Omega Bio-tec Inc., USA) are purified.
Further, in such scheme, in step (6), PCR purified products are utilized the second generation high pass of Illumina
Amount microarray dataset Miseq carries out sequencing analysis.
Further, in such scheme, in step (7), sequencing result is dropped using Sickle and Mothur programs
Make an uproar after treatment, on the basis of the minimum sample of bar sequence, ordered from other samples using " Sub.sample " of Mothur softwares
In randomly select identical bar sequence, carry out be sequenced depth unification；Each sample identical sequencing depth under
Genealogical classification is carried out on Ribosomal Database Project Classifier processing platforms, the germy solution of institute is drawn
Analysis result.
The beneficial effects of the invention are as follows present invention utilizes biology techniques in groups, from gene angle announcement blue-green alga bloom
Structure of community and the interactive relationship between environment, prediction environmental change may cause the situation that structure of community changes.This
Invention employs the second generation high-flux sequence Miseq platforms of Illumina companies to the micropopulation in Taihu Lake water body and bed mud
The structure that falls is determined, the grand genome of Summary microbiologic population, can once to hundreds of thousands to millions of DNA points
Son carries out sequencing, with flux is high, accuracy rate high and many advantages, such as low cost, can more systematically aid in parsing too
The structure of community of microorganism and corresponding abundance in Lake Water Body.
The present invention carries out molecular biology research to Taihu Lake blue-green alga bloom, with following some significance：
1) contribute to talk clearly the formation mechenism of Taihu Lake blue-green algae.Molecular biology discloses the group of blue-green alga bloom from gene angle
Structure and the interactive relationship between environment, prediction environmental change may cause the situation that structure of community changes.
2) envirment factor of Restricting Blue-green Algae algal bloom is found out.Microorganisms in water population is studied, itself and area is found
Contact between the environment of domain, finds the method by controlling Limitation of environmental factors to reach and avoiding blue-green alga bloom from breaking out.
3) environmental monitoring technology means are expanded.The application of molecular biology is by the existing prison of extreme enrichment environmental monitoring department
Survey means, improve the technical capability of environmental monitoring department, for the technology establishes solid base in the in-depth application of environmental monitoring
Plinth.
Brief description of the drawings
The present invention is further described with reference to the accompanying drawings and examples.
Figure 1A and Figure 1B are TAIHU LAKE sampler body point schematic diagrames.
Fig. 2 is each sampled point water sample sample 16S rDNA abundance figures.
Fig. 3 is the horizontal predominant bacteria distribution map of each sampled point water sample door.
Fig. 4 is each sampled point water sample mycetozoan distribution map.
Fig. 5 is that each sampled point water sample belongs to horizontal predominant bacteria distribution map.
In Fig. 2-5, STG：Sha Tang ports；ZSHN：Zhu Shan Hunan；JS：Green pepper mountain；PTS：Platform mountain；XSX：Western Hills west；QD：Seven
All；XHX：All middle of a lake；YYS：Yu Yang mountains；XWL：In voe；LJK：Gate of a village Jiangkou；YPG：YAP port.
Specific embodiment
In conjunction with the accompanying drawings, the present invention is further explained in detail.
Embodiment 1
A kind of method that planktonic bacteria group is evaluated in Taihu Lake water body, comprises the following steps：
(1) collection Taihu Lake basin Hekou District (gate of a village Jiangkou, Sha Tang ports, in voe, YAP port)；Middle of a lake area (Western Hills west, platform
Mountain, green pepper mountain, Zhu Shan Hunan) and pasture and water area (seven all, all middle of a lake, Yu Yang mountains) totally 11 water samples of sampled point；YSI is utilized during sampling
Water Test Kits is determined to the basic water quality index such as water temperature, pH, turbidity, chlorophyll a, algae density and dissolved oxygen.Sewage
Water sample is acquired using polytetrafluoroethylplastic plastic bottle；In transportation, all of sample is both placed in being preserved in refrigerating box；
(2) pretreatment of sample：
Pre-processed immediately after laboratory is sent to after sample collection.11 water samples of collection are respectively with 0.45 μm of mixing
Cellulose filter membrane is filtered and collects the microbiological specimens for filtering out respectively, treats that filter membrane is blocked completely, the water sample body after record filtering
Product；The sludge solids obtained after filter membrane and centrifugation after filtering are immersed in 50% ethanol, and are stored under the conditions of -20 DEG C；
(3) DNA of sample is extracted：
DNA is extracted using FastDNA Spin Kit for Soil kits in this experiment, its key step is as follows：
A) for sewage sample, filter membrane is thawed and shredded (Lysing Matrix in addition cracking tube E pipes at room temperature
E tube), for mud sample, mud sample is put into cracking tube E pipes after weighing about 0.5g centrifugations；
B) to adding 978 μ L sodium phosphate buffers (Sodium Phosphate Buffer), and 122 μ L MT in above-mentioned pipe
Buffer；
C) E pipes are placed in FastPrep sample homogenizers and vibrate 40s by 6.0m/s of speed.Then E pipes are placed on
10min is centrifuged with 14000 × g in centrifuge, g is acceleration of gravity；
D) after being centrifuged, supernatant is transferred in new 2mL centrifuge tubes, adds 250 μ L protein precipitation solutions (protein
Precipitation solution), hand 10 centrifuge tube mixed solutions；
E) centrifuge tube is put into centrifuge and 5min is centrifuged with 14000 × g, supernatant is transferred to 15mL centrifuge tubes, and add
Enter 1mL DNA binding solns (Binding Matrix), promote DNA to be combined with silica gel.Centrifuge tube is turned upside down 2min, then
Centrifuge tube is placed and stands 3min on the top of the shelf；
F) supernatant of 500 μ L of careful removal, suspend remaining mixed liquor again；The mixed liquor of about 600 μ L is shifted to containing
SPINTMIn the pipe of Filter, 1min is centrifuged with 14000 × g；Then by SPINTMLiquid in Filter pipes is outwelled；Repeat
Until residual mixed liquor, all transfer has been centrifuged said process；
G) 500 μ L SEWS-M (dissolving and cleaning DNA) to the SPIN of step f) are addedTMIn Filter pipes, liquid-transfering gun is used
Piping and druming is centrifuged 1min after sediment is suspended again with 14000 × g；By SPINTMLiquid in Filter pipes is outwelled, then with
14000 × g is centrifuged 2min, the SEWS-M in removal matrix；
H) by SPINTMFilter is put into new Catch Tube, and 80 μ L DES are added after air-drying 5min at room temperature
(DNase/Pyrogen Free Water), is gently agitated for liquid-transfering gun pipette tips on filter membrane, makes sediment on filter membrane again
1min is centrifuged with 14000 × g after suspension, the solution collected in centrifuge tube is the DNA for extracting and purifying completion；
(4) after determining the DNA concentration that extracts and purity using ultramicron protein nucleic acids instrument, by DNA sample in-
Preserved in 20 DEG C；
(5) 16S rDNA regular-PCRs and product are identified：
PCR is polymerase chain reaction (Polymerase Chain reaction), and the PCR reaction system solution for using is
25 μ L, including：2.5 μ L 10 × PCR buffer solutions, 2 μ L MgCl2, 2 μ L dNTP intermixtures, upper and lower each 0.2 μ L of primer (20 μM),
0.125 μ L Ex Taq archaeal dna polymerases, 2 μ L DNA profilings (DNA of extraction is diluted to about 20ng/ μ L) and ddH2O makes system extremely
25μL。
Expanded using PCR amplification instrument, response procedures are：After 94 DEG C of predegeneration 5min, 95 DEG C of denaturation 15s, annealing temperature
30s, 72 DEG C of extension 30s are reacted at 58 DEG C of degree, totally 35 circulations, 7min is extended at last 72 DEG C；To the regular-PCR of 16S rDNA
And the real-time fluorescence quantitative PCR primer sequence (5 ' -3 ') that uses of analysis is as follows：Forward primer
CGAATATGGAATCCCTAGTAACT, reverse primer GCCCACTCAGTTCGATACGC, expanding fragment length is 140bp；
Pcr amplification product carries out electrophoretic determination using 1% agarose gel electrophoresis；
(6) real-time fluorescence quantitative PCR (qPCR)：
QPCR reaction carried out in 96 orifice plates, reaction system be 25 μ L, including 12.5 μ L 2 × PowerGreen
PCR Master Mix, forward and reverse each 0.2 μ L of primer (20 μM), 2 μ L DNA profilings (20ng/ μ L) and 10.1 μ L's is aseptic
Water；Experiment is carried out on the type quantitative PCR apparatus of Applied Biosystems 7500；Thermal Cycling is：Heat at 95 DEG C of predegeneration
Denaturation 15min；Subsequently into 45 amplification stages of circulation, including 95 DEG C of denaturation 15s, 30s is reacted at 57.5 DEG C of annealing temperature,
72 DEG C of extension 30s；Reaction may proceed to do corresponding solubility curve to check course of reaction with the presence or absence of non-specificity after terminating
Amplification, solubility curve temperature is between 60 DEG C to 95 DEG C；Each sample does 3 Duplicate Samples, and negative control replaces DNA with sterilized water
Template；
Do standard curve using the plasmid containing target gene 16S rDNA, acquisition do standard curve plasmid need into
Row cloning experimentation, comprises the following steps that：
A) specific amplification is carried out to 16S rDNA, amplified production uses Axyprep PCR Cleanup Kit (Axygen
Scientific, USA) kits；
B) then with19-T Vector (TaKaRa, Japan) are cloned for carrier, are transformed into E.coil impressions
State cell DH5a, competent cell DH5a is applied on the LB solid mediums containing ammonia benzyl, penicillin, X-gal and IPTG and is trained
Support 12h；
C) screened by blue hickie and choose white restructuring bacterial plaque, the length of Insert Fragment in carrier is identified using PCR methods, chosen
Select positive clone molecule LB liquid medium Amplification Cultures 12h；
D) thalline of incubated overnight using MiniBest Plasmid Purification Kit Ver.3.0 (TaKaRa,
Japan plasmid) is extracted.The plasmid that extraction is obtained adjusts protein analyzer and detects its concentration and purity using ultramicron, as
The standard sample of qPCR；
The plasmid that will be obtained carries out qPCR experiments with 10 times of gradient dilution, 5 concentration gradients of dilution as standard curve；
The amplification efficiency of this experiment between 90%-100%, calibration curve coefficient correlation R2More than 0.99；
(7) 16S rRNA genes high-flux sequence：
A) the PCR amplifications of 16S rRNA genes：
The DNA sample of extraction is diluted to 20ng/ μ L and enters performing PCR amplification, each sample does four groups of Duplicate Samples；16S rRNA
Gene high-flux sequence enters performing PCR amplification from the primer of V1V2 conserved regions, and primer sequence (5 ' -3 ') is as follows：Forward primer
AGAGTTTGATYMTGGCTCAG, reverse primer TGCTGCCTCCCGTAGGAGT.PCR amplification system is 50 μ L, comprising Ex Taq
0.25 μ L, 10 × Ex Taq Buffer of DNA 5 μ L, 25mM MgCl244 μ L of μ L, dNTP, forward primer and reverse primer each 1
μ L, the μ L of DNA profiling 2, the μ L of ultra-pure water 32.75.PCR amplification procedures are：After 98 DEG C of predegeneration 5min, 98 DEG C of denaturation 30s, annealing temperature
30s, 72 DEG C of extension 40s are reacted at 50 DEG C of degree, totally 20 circulations, 10min is extended at last 72 DEG C；Pcr amplification product is with 1%
Agarose electrophoresis is detected；
B) amplified production purifying：
Four Duplicate Samples mixing after PCR is expanded, with E.Z.N.A.TM Cylcle-Pure kits (Omega Bio-
Tec Inc., USA) purified；
C) high-flux sequence and analysis：
PCR purified products carry out second generation high-flux sequence and analysis using the Miseq platforms of Illumina (USA)；
D) data processing and analysis：
After sequencing result carries out noise reduction process using Sickle and Mothur programs, in order to fair in same sequencing depth
Ground compares all samples, on the basis of the minimum sample of bar sequence, uses Mothur softwares (1.32.1 editions)
Identical bar sequence is randomly selected in " Sub.sample " order from other samples, be sequenced the unification of depth；Each sample
It is enterprising in Ribosomal Database Project Classifier (2.6 editions) processing platform under identical sequencing depth
Row genealogical classification；
E) data after processing use (3.1.0 editions) drafting thermal map of R LISP program LISPs using (9.0 editions) drawing of Origin.
Experimental result understands through analysis：
In 11 sampled points, the concentration range of 16S rDNA is 10 in water body6~108Copies/mL, in illustrating water body
Plankton amount is (Fig. 1) higher.Between each sampled point, except all middle of a lake and 2, Yu Yang mountains concentration are slightly lower, respectively 4.44 ×
106Copies/mL and 1.63 × 107Outside copies/mL, than more consistent, abundance is about remaining each sampled point concentration
108copies/mL。
The sewage sample for choosing 11 sampled points carries out Miseq high-flux sequences.Predominant bacteria point of the water sample in door level
Cloth is as shown in Figure 3.As seen from the figure, relative abundance highest bacterium is mycetozoan (Proteobacteria) in water sample, is accounted for total
The 29.66%~71.80% of bacterium, average abundance accounts for 36.63%, and highest abundance is the water sample at Sha Tang ports, Proteobacteria accounting
Up to 70.80%.Secondly relative abundance bacterium higher is actinomyces (Actinobacteria), and average relative abundance is in water sample
20.99%.Secondly it is bacteroid (Bacteroidetes), average relative abundance is 12.77% in water sample.It is worth noting that,
Cyanobacteria (Cyanobacteria) accounting is higher in sewage sample, and average relative abundance accounts for 9.01%.In addition, acidfast bacilli
(Acidobacteria), heavy wall bacterium (Firmicutes) also has compared with high abundance, and average accounting is respectively 3.92% and 2.82%.
The average relative abundance of the nitrification spirillum (Nitrospira) related to nitrification is 1.16%.
Further relative abundance highest Proteobacteria is classified, the composition of each deformation Gammaproteobacteria is obtained, figure is as a result seen
4.As seen from the figure, water sample respectively deforms the average relative abundance of Gammaproteobacteria and is followed successively by from high to low：β-mycetozoan
(Betaproteobacteria, 14.57%), γ-mycetozoan (Gammaproteobacteria, 5.59%), δ-mycetozoan
(Deltaproteobacteria, 5.44%), α-mycetozoan (Alphaproteobacteria, 5.32%) and ε-mycetozoan
(Epsilonproteobacteria, 0.04%).
From the point of view of subordinate level, the predominant bacteria of (Fig. 5) is mainly in water sample：GpXI (is wherein accounted in voe in water sample XWL-W
Contain 13.19% than highest, 1%) accounting is approximately more than in remaining water sample, GpIIa (content about 9.26% in all middle of a lake water sample XHX-W,
5%) content is all higher than in other platform mountain PTS-W, the western XSX-W of Western Hills, seven all QD-W, and Streptococcus (is more than 1%).
Test result indicate that, the plankton group of Taihu Lake water body can be goed deep into using biology techniques in groups
Systematically parse, the structure of community and the interactive relationship between environment of blue-green alga bloom are disclosed from gene angle, prediction environment becomes
Change may cause the situation that structure of community changes, for the envirment factor for finding out Restricting Blue-green Algae algal bloom provide science according to
According to.
Claims (9)
1. in a kind of Taihu Lake water body planktonic bacteria group evaluation method, it is characterised in that comprise the following steps：
(1) Taihu Lake basin totally 11 water samples of sampled point are gathered；
(2) 11 water samples in step (1) are collected with 0.45 μm of cellulose mixture membrane filtration and respectively and is filtered out respectively
Microbiological specimens, untill treating that filter membrane is blocked completely；
(3) 11 microbiological specimens filtered out in step (2) are carried out with the extraction of DNA respectively；
(4) its concentration and purity are determined using ultramicron protein nucleic acids instrument to the DNA sample extracted in step (3), and
DNA sample is stored at -20 DEG C；
(5) the regular-PCR amplification of 16S rDNA is carried out to the DNA sample in step (4), and real-time fluorescence quantitative PCR is quantified
Analysis；
(6) the PCR amplifications of 16S rRNA genes are carried out to the DNA sample in step (4), the amplified production to obtaining carries out pure
Change, obtain PCR purified products；
(7) Miseq high-flux sequences are carried out to the PCR purified products in step (6), sequencing result carries out the noise reduction process of data
Afterwards, genealogical classification is carried out on processing platform, microbiologic population's parsing is carried out to planktonic bacteria in the water body of Taihu Lake.
2. in Taihu Lake water body as claimed in claim 1 planktonic bacteria group evaluation method, it is characterised in that：In step (5)
In, primer sequence (5 ' -3 ') used is：
Forward primer CGAATATGGAATCCCTAGTAACT,
Reverse primer GCCCACTCAGTTCGATACGC.
3. in Taihu Lake water body as claimed in claim 2 planktonic bacteria group evaluation method, it is characterised in that：In step (5),
The pcr amplification reaction system of 16S rDNA is 25 μ L, and response procedures are：After 94 DEG C of predegeneration 5min, 95 DEG C of denaturation 15s, annealing
30s, 72 DEG C of extension 30s are reacted at 58 DEG C of temperature, totally 35 circulations, 7min is extended at last 72 DEG C.
4. in Taihu Lake water body as claimed in claim 3 planktonic bacteria group evaluation method, it is characterised in that：In step (5),
When real-time fluorescence quantitative PCR (qPCR) is carried out to 16S rDNA, thermal denaturation 15min at 95 DEG C of predegeneration；Subsequently into 45
The amplification stage of circulation, including 95 DEG C of denaturation 15s, 30s, 72 DEG C of extension 30s are reacted at 57.5 DEG C of annealing temperature；Solubility curve temperature
Spend between 60 DEG C to 95 DEG C.
5. in Taihu Lake water body as claimed in claim 1 planktonic bacteria group evaluation method, it is characterised in that：Doing high flux
Before sequencing, in step (6), when entering performing PCR amplification to 16S rRNA genes, it is preferable that described primer is sequence (5 ' -3 ')
For：
Forward primer AGAGTTTGATYMTGGCTCAG,
Reverse primer TGCTGCCTCCCGTAGGAGT.
6. in Taihu Lake water body as claimed in claim 5 planktonic bacteria group evaluation method, it is characterised in that：In step (6),
16S rRNA gene PCRs amplification system is for 50 μ L, PCR amplification procedures：After 98 DEG C of predegeneration 5min, 98 DEG C of denaturation 30s, annealing
30s, 72 DEG C of extension 40s are reacted under temperature 50 C, totally 20 circulations, 10min is extended at last 72 DEG C.
7. in Taihu Lake water body as claimed in claim 2 planktonic bacteria group evaluation method, it is characterised in that：In step (6),
Duplicate Samples mixing after PCR is expanded, is entered with E.Z.N.A.Cylcle-Pure kits (Omega Bio-tec Inc., USA)
Row purifying.
8. in Taihu Lake water body as claimed in claim 7 planktonic bacteria group evaluation method, it is characterised in that：In step (6),
PCR purified products are carried out into sequencing analysis using the second generation high-flux sequence platform Miseq of Illumina.
9. in Taihu Lake water body as claimed in claim 8 planktonic bacteria group evaluation method, it is characterised in that：In step (7),
After sequencing result carries out noise reduction process using Sickle and Mothur programs, on the basis of the minimum sample of bar sequence, use
Identical bar sequence is randomly selected in " Sub.sample " order of Mothur softwares from other samples, be sequenced the system of depth
One；Each sample is under identical sequencing depth in Ribosomal Database Project Classifier processing platforms
On carry out genealogical classification, draw the germy analysis result of institute.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710128594.8A CN106929578A (en) | 2017-03-06 | 2017-03-06 | The evaluation method of planktonic bacteria group in a kind of Taihu Lake water body |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710128594.8A CN106929578A (en) | 2017-03-06 | 2017-03-06 | The evaluation method of planktonic bacteria group in a kind of Taihu Lake water body |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106929578A true CN106929578A (en) | 2017-07-07 |
Family
ID=59423339
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710128594.8A Pending CN106929578A (en) | 2017-03-06 | 2017-03-06 | The evaluation method of planktonic bacteria group in a kind of Taihu Lake water body |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106929578A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107418951A (en) * | 2017-08-11 | 2017-12-01 | 浙江省林业科学研究院 | A kind of low stain and high sensitive inexpensive general strain method for identifying molecules |
| CN108841942A (en) * | 2018-06-04 | 2018-11-20 | 常州市环境监测中心 | A kind of PM2.5 bacterial community composition source is quickly analyzed and methods of risk assessment |
| CN109238775A (en) * | 2018-09-08 | 2019-01-18 | 常州市环境监测中心 | A kind of passive sampling apparatus in situ and application based on the monitoring of physical and chemical and biological coupling |
| CN112159856A (en) * | 2020-11-04 | 2021-01-01 | 江苏宏众百德生物科技有限公司 | Method for realizing absolute quantification of blue-green algae on generic level based on second-generation sequencing technology |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104715165A (en) * | 2014-12-19 | 2015-06-17 | 中国石油天然气集团公司 | Petroleum pollution marine ecological environment evaluation method based on metagenome technology |
| CN104899475A (en) * | 2015-05-21 | 2015-09-09 | 上海大学 | Method for evaluating water quality by using microbial diversity indicators in water sediments |
| CN104946740A (en) * | 2015-05-07 | 2015-09-30 | 辽宁省海洋水产科学研究院 | Detection method for biological community structures of ocean brown tide |
| CN105868545A (en) * | 2016-03-28 | 2016-08-17 | 中国科学院城市环境研究所 | Underground water ecological system health assessment method |
-
2017
- 2017-03-06 CN CN201710128594.8A patent/CN106929578A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104715165A (en) * | 2014-12-19 | 2015-06-17 | 中国石油天然气集团公司 | Petroleum pollution marine ecological environment evaluation method based on metagenome technology |
| CN104946740A (en) * | 2015-05-07 | 2015-09-30 | 辽宁省海洋水产科学研究院 | Detection method for biological community structures of ocean brown tide |
| CN104899475A (en) * | 2015-05-21 | 2015-09-09 | 上海大学 | Method for evaluating water quality by using microbial diversity indicators in water sediments |
| CN105868545A (en) * | 2016-03-28 | 2016-08-17 | 中国科学院城市环境研究所 | Underground water ecological system health assessment method |
Non-Patent Citations (1)
| Title |
|---|
| ZHOU FAN等: "Submerged macrophytes shape the abundance and diversity of bacterial denitrifiers in bacterioplankton and epiphyton in the Shallow Fresh Lake Taihu, China", 《ENVIRON SCI POLLUT RES》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107418951A (en) * | 2017-08-11 | 2017-12-01 | 浙江省林业科学研究院 | A kind of low stain and high sensitive inexpensive general strain method for identifying molecules |
| CN107418951B (en) * | 2017-08-11 | 2021-01-15 | 浙江省林业科学研究院 | Low-pollution and high-sensitivity low-cost general strain molecular identification method |
| CN108841942A (en) * | 2018-06-04 | 2018-11-20 | 常州市环境监测中心 | A kind of PM2.5 bacterial community composition source is quickly analyzed and methods of risk assessment |
| CN108841942B (en) * | 2018-06-04 | 2021-12-07 | 常州市环境监测中心 | PM2.5 bacterial community composition source rapid analysis and risk assessment method |
| CN109238775A (en) * | 2018-09-08 | 2019-01-18 | 常州市环境监测中心 | A kind of passive sampling apparatus in situ and application based on the monitoring of physical and chemical and biological coupling |
| CN112159856A (en) * | 2020-11-04 | 2021-01-01 | 江苏宏众百德生物科技有限公司 | Method for realizing absolute quantification of blue-green algae on generic level based on second-generation sequencing technology |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Luo et al. | Microbial community structures in a closed raw water distribution system biofilm as revealed by 454-pyrosequencing analysis and the effect of microbial biofilm communities on raw water quality | |
| Rajendhran et al. | Strategies for accessing soil metagenome for desired applications | |
| CN103993007B (en) | The simple and easy method of a kind of high efficiency extraction DNA from pedotheque | |
| CN101475987B (en) | Rapid molecule detecting method for microflora composition in waste water biological treatment reactor | |
| Felczykowska et al. | Sampling, metadata and DNA extraction-important steps in metagenomic studies | |
| Fujitani et al. | Isolation of sublineage I N itrospira by a novel cultivation strategy | |
| Chernyh et al. | Microbial life in Bourlyashchy, the hottest thermal pool of Uzon Caldera, Kamchatka | |
| CN106929578A (en) | The evaluation method of planktonic bacteria group in a kind of Taihu Lake water body | |
| Saunders et al. | Comparison of nutrient-removing microbial communities in activated sludge from full-scale MBRs and conventional plants | |
| Jinhua et al. | Bacterial community structure on membrane surface and characteristics of strains isolated from membrane surface in submerged membrane bioreactor | |
| Collins et al. | Accessing the black box of microbial diversity and ecophysiology: recent advances through polyphasic experiments | |
| CN109593868A (en) | It is a kind of for detecting characteristic nucleotide sequence and its specific primer, the kit and detection method of pseudomonas bacterium | |
| Da Silva et al. | Sulfide removal from livestock biogas by Azospirillum-like anaerobic phototrophic bacteria consortium | |
| Bryukhanov et al. | Investigation of the sulfate-reducing bacterial community in the aerobic water and chemocline zone of the Black Sea by the FISH technique | |
| CN112646902A (en) | Kit and method for rapidly detecting archaea | |
| Sadeepa et al. | Diversity of microbial communities in hot springs of Sri Lanka as revealed by 16S rRNA gene high-throughput sequencing analysis | |
| CN106701580A (en) | Separation method of autotrophic bacteria and heterotrophic bacteria in activated sludge of sewage treatment plant | |
| Qin et al. | Population dynamics of ammonia-oxidizing bacteria in an aerated submerged biofilm reactor for micropolluted raw water pretreatment | |
| Hershey et al. | A practical guide to studying the microbiology of karst aquifers | |
| Dunaev et al. | Use of RNA-based genotypic approaches for quantification of viable but non-culturable Salmonella sp. in biosolids | |
| Ramothokang et al. | ‘Morphological shifts’ in filamentous bacteria isolated from activated sludge processes | |
| Ziembinska et al. | Molecular analysis of temporal changes of a bacterial community structure in activated sludge using denaturing gradient gel electrophoresis (DGGE) and fluorescent in situ hybridization (FISH) | |
| CN111573853B (en) | Method for reducing toxicity of wastewater treated by biological method | |
| Vlasova et al. | The Prokaryotic Community Structure of Oil-Contaminated Chernozem as Affected by the Introduction of Potassium Nitrate and Chloride | |
| WO2016145329A1 (en) | Pcr amplification methods, primers, and probes for detecting and quantifying sulfate-reducing bacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170707 |