CN106929484A - The mark and detection method of a kind of deoxyuridine of 5 acetenyl 2 ' of hepatitis B virogene group DNA - Google Patents

The mark and detection method of a kind of deoxyuridine of 5 acetenyl 2 ' of hepatitis B virogene group DNA Download PDF

Info

Publication number
CN106929484A
CN106929484A CN201710153469.2A CN201710153469A CN106929484A CN 106929484 A CN106929484 A CN 106929484A CN 201710153469 A CN201710153469 A CN 201710153469A CN 106929484 A CN106929484 A CN 106929484A
Authority
CN
China
Prior art keywords
ntcp
hbv
edu
huh7
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710153469.2A
Other languages
Chinese (zh)
Other versions
CN106929484B (en
Inventor
马春红
武专昌
梁晓红
高立芬
王泽华
宋晓佳
徐蕾琪
王体潇
宋洋
杜宪红
谭思雨
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong University
Original Assignee
Shandong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong University filed Critical Shandong University
Priority to CN201710153469.2A priority Critical patent/CN106929484B/en
Publication of CN106929484A publication Critical patent/CN106929484A/en
Application granted granted Critical
Publication of CN106929484B publication Critical patent/CN106929484B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00—Reverse transcribing DNA viruses
    • C12N2730/00011—Details
    • C12N2730/10011—Hepadnaviridae
    • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10151—Methods of production or purification of viral material
    • C12N2730/10152—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/01—DNA viruses
    • G01N2333/02—Hepadnaviridae, e.g. hepatitis B virus

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Food Science & Technology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses the mark and detection method of a kind of deoxyuridine of 5 acetenyl 2 ' of hepatitis B virogene group DNA, specifically include：(1) NTCP genes are expanded, NTCP eukaryon expression plasmid pcDNA NTCP are built, pcDNA NTCP is transferred in Huh7 HCCs the Huh7 NTCP cell lines for building NTCP stabilization expression；(2) HepG2.2.15 cells are processed using EdU, obtains the cell conditioned medium containing EdU HBV, HBV gene group copy number carried out using PEG8000 treatment, after concentration and is quantified；(3) by HBV passages culture to cell confluency degree be 50 80% when, using EdU HBV infection Huh7 NTCP cells, then carry out EdU HBV fluoroscopic examinations.Compared with prior art, simple to operate, image result need not carry out later stage treatment to the present invention, and each coloration result does not interfere with each other.

Description

A kind of deoxyuridine of 5- acetenyls -2 ' of hepatitis B virogene group DNA Mark and detection method
Technical field
The present invention relates to technical field of bioengineering, more particularly to a kind of 5- acetylene of hepatitis B virogene group DNA Base -2 ' deoxyuridine mark and detection method.
Background technology
Hepatitis type B virus abbreviation hepatitis B (Hepatitis B virus, HBV), is a kind of DNA virus, belongs to thermophilic Hepadnaviridae (hepadnaviridae).HBV only has neurological susceptibility to people and orangutan, its chronic infection and cirrhosis and liver cancer It is in close relations, it is the mostly important risk factor of hepatocellular carcinoma (hepatocellular carcinoma, HCC).Serology Evidence confirms have 30% once to infect HBV in population in the world, wherein about 2.5 hundred million people are HBV chronic infections, but HBV is caused so far Interpretation of the cause, onset and process of an illness system is not illustrated yet.HBV has strict species specificity, and its natural reservoir (of bird flu viruses) is only limitted to people and orangutan, and HBV viral genes Though group only includes 3200bp, effectively, replicative cycle is special for structure, and the good animal model of shortage and virus signature technology are serious Limit the research of HBV related mechanisms.
HBV infection depends on surface of hepatocytes specific receptor sodium ion-taurocholate to cotransport albumen (sodium Taurocholate cotransporting polypeptide, NTCP), determine the kind and organizing specific of HBV infection Property.After HBV virus bind receptor NTCP invasion liver cells, viral relaxed circular genomic DNA (RC-DNA) enters nucleus, warp Cross reparation and form covalence closed cyclic DNA (cccDNA), and combine host cell histone, viral core protein etc. with small Chromosome form is present.CccDNA transcribes to form pgRNA and subgenomic RNA, and under the effect of Pol albumen, pgRNA is in nucleocapsid Interior reverse transcription forms RC-DNA, and parcel cyst membrane forms mature virion, and is formed again in RC-DNA also Transshipment Permitted karyons cccDNA.CccDNA is the unique template and internal virus repository of HBV transcriptions, is also the main cause that HBV is persistently present.
All many-side such as current HBV infection and the molecular mechanism that is interacted with cell are not still very clear, such as HBV combinations After NTCP acceptors, host cell how is further infected, how cccDNA to be formed, maintain and transcriptional control etc., seriously limit The Mechanism Study of HBV related liver diseases and the exploitation for HBV specific treatment target spots.Set up HBV gene group DNA marker and detection Method, contributes to HBV to infect the Study on Molecular Mechanism with transcriptional control, to seeking the potential target spot for suppressing and blocking hbv replication Have great importance, but rarely have the report on HBV gene group DNA marker and detection method so far.
The content of the invention
Based on the deficiencies in the prior art, it is an object of the invention to provide a kind of 5- acetenyls -2 ' of HBV gene group DNA The mark and detection method of deoxyuridine, are the molecular mechanism of HBV infection processs and cccDNA maintenances and transcriptional control Important research tool is provided Deng research.
To realize above-mentioned technical purpose, the present invention is adopted the following technical scheme that：
The first aspect of the present invention, the open deoxyuridine of 5- acetenyls -2 ' of knowing clearly enters to HBV gene group DNA Line flag and the application of detection；
The second aspect of the present invention, discloses a kind of deoxyuridine of 5- acetenyls -2 ' of HBV gene group DNA Mark and detection method, methods described comprise the following steps：
(1) NTCP genes are expanded, NTCP eukaryon expression plasmid pcDNA-NTCP are built, pcDNA-NTCP is transferred to Huh7 livers The Huh7-NTCP cell lines of NTCP stabilization expression are built in cancer cell；
(2) HepG2.2.15 cells are processed using the deoxyuridine (EdU) of 5- acetenyls -2 ', obtains and contain EdU-HBV Cell conditioned medium, using PEG8000 treatment, supernatant is abandoned in centrifugation, is quantified to carrying out HBV gene group copy number in precipitation；
(3) during by Huh7-NTCP passages culture to cell confluency degree for 50-80%, infected using EdU-HBV Huh7-NTCP cells, then carry out EdU-HBV fluoroscopic examinations.
In one embodiment of the invention, step (1) includes：
1) NTCP genes are expanded, in insertion vector pcDNA3.0, NTCP eukaryon expression plasmids pcDNA-NTCP is constructed；
2) pcDNA-NTCP is transfected into Huh7 cells, is screened using Geneticin G418；
3) picking Geneticin G418 resistance positive colonies, are detected using indirect immunofluorescence assay (IFA) and qRT-PCR NTCP is expressed；
4) NTCP high-expression clones, Amplification Culture are selected；
5) HBV is infected, HBsAg is detected with ELISA, determine that Huh7-NTCP cell lines support HBV infection.
Preferably, the amplimer of selection when being expanded to NTCP genes is：
pC3NTCP-F:CCCAAGCTTGCCACCATGGAGGCCCACAACGCGTCTG；
pC3NTCP-R:CCGCTCGAGCTAGGCTGTGCAAGGGGAGCAG；
Preferably, the pcDNA-NTCP plasmids for building are linearized, it is further preferred that to pcDNA-NTCP plasmids The linearisation enzyme used for being linearized is PvuI restriction endonucleases；
Preferably, the restriction enzyme of digestion selection is carried out to NTCP amplification genes and pcDNA3.0 for HindIII and XhoI；
Preferably, the concentration of Geneticin G418 be 700ug/ml, using Geneticin G418 screened when Between be 4-6 weeks；
Preferably, it is internal reference from GAPDH when carrying out qRT-PCR, each primer sequence is respectively：
hNTCP-qF:GGGACATGAACCTCAGCATT；
hNTCP-qR:CGTTTGGATTTGAGGACGAT；
hGAPDH-qF:GGAGTCCACTGGCGTCTTCAC；
hGAPDH-qR:GAGGCATTGCTGATGATCTTGAGG；
In one embodiment of the invention, step (2) includes：
1) HepG2.2.15 HCCs are carried out into Secondary Culture using MEM culture mediums, after cell is covered with, changes and contain 10 μ The MEM culture mediums of MEdU and 2% hyclone FBS carry out culture 3d, collect cell conditioned medium；Then add again containing 10 μM of EdU and The MEM culture mediums of 2%FBS continue to cultivate and regather cell conditioned medium once；
2) viral purification is carried out to the cell conditioned medium collected, removes cell fragment and impurity, then added in cell conditioned medium Enter PEG8000, it is slow on ice to mix 4-6h；Centrifugation, abandons supernatant, HBV gene group copy number is carried out after precipitation is resuspended and is quantified；
Preferably, step 2) in the addition of PEG8000 be that the final concentration for making PEG8000 reaches 5-10%；
Preferably, step 2) in centrifugal condition be 3000-5000rpm, 4 DEG C centrifugation 20min；
Preferably, step 2) in be to specific method that HBV gene group copy number quantitative analysis is carried out in precipitation：To concentration HBV HBV gene group copy number quantitative analysis is carried out using PCR- fluorescence probe methods；
In the specific embodiment of the present invention, step (3) includes：
1) Huh7-NTCP passages, during degree of converging 50-80%, are diluted with the DMEM containing 4%PEG8000 and 10%FBS EdU-HBV postoperative infection Huh7-NTCP cells；
2) after infection 2-12h, supernatant discarded after washing 3 times with PBS, changes the MEM culture mediums containing 10%FBS, continues to train Support；
3) to after expeced time point, EdU-HBV fluoroscopic examinations are carried out.Culture medium is discarded, after PBS washes one time, 4% poly is used Formaldehyde room temperature fixes 30min；
4) fixer is discarded, glycine is added, after incubation at room temperature, glycine solution is discarded, PBS is washed one time；
5) TritonX-100 is added, after incubation at room temperature, punching liquid is discarded, PBS is washed three times；
6) after adding fluorescent staining reaction solution, room temperature lucifuge to be incubated, after discarding dyeing liquor, PBS is washed three times；
7) continued to rinse with methyl alcohol；
8) dyeed with DAPI dyeing liquors lucifuge；
9) after PBS is rinsed, analyzed with anti-fluorescence quenching mounting and confocal microscope；
Preferably, step 4) in glycine concentration be 2mg/ml；
Preferably, step 6) in the collocation method of fluorescent staining reaction solution be：Configured with 1ml dyeing liquors, affiliated reaction is slow Fliud flushing 50ul, is catalyzed buffer solution 10ul, fluorescent dye Alexa Fluor 488azide solution 3ul, buffer additive 10mg, ddH2O938ul。
The third aspect of the present invention, discloses the above method in the analysis of HBV infection dynamic, antiviral drugs screening, cell With the application in HBV interactions, HBV DBPs.
The present invention is marked using EdU to the DNA of HBV first, and EdU (5 '-Ethynyl-2 '-deoxyuridine) is A kind of thymidine analog, can replace thymidine (T) to penetrate into the DNA molecular for replicating in cell propagation period In, and by the method based on click chemistry (click chemistry), with the fluorescent dye containing azido or biotin decile Son is combined, and is completed fluorescence labeling or is carried out the immune precipitation of DNA mediations.But not yet it is related to use EdU so far to HBV The report being marked, inventor find under study for action the EdU of various concentrations on the state influence of the yield and cell of HBV compared with Greatly, and then HBV is influenceed to the infection ability of liver cell, therefore the EdU of selection suitable concn is very big on result influence, applicant is led to Optimum Experiment step and technological parameter are crossed, the deoxidation of 5- acetenyls -2 ' of above-mentioned hepatitis B virogene group DNA has been finally given The mark and detection method of uridine, meanwhile, after pcDNA-NTCP plasmids are prepared, applicant has been surprisingly found that, will PcDNA-NTCP plasmids are linearized, and can increase the ratio of DNA integration efficiencies and positive cell clone, while considering line Property after must can not influence destination gene expression, it is final to determine from PvuI restriction endonucleases as right by a large amount of screenings The linearisation enzyme that pcDNA-NTCP plasmids are linearized；By verification experimental verification, the EdU-HBV that the application is prepared have and The close infection ability of parental virus, is further to inquire into HBV infection dynamically analysis, antiviral drugs screening, cell and HBV phases Interaction, searching HBV DBPs are laid a good foundation.
The present invention compared with prior art, it is simple to operate, meanwhile, in labeling process, the present invention by EdU mix dyeing, DAPI is redyed and is combined with HBV, and the picture indicia color obtained through present invention mark and detection method is vivid, and signal intensity is strong, Image result need not carry out later stage treatment, and each coloration result does not interfere with each other.
Brief description of the drawings
Fig. 1 (a) is NTCP gene magnification figures, and Fig. 1 (b) is pcDNA-NTCP plasmid enzyme restriction figures；
For pcDNA-NTCP plasmids carry out linearized enzyme digestion figure, (wherein, M roads are 15000bp DNA ladder electricity to Fig. 2 (a) Swimming figure, 1 road is to carry out pcDNA-hNTCP using PvuI restriction endonucleases to linearize electrophoretogram；2 roads are control group electrophoretogram)；
Fig. 2 (b) is pcDNA plasmid maps (restriction enzyme site containing PvuI)；
Fig. 3 is that Huh7-NTCP positive colonies qPCR analyzes NTCP expression figures；
Fig. 4 is Huh7-NTCP cell clone IFA qualification figures；
Fig. 5 is that EdU-HBV and HBV infection compare block diagram；
Fig. 6 is the EdU-HBV figures of click chemistry reaction and fluoroscopic examination infection；
Fig. 7 is the positioning variation diagram that EdU-HBV infects different time.
Specific embodiment
It is noted that described further below is all exemplary, it is intended to provide further instruction to the application.Unless another Indicate, all technologies used herein and scientific terminology are with usual with the application person of an ordinary skill in the technical field The identical meanings of understanding.
It should be noted that term used herein above is merely to describe specific embodiment, and be not intended to restricted root According to the illustrative embodiments of the application.As used herein, unless the context clearly indicates otherwise, otherwise singulative Be also intended to include plural form, additionally, it should be understood that, when in this manual use term "comprising" and/or " bag Include " when, it indicates existing characteristics, step, operation, device, component and/or combinations thereof.
The foundation of the Huh7-NTCP cell lines of embodiment 1
1. NTCP genes are expanded, in insertion vector pcDNA3.0, NTCP eukaryon expression plasmid pcDNA-NTCP is constructed, had Body, the NTCP genes and carrier pcDNA3.0 after amplification are carried out into the reaction of HindIII, XhoI double digestion, 1.5% agar respectively Its product of sugared detected through gel electrophoresis is simultaneously linearized using PvuI restriction endonucleases to the NTCP-pcDNA plasmids for building, to increase The ratio of DNA integration efficiencies and positive cell clone；Using T4DNA ligases connect above-mentioned linear plasmid carrier pcDNA3.0 and NTCP genes.Amplification NTCP gene primers are as follows：
pC3NTCP-F:cccAAGCTTgccaccatggaggcccacaacgcgtctg
pC3NTCP-R:ccgCTCGAGctaggctgtgcaaggggagcag
2.pcDNA-NTCP transfects Huh7 cells, and 700ug/ml G418 are screened 4-6 weeks
3. picking G418 resistances positive colony, IFA and qRT-PCR detection NTCP expression
QRT-PCR the primers：
hNTCP-qF:GGGACATGAACCTCAGCATT
hNTCP-qR:CGTTTGGATTTGAGGACGAT
hGAPDH-qF:GGAGTCCACTGGCGTCTTCAC
hGAPDH-qR:GAGGCATTGCTGATGATCTTGAGG
4. NTCP high-expression clones, Amplification Culture are selected
5. HBV is infected, HBsAg is detected with ELISA, determine that Huh7-NTCP cell lines support HBV infection
The preparation of the EdU-HBV of embodiment 2
Material：
5-ethynyl-2’-deoxyuridine(EdU)(Sigma)in DMSO
HepG2.2.15cell
HBV gene group DNA quantification kits (QiaGen)
PEG8000(Sigma)
Step:
1. 1x107HepG2.2.15 passages are in T75 blake bottles
2. after culture 24h, change containing 10 μM of MEM of EdU and 2%FBS, cell conditioned medium is collected after 2d, then add again and contain 10 μM of MEM of EdU and 2%FBS, regather cell conditioned medium once after 2d
3. the cell conditioned medium collected, carries out viral purification：Filtered with 0.45um filter membranes (Millipore) first or 12000rpm is centrifuged the impurity such as 2min, removal cell fragment
4. supernatant is transferred in another 50ml centrifuge tubes, adds final concentration of 5-10%PEG8000, slow on ice to mix 4- 6h
5. 4 DEG C of 3000-5000rpm is centrifuged 20min
6. supernatant is abandoned, and precipitation is resuspended with the DMEM culture mediums of the former volume of culture supernatant 1/10, is frozen in -80 after aliquot packing ℃。
7. the HBV of concentration carries out HBV with the HBV nucleic acid quantitative determination reagent kits (PCR- fluorescence probe methods) of QIAGEN companies Genome copy numbers are quantified, brief step：Sample process
1) 100ul sample pretreatment solutions are added, 50ul standard items+50ul PBS are added, vibration mixes plasmid standards for quantitation 1- 4:3x10^7,2.5x10^5,2.5x10^4,7x10^2 (unit：IU/ml), positive control, negative control sample does same treatment
2) 15000rpm centrifugations 10min, inspiration supernatant (does not touch precipitation, the virion of enrichment)
3) 25ul lysates are added, thoroughly vibration mixes (3-5min), 100 DEG C of metal baths or boiling water bath 10min (crack disease Virion)
4) 4 DEG C, 15000rpm centrifugations 10min
5) qPCR mix are prepared
6) it is loaded：
22.5ul qPCR mix
2.5ul sample supernatants
PCR amplification conditions：
37 DEG C of 5min (eliminating UTP-DNA)；
95 DEG C of 5min (becoming UNG enzymes living)；
95℃15s；
60℃40s；Amplification 45cycle, 60 DEG C of collection signals.
The virus infection of embodiment 3
1.Huh7-NTCP passages, during degree of converging 50-80%, are diluted with the DMEM containing 4%PEG8000 and 10%FBS EdU-HBV and HBV postoperative infection Huh7-NTCP cells (100-1000Geq/cell)；
2. after infection 2-12h, supernatant discarded after washing 3 times with PBS, changes 2% culture medium, it is contemplated that time point detects HBsAg Secrete and carry out EdU-HBV fluoroscopic examinations.
The EdU-HBV of embodiment 4 infects fluoroscopic examination
After 1.EdU-HBV and HBV infection Huh7-NTCP cell infections 6h, culture medium is discarded, after PBS washes one time, with 4% Paraformaldehyde room temperature fixes 30min；
2. fixer is discarded, 2mg/ml glycine is added, after incubation at room temperature 5min, glycine solution is discarded, PBS washes one Time,
3. 0.5%TritonX-100 is added, after incubation at room temperature 10min, punching liquid is discarded, PBS is washed 3 times；
4. (1ml dyeing liquors are prepared to add fluorescent staining reaction solution：Reaction buffer 50ul, is catalyzed buffer solution 10ul, fluorescence Dyestuff Alexa Fluor 488azide solution 3ul, buffer additive 10mg, ddH2O 938ul), room temperature lucifuge is incubated After 30min-1h, after discarding dyeing liquor, PBS is washed 3 times, each 10min；
5. continued to wash 2 times with methyl alcohol, each 5min；PBS is washed 1 time；
6. 5min is dyeed with DAPI dyeing liquors lucifuge；
After 7.PBS washes 3 times, analyzed with anti-fluorescence quenching mounting and confocal microscope.
The HBsAg ELISA of embodiment 5 are detected
After 1.EdU-HBV and HBV infection Huh7-NTCP cell infections 12h, culture medium is discarded, after PBS washes one time, added After culture medium continues to cultivate 12h, cell conditioned medium is collected；
2. supernatant is added to reacting hole, 100ul/ holes, 37 DEG C of reaction 1h after being diluted with PBS 5x；
3. 50ul HRP enzymic-labelled antibodies are added, and 37 DEG C are continued to react 30min；
4.PBST is washed 3-5 times；
5. 50ul nitrite ions A and nitrite ion B is separately added into；
6. after 37 DEG C of reaction 30min, 50ul terminate liquids are added in reading OD values under 450nm wavelength.
The EdU labeling methods of hepatitis type B virus (HBV) genomic DNA of the present invention are set up, and are a kind of new of HBV marks Method.The EdU-HBV for showing that the present invention is obtained is tested and analyzed by the HBsAg after 5 pairs of infection Huh7-NTCP cell lines of embodiment With the infection ability close with parental virus；Fluorescence analysis shows that EdU-HBV can be arrived by specific detection, when infecting different Between detection show EdU-HBV virus early stage migrated from endochylema to the change of karyon.

Claims (10)

  1. The deoxyuridine of 1.5- acetenyls -2 ' is in the application that HBV gene group DNA is marked and is detected.
  2. 2. the mark and detection method of a kind of deoxyuridine of 5- acetenyls -2 ' of HBV gene group DNA, it is characterised in that Methods described comprises the following steps：
    (1) NTCP genes are expanded, NTCP eukaryon expression plasmid pcDNA-NTCP are built, pcDNA-NTCP Huh7 liver cancer is transferred to thin The Huh7-NTCP cell lines of NTCP stabilization expression are built in born of the same parents；
    (2) HepG2.2.15 cells are processed using EdU, obtains the cell conditioned medium containing EdU-HBV, using PEG8000 treatment, from The heart, abandons supernatant, is quantified to carrying out HBV gene group copy number in precipitation；
    (3) during by HBV passages culture to cell confluency degree for 50-80%, Huh7-NTCP cells are infected using EdU-HBV, Then EdU-HBV fluoroscopic examinations are carried out.
  3. 3. a kind of method as claimed in claim 2, it is characterised in that the step (1) includes：
    1) NTCP genes are expanded, in insertion vector pcDNA3.0, NTCP eukaryon expression plasmids pcDNA-NTCP is constructed；
    2) pcDNA-NTCP is transfected into Huh7 cells, is screened using Geneticin G418；
    3) picking Geneticin G418 resistance positive colonies, NTCP is detected using indirect immunofluorescence assay (IFA) and qRT-PCR Expression；
    4) NTCP high-expression clones, Amplification Culture are selected；
    5) HBV is infected, HBsAg is detected with ELISA, determine that Huh7-NTCP cell lines support HBV infection.
    Preferably, the pcDNA-NTCP plasmids for building are linearized；It is further preferred that being carried out to pcDNA-NTCP plasmids The linearisation enzyme used of linearisation is PvuI restriction endonucleases；
    Preferably, the amplimer of selection when being expanded to NTCP genes is：
    pC3NTCP-F:CCCAAGCTTGCCACCATGGAGGCCCACAACGCGTCTG；
    pC3NTCP-R:CCGCTCGAGCTAGGCTGTGCAAGGGGAGCAG。
  4. 4. a kind of method as claimed in claim 3, it is characterised in that digestion choosing is carried out to NTCP amplification genes and pcDNA3.0 Restriction enzyme is HindIII and XhoI；
    The concentration of Geneticin G418 is 700ug/ml, and the time screened using Geneticin G418 is 4-6 weeks；
    It is internal reference from GAPDH when carrying out qRT-PCR, each primer sequence is respectively：
    hNTCP-qF:GGGACATGAACCTCAGCATT；
    hNTCP-qR:CGTTTGGATTTGAGGACGAT；
    hGAPDH-qF:GGAGTCCACTGGCGTCTTCAC；
    hGAPDH-qR:GAGGCATTGCTGATGATCTTGAGG。
  5. 5. a kind of method as claimed in claim 2, it is characterised in that the step (2) includes：
    1) HepG2.2.15 HCCs are carried out into Secondary Culture using MEM culture mediums, changes and contain 10 μM of EdU and 2% tire ox blood The MEM culture mediums of clear FBS carry out Secondary Culture again, collect cell conditioned medium；Then add again containing 10 μM of MEM of EdU and 2%FBS Culture medium carries out Secondary Culture and collects cell conditioned medium once；
    2) viral purification is carried out to the cell conditioned medium collected, removes cell fragment and impurity, then added in cell conditioned medium PEG8000, it is slow on ice to mix 4-6h；Centrifugation, abandons supernatant, is quantified to carrying out HBV gene group copy number in precipitation.
  6. 6. a kind of method as claimed in claim 5, it is characterised in that step 2) in PEG8000 addition to make PEG8000 Final concentration reach 5-10%；
    Step 2) in centrifugal condition be 3000-5000rpm, 4 DEG C centrifugation 20min；
    Step 2) in be to specific method that HBV gene group copy number quantitative analysis is carried out in precipitation：HBV to concentrating is used PCR- fluorescence probe methods carry out HBV gene group copy number quantitative analysis.
  7. 7. a kind of method as claimed in claim 2, it is characterised in that the step (3) includes：
    1) Huh7-NTCP passages, during degree of converging 50-80%, EdU- are diluted with the DMEM containing 4%PEG8000 and 10%FBS HBV postoperative infection Huh7-NTCP cells；
    2) after infection 2-12h, supernatant discarded after washing 3 times with PBS, changes 2%MEM culture mediums, carries out EdU-HBV fluoroscopic examinations；
    3) EdU-HBV is infected into Huh7-NTCP cells, discards culture medium, after PBS washes one time, fixed with 4% paraformaldehyde room temperature 30min；
    4) fixer is discarded, glycine is added, after incubation at room temperature, glycine solution is discarded, PBS is washed one time；
    5) TritonX-100 is added, after incubation at room temperature, punching liquid is discarded, PBS is washed three times；
    6) after adding fluorescent staining reaction solution, room temperature lucifuge to be incubated, after discarding dyeing liquor, PBS is washed three times；
    7) continued to rinse with methyl alcohol；
    8) dyeed with DAPI dyeing liquors lucifuge；
    9) after PBS is rinsed, analyzed with anti-fluorescence quenching mounting and confocal microscope.
  8. 8. method as claimed in claim 7, it is characterised in that the step 4) in the concentration of glycine be 2mg/ml.
  9. 9. method as claimed in claim 7, it is characterised in that the step 6) in fluorescent staining reaction solution collocation method For：Configured with 1ml dyeing liquors, reaction buffer 50ul, be catalyzed buffer solution 10ul, fluorescent dye Alexa Fluor 488 Azide solution 3ul, buffer additive 10mg, ddH2O 938ul。
  10. 10. claim 2-9 any one methods described is in the analysis of HBV infection dynamic, antiviral drugs screening, cell and HBV Interact and the application in HBV DBPs.
CN201710153469.2A 2017-03-15 2017-03-15 A kind of tagging and testing method of the 5- deoxyuridine of acetenyl -2 ' of hepatitis B virogene group DNA Active CN106929484B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710153469.2A CN106929484B (en) 2017-03-15 2017-03-15 A kind of tagging and testing method of the 5- deoxyuridine of acetenyl -2 ' of hepatitis B virogene group DNA

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710153469.2A CN106929484B (en) 2017-03-15 2017-03-15 A kind of tagging and testing method of the 5- deoxyuridine of acetenyl -2 ' of hepatitis B virogene group DNA

Publications (2)

Publication Number Publication Date
CN106929484A true CN106929484A (en) 2017-07-07
CN106929484B CN106929484B (en) 2019-07-02

Family

ID=59433263

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710153469.2A Active CN106929484B (en) 2017-03-15 2017-03-15 A kind of tagging and testing method of the 5- deoxyuridine of acetenyl -2 ' of hepatitis B virogene group DNA

Country Status (1)

Country Link
CN (1) CN106929484B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112326539A (en) * 2020-10-28 2021-02-05 中国科学院生态环境研究中心 Quantitative detection method for cell proliferation of whole organ
CN115074332A (en) * 2022-06-21 2022-09-20 中国人民解放军陆军军医大学第一附属医院 Method for constructing Huh7-eGFP cell strain for stably expressing green fluorescent protein

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101921835A (en) * 2010-05-19 2010-12-22 广州市锐博生物科技有限公司 Method and kit for marking nucleic acid in living cell
CN106166328A (en) * 2015-08-14 2016-11-30 浙江大学 A kind of use the tumor cell of liver that mixes the method preserving Quality of Erythrocyte in linear accelerator inactivation autogenous vein

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101921835A (en) * 2010-05-19 2010-12-22 广州市锐博生物科技有限公司 Method and kit for marking nucleic acid in living cell
CN106166328A (en) * 2015-08-14 2016-11-30 浙江大学 A kind of use the tumor cell of liver that mixes the method preserving Quality of Erythrocyte in linear accelerator inactivation autogenous vein

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GUIFANG YU等: "MiR-19a, miR-122 and miR-223 are differentially regulated by hepatitis B virus X protein and involve in cell proliferation in hepatoma cells", 《J TRANSL MED》 *
ZONGLI DIAO等: "Purified hepatitis B virus induces human Mesangial cell proliferation and extracellular matrix expression In Vitro", 《VIROLOGY JOURNAL》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112326539A (en) * 2020-10-28 2021-02-05 中国科学院生态环境研究中心 Quantitative detection method for cell proliferation of whole organ
CN115074332A (en) * 2022-06-21 2022-09-20 中国人民解放军陆军军医大学第一附属医院 Method for constructing Huh7-eGFP cell strain for stably expressing green fluorescent protein

Also Published As

Publication number Publication date
CN106929484B (en) 2019-07-02

Similar Documents

Publication Publication Date Title
Zeng et al. Geographic distribution, virologic and clinical characteristics of hepatitis B virus genotypes in China
Kurbanov et al. Detection of hepatitis C virus natural recombinant RF1_2k/1b strain among intravenous drug users in Uzbekistan
Esposito et al. Occult hepatitis infection in transfusion medicine: screening policy and assessment of current use of anti-HBc testing
Levast et al. Prevalence and impact of occult hepatitis B infection in chronic hepatitis C patients treated with pegylated interferon and ribavirin
Lunel-Fabiani et al. Impact of hepatitis B and delta virus co-infection on liver disease in Mauritania: a cross sectional study
Alberti et al. Full and empty Dane particles in chronic hepatitis B virus infection: relation to hepatitis B e antigen and presence of liver damage
CN103884847B (en) A kind of Much's bacillus holoprotein chip and application
CN103820431A (en) Nucleic acid extraction and purification method based on nanometer magnetic beads and kit
CN102121009B (en) Nucleic acid aptamer specifically combined with hepatitis C virus core protein and application thereof
Petruzziello et al. Distribution pattern of hepatitis C virus genotypes and correlation with viral load and risk factors in chronic positive patients
JP2005523709A5 (en)
Zhong et al. A novel method for detection of HBVcccDNA in hepatocytes using rolling circle amplification combined with in situ PCR
CN106929484B (en) A kind of tagging and testing method of the 5- deoxyuridine of acetenyl -2 ' of hepatitis B virogene group DNA
Shiokawa et al. Novel permissive cell lines for complete propagation of hepatitis C virus
CN104004763A (en) Nucleic acid aptamer of affinity viral hepatitis C core protein and application of nucleic acid aptamer
CN106702020A (en) Method for diagnosing avian leukosis virus subgroup J of sicken chicken flocks
US20160017442A1 (en) Multiplex Real Time PCR Testing Kit for the Simultaneous Detection of Hepatitis Virus
Zhang et al. High risk of occult hepatitis B virus infection in leukemia patients from China
Wang et al. The implications of cell‐free DNAs derived from tumor viruses as biomarkers of associated cancers
CN111363748B (en) Aptamer, construction method thereof and application thereof in detection of Chinese softshell turtle rainbow virus
Li et al. Optimization of the expression of hepatitis B virus e gene in Pichia pastoris and immunological characterization of the product
Kaklikkaya et al. Hepatitis B virus genotypes and subgenotypes in the Eastern Black Sea region of Turkey
CN108796133A (en) A kind of the real time fluorescent quantitative detection kit and its detection method of serum HBV DNA
CN107557464A (en) Forecast model and detection kit for the reaction of interferon treatment in chronic hepatitis B early stage virology
Du et al. The prevalence and replication capacity of a Tibetan dominant HBV strain, C/D Recombinant

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant