CN106928330B - Plant biological yield related protein SOD3, and coding gene and application thereof - Google Patents

Abstract

The invention discloses a plant biological yield related protein SOD3 and a coding gene and application thereof. The invention provides a protein which is 1) or 2) as follows: 1) protein shown as a sequence 1 in a sequence table; 2) the protein which is derived from the sequence 1 and has the same function by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 1 in the sequence table. Experiments prove that the SOD3 and the coding gene thereof can increase the size of plant organs and increase biomass, lay a solid foundation for the genetic improvement of crops, and have important significance for the improvement of the crop yield.

Description

Plant biological yield related protein SOD3, and coding gene and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a plant biological yield-related protein SOD3, and a coding gene and application thereof.

Background

With the development of economy and the increase of population, the grain demand is increased day by day, the limitation of grain production is highlighted day by day due to the reduction of arable land area, and grain safety faces a serious challenge. The organ size of plants is an important agronomic trait, directly related to crop yield. Therefore, studying how a plant body achieves its own control of organ size has become one of the important strategies for improving crop yield.

As an important ubiquitin ligase, the SCF complex formed by F-box protein participates in efficient degradation of key proteins of growth and development, widely participates in biological processes such as phytohormone signal transduction, photoperiod, organ development and the like, and is vital to the growth and development of plants.

Disclosure of Invention

An object of the present invention is to provide plant biological yield related protein SOD3 and its coding gene.

The protein provided by the invention is named as SOD3 and is 1) or 2):

1) protein shown as a sequence 1 in a sequence table;

2) the protein which is derived from the sequence 1 and has the same function by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 1 in the sequence table.

The substitution and/or deletion and/or addition of one or more amino acid residues is the substitution and/or deletion and/or addition of no more than 10 amino acid residues.

DNA molecules encoding the above proteins are also within the scope of the present invention.

The DNA molecule is any one of the following 1) to 3):

1) the coding region is a DNA molecule shown as a sequence 2 in a sequence table;

2) DNA molecules which hybridize under stringent conditions with the DNA sequences defined in 1) and which code for proteins having the same function;

3) a DNA molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA sequence defined in 1) and encoding a protein having the same function.

The stringent conditions may be hybridization in a solution of 6 XSSC, 0.5% SDS at 65 ℃ and washing the membrane once with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

Recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the above DNA molecules are also within the scope of the present invention.

Primer pairs for amplifying the full length of the DNA molecule or any fragment thereof are also within the scope of the present invention.

The application of the protein, the DNA molecule or the recombinant vector, the expression cassette, the transgenic cell line or the recombinant bacterium in regulating and controlling the plant biological yield and/or the organ size is also within the protection scope of the invention.

In the above-mentioned application, the first and second substrates,

the organ corpuscles now have a leaf area, petal area, silique width and/or seed area;

the biological yield is expressed in terms of the weight of hundred seeds;

the plant is a monocotyledon or a dicotyledon;

the dicotyledonous plant is a cruciferous plant; the cruciferous plant is specifically arabidopsis thaliana.

The application of the protein, the DNA molecule or the recombinant vector, the expression cassette, the transgenic cell line or the recombinant bacterium in the cultivation of plant biological yield and/or organ size is also within the protection scope of the invention;

the organ corpuscles now have a leaf area, petal area, silique width and/or seed area;

the biological yield is expressed in terms of the weight of hundred seeds;

the plant is a monocotyledon or a dicotyledon;

the dicotyledonous plant is a cruciferous plant; the cruciferous plant is specifically arabidopsis thaliana.

It is another object of the present invention to provide a method for breeding transgenic plants with high biological yield and/or organ enlargement.

The method provided by the invention is used for introducing the DNA molecule for coding the protein into a target plant to obtain a transgenic plant, and the biological yield and/or organ size of the transgenic plant are higher than those of the target plant.

In the above-mentioned method, the first step of the method,

the organ corpuscles now have a leaf area, petal area, silique width and/or seed area;

the biological yield is expressed in terms of the weight of hundred seeds;

the plant is a monocotyledon or a dicotyledon;

the dicotyledonous plant is a cruciferous plant; the cruciferous plant is specifically arabidopsis thaliana.

Experiments prove that the novel protein SOD3 and the coding gene thereof are found and are introduced into wild arabidopsis thaliana to obtain a transgenic plant, and the organ, such as leaf area, petal area, silique width, seed area and biomass (weight of hundreds of seeds) of the transgenic plant are higher than those of the wild arabidopsis thaliana, so that the protein SOD3 and the coding gene thereof can increase the size of the plant organ and improve the biomass, thereby laying a solid foundation for genetic improvement of crops and having important significance for improving the crop yield.

Drawings

FIG. 1 is an electrophoretogram of a PCR-identified transgenic Arabidopsis plant;

wherein, A, lanes from left to right are wild type arabidopsis thaliana contrast, 15 transgenic arabidopsis thaliana plants and plasmid 35S, namely SOD3 positive contrast in sequence; b, lanes from left to right are wild type Arabidopsis thaliana control, 15 transgenic Arabidopsis thaliana plants and plasmid 35S, SOD3 positive control.

FIG. 2 is an electrophoretogram of the expression level of transgenic SOD3 Arabidopsis thaliana;

wherein A is the expression quantity of SOD3 gene, lanes from left to right are wild type Arabidopsis thaliana control and transgenic Arabidopsis thaliana in sequence, and 30 PCR cycles; b is the expression level of the reference ACTIN7 gene, and the lanes from left to right are wild type Arabidopsis thaliana control and transgenic Arabidopsis thaliana in sequence, 25 PCR cycles.

FIG. 3 is a diagram of the phenotype and statistics of SOD3 transgenic Arabidopsis plants;

wherein, I is wild type, II is transgenic line, representing that P is less than 0.01, the level difference is obvious, A is leaf of Arabidopsis plant, B is the 5 th flower on the stem, C is the 6 th silique on the stem, D is the seed of the 8 th silique on the stem, E is the histogram of the 5 th true leaf area statistics, F is the histogram of petal area statistics, G is the histogram of silique width statistics, H is the histogram of seed area statistics, and I is 100 seed weight statistics histogram.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 obtaining of SOD3 protein and Gene encoding the same

1. Obtaining of SOD3 encoding Gene

200mg of fresh wild type Arabidopsis thaliana (Col-0, The European Arabidopsis Stock Centre, N1092) seedlings (10 days after germination) were weighed, ground into powder in liquid nitrogen and total RNA extracted using a plant Total RNA extraction kit (TIANGEN). After extraction was complete, the concentration of total RNA was measured spectrophotometrically. Mu.g of total RNA was collected and subjected to reverse transcription using a reverse transcription kit (INVITROGEN) to obtain cDNA.

Using the cDNA as a template, PCR amplification was carried out using the following primers.

SOD3-F：ATGTCTACCTCCTCCTCTTCTT

SOD3-R：CTACAGTGCACCGAAATCCCATAG

PCR reaction (50. mu.L): 5 μ L of 10 XKOD-Plus Buffer, 5 μ L of 2mM dNTP, 2 μ L of 25mM MgSO4, 1.5 μ L of 10 μ M primer SOD3-F and 1.5 μ L of 10 μ M primer SOD3-R, 1 μ L of KOD-Plus (TOYOBO).

And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 30 seconds, annealing at 56 ℃ for 30 seconds, extension at 68 ℃ for 1.5 minutes, and circulation for 32 times; 10 minutes at 68 ℃. After completion of the reaction, 0.5. mu.L of Taq DNA polymerase (TAKARA) was added and the reaction was carried out at 72 ℃ for 30 minutes to add the base A.

The PCR product was electrophoresed in a 1% agarose gel and the size of the PCR product was about 1.4 kb.

The PCR product was recovered using agarose gel recovery kit (TIANGEN), and ligated into pCR8/GW/TOPO TA vector (INVITROGEN) to obtain SOD3-TOPO vector. Sequencing verification is carried out on the DNA fragments connected on the vector.

Sequencing results show that a PCR product in the SOD3-TOPO vector has a nucleotide sequence shown as a sequence 2 in a sequence table, a gene shown as the PCR product is named as SOD3 gene, an open reading frame is nucleotide 1-1341 in the sequence 2, the gene codes a protein shown as the sequence 1 in the sequence table, the protein is named as SOD3, and the sequence 1 consists of 446 amino acid residues.

Example 2 SOD3 protein and application of its coding gene

First, construction of recombinant vector 35S SOD3

The SOD3-TOPO vector prepared in example 1 was subjected to LR reaction (INVITROGEN) with a target vector pMDC43(INVITROGEN) to obtain 35S recombinant SOD3 vector.

Sequencing verification is carried out on the recombinant vector 35S SOD3, and the recombinant vector 35S SOD3 is obtained by carrying out LR recombination reaction on SOD3 gene shown in a sequence 2 and a target vector pMDC 43.

Second, obtaining transgenic SOD3 Arabidopsis thaliana

1. Obtaining of recombinant Agrobacterium

The recombinant vector 35S: SOD3 is transferred into Agrobacterium tumefaciens GV3101 by a shocker Micropulser (Bio-RAD), the bacterial liquid is coated on a solid medium plate containing 50 ug/mL kanamycin, 40 ug/mL gentamicin and 10 ug/mL rifampicin YEP, and the obtained positive clone is the Agrobacterium tumefaciens containing the vector 35S: SOD3 and is named as GV3101/35S: SOD 3.

YEP solid medium: yeast extract (OXOID)10g/L, tryptone (OXOID)10g/L, NaCl5g/L, and water in balance, adjusting pH to 7.0, adding 15g/L agar, and making into YEP solid culture medium.

2. Preparation of invaded dye solution

The positive clone GV3101/35S SOD3 obtained in step 1 above was selected and cultured overnight in YEP liquid medium containing 50. mu.g/mL kanamycin, 40. mu.g/mL gentamicin and 10. mu.g/mL rifampicin at 28 ℃ with shaking to OD₆₀₀Is 1.5-2.5. Then, the cells were centrifuged at 14 ℃ and 4000 rpm for 10 minutes to collect the cells, which were then resuspended in a transformation buffer to obtain an invaded solution.

Transformation buffer: 2.2g/L MS (Phytocechnolgy), 5% sucrose, 0.5g/L MES (AMRESCO), adjusted to pH 5.7, then 0.03% Silwet L-77(LEHLE SEEDS) was added.

3. Inflorescence infestation

Selecting a strong wild arabidopsis Col-0 plant, and dripping the infection liquid on the inflorescence by using a dropper until the inflorescence is completely infiltrated. Standing vertically in dark for 1 day, then normally culturing under light, and harvesting after about 1 month, thus obtaining the transgenic seeds.

4. Obtaining of transgenic SOD3 Arabidopsis thaliana

The transgenic seeds obtained in the above 3 were sown on a hygromycin-resistant selection medium and cultured for 10 days. The obtained resistant transgenic plants are transplanted into a culture medium (evenly mixed vermiculite and nutrient soil according to the volume of 2: 1), and are cultured under 16-hour illumination/8-hour darkness with illumination intensity of 4000Lux, temperature of 22 ℃ and humidity of 60-80%. 32 transgenic plants are screened out together and marked as T1 generation transgenic SOD3 Arabidopsis thaliana.

The empty vector pMDC43 was transferred into wild type Arabidopsis thaliana by the same method to obtain 12T 1 generations of empty vector Arabidopsis thaliana.

The hygromycin resistance screening culture medium comprises the following components: to 1/2MS solid medium (2.2g/L MS, 10% glucose, 0.5g/L MES, 0.8% agar, pH 5.7) was added 30. mu.g/mL hygromycin.

5. Identification of transgenic SOD3 Arabidopsis thaliana

The SOD3ID-F and SOD3ID-R are used as primers, and genome DNA of leaves of wild arabidopsis thaliana Col-0 and T1 generation empty vector arabidopsis thaliana and T1 generation SOD3 generation arabidopsis thaliana are used as templates respectively to carry out PCR amplification.

SOD3ID-F：CTCCCACAACGTATACATCATG

SOD3ID-R：TATCAGGCTCGTCCACATCA

PCR reaction (20. mu.L): mu.L of DNA, 2. mu.L of 10 XPCR buffer, 2. mu.L of 2.5mM dNTP, 1. mu.L of 10mM primer SOD3ID-F and 1. mu.L of 10mM primer SOD3ID-R, 0.3. mu.L of Taq DNA polymerase (TAKARA).

And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 30 seconds, annealing at 56 ℃ for 30 seconds, extension at 72 ℃ for 45 seconds, and circulation for 40 times; 10 minutes at 72 ℃.

As shown in FIG. 1, the band of about 750bp can be obtained from 30T 1 transgenic SOD3 Arabidopsis thaliana, while the wild Arabidopsis thaliana has no band, which indicates that all the plants of 30T 1 transgenic SOD3 Arabidopsis thaliana are positive. The results of T1 generation transgenic arabidopsis thaliana with the empty vector were consistent with those of wild type arabidopsis thaliana.

6. Expression level analysis of transgenic SOD3 Arabidopsis thaliana

Wild Col-0 and T1 transgenic SOD3 Arabidopsis seedlings which were germinated for 10 days were weighed, total RNA was extracted and reverse transcribed to obtain cDNA as in example 1.

Using the cDNA as a template, PCR amplification was carried out using the following primers, respectively.

SOD3RT-F：ATGTCTACCTCCTCCTCTTCTT

SOD3RT-R：TAGATGGTCGGAGCGAGAGA

ACTIN7-F：ATCCTTCCTGATATCGAC

ACTIN7-R：GAGAAGATGACTCAGATC

The PCR products were electrophoresed in a 1% agarose gel.

As a result, as shown in fig. 2, the expression level of SOD3 gene in T1 generation SOD3 transgenic arabidopsis thaliana was significantly increased compared to wild type arabidopsis thaliana.

Phenotypic analysis of three, transgenic SOD3 Arabidopsis thaliana

Under the same and normal conditions, wild type Arabidopsis thaliana (I) seeds, T1 generation transformed SOD3 Arabidopsis thaliana (II) seeds and T1 generation transformed empty carrier Arabidopsis thaliana seeds are planted, and indexes such as leaves, petals, siliques and seeds of 12 individual plants are counted respectively.

The statistical method and the result are as follows:

1. area of blade

After 40 days of sowing, the leaf area of the 5 th true leaf was measured as follows: the 5 th true leaf was removed from the plant, flattened and photographed, the area of the leaf was measured with Image J software, and statistical analysis was performed with EXCEL.

The photographing results are shown in fig. 3A, and the statistical results are shown in fig. 3E, and it can be seen that the leaf area of the 5 th true leaf of T1 generation SOD3 transgenic arabidopsis thaliana was significantly increased compared to wild type arabidopsis thaliana.

The results of the wild type arabidopsis and the T1 generation empty vector arabidopsis have no significant difference.

2. Area of petal

After 40 days of sowing, the petal area was measured as follows: the 4 th to 6 th flowers opened on the main stem were taken, the petals were peeled off, observed under a stereoscope (LEICA S8APO) and photographed (LEICA DFC420), and the area of the petals was measured with Image J software and statistically analyzed with EXCEL.

The photographing results are shown in fig. 3B, and the statistical results are shown in fig. 3F, which shows that the petal area of T1 generation SOD3 transgenic arabidopsis thaliana is significantly increased compared to wild type arabidopsis thaliana.

The results of the wild type arabidopsis and the T1 generation empty vector arabidopsis have no significant difference.

3. Width of silique

After 50 days of sowing, the silique width was measured as follows: the 4 th to 6 th siliques on the main stem were taken, observed under a body mirror and photographed, the width of the siliques was measured with Image J software, and statistical analysis was performed with EXCEL.

The photographing results are shown in fig. 3C, and the statistical results are shown in fig. 3G, and it can be seen that the silique width of T1 generation SOD3 transgenic arabidopsis thaliana was significantly increased compared to wild type arabidopsis thaliana.

The results of the wild type arabidopsis and the T1 generation empty vector arabidopsis have no significant difference.

4. Area of seed

After 70 days of sowing, the area of the seeds was measured as follows: seeds of the 4 th to 10 th siliques on the main stem were harvested, photographed under a body mirror after 1 month at room temperature, the area of the seeds was measured with Image J software, and statistically analyzed with EXCEL.

As shown in fig. 3D and the statistical result in fig. 3H, the seed area of T1 generation SOD3 transgenic arabidopsis thaliana was significantly increased compared to wild arabidopsis thaliana.

The results of the wild type arabidopsis and the T1 generation empty vector arabidopsis have no significant difference.

5. Weight of seed

After 70 days of sowing, the seed weight was measured as follows: 100 seeds from T1 plants were accurately counted and the seed weight was measured on a balance (METTLER TOLEDO AL104) for 4 replicates.

As shown in fig. 3I, the weight of the seeds of T1 generation transformed into SOD3 arabidopsis was significantly increased compared to wild arabidopsis.

The results of the wild type arabidopsis and the T1 generation empty vector arabidopsis have no significant difference.

Claims (2)

1. The protein, DNA molecules encoding the protein or recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the DNA molecules are applied to the regulation and control of the plant biological yield and/or the organ size;

the protein is shown as a sequence 1 in a sequence table;

the plant is Arabidopsis thaliana;

the organ corpuscles now have a leaf area, petal area, silique width and/or seed area;

the biological yield is expressed in terms of the weight of hundred seeds.

2. A method for cultivating transgenic plant with high biological yield and/or organ enlargement includes introducing DNA molecule for coding protein into target plant to obtain transgenic plant,

the protein is shown as a sequence 1 in a sequence table;

the biological yield and/or organ size of the transgenic plant is higher than that of the target plant;

the plant is Arabidopsis thaliana;

the organ corpuscles now have a leaf area, petal area, silique width and/or seed area;

the biological yield is expressed in terms of the weight of hundred seeds.

Images