CN106908600B - One kind being used for the kit of detection system lupus erythematosus (SLE) - Google Patents
One kind being used for the kit of detection system lupus erythematosus (SLE) Download PDFInfo
- Publication number
- CN106908600B CN106908600B CN201710167336.0A CN201710167336A CN106908600B CN 106908600 B CN106908600 B CN 106908600B CN 201710167336 A CN201710167336 A CN 201710167336A CN 106908600 B CN106908600 B CN 106908600B
- Authority
- CN
- China
- Prior art keywords
- sle
- ser6
- serpina6
- kit
- lupus erythematosus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/564—Immunoassay; Biospecific binding assay; Materials therefor for pre-existing immune complex or autoimmune disease, i.e. systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, rheumatoid factors or complement components C1-C9
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/10—Musculoskeletal or connective tissue disorders
- G01N2800/101—Diffuse connective tissue disease, e.g. Sjögren, Wegener's granulomatosis
- G01N2800/104—Lupus erythematosus [SLE]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Hematology (AREA)
- Engineering & Computer Science (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Rehabilitation Therapy (AREA)
- Biotechnology (AREA)
- Rheumatology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention discloses a kind of kit for being used for detection system lupus erythematosus (SLE), the aptamer containing energy specific detection systemic loupus erythematosus (SLE), the aptamer can specifically bind SERPINA6.Kit of the invention can be used in the expression quantity of quantitative detection SERPINA6 albumen, so as to be used for accurate detection system Erythematosus Disease.
Description
Technical field
The present invention relates to a kind of kits for being used for detection system lupus erythematosus (SLE).
Background technique
Systemic loupus erythematosus (SLE) is the inflammatory disorderly of the autoimmunity cause of disease (auto immune etiology)
Disorderly, it occurs mainly in young woman.SLE can influence many body organ systems, including kidney, skin, joint, nerveous system
System, serous coat, haemocyte and vascular.Although not knowing the specific inducement of SLE, many factors are related with the development of disease, including
Gene, race, hormone and environmental factor.
The presence of multiple types antinuclear antibodies is the important serology feature for suffering from SLE, so the quick diagnosis master of SLE at present
If being observed according to autoantibodies inspection in conjunction with clinical manifestation.Wherein sensibility of the antinuclear antibodies (ANA) to SLE
It is 95%, specificity is about 65%, is current optimal SLE state of an illness screening index, is such as repeatedly negative, then that suffers from SLE can
Energy property is little；Anti-dsDNA antibody (dsDNA) is up to 95% to the specificity of SLE, and sensibility is about 70%, to make a definite diagnosis SLE and
Judge that Lupus activity has biggish reference value；Anti-Sm antibody is up to 99% to the specificity of SLE, but sensibility is only
25%, it can also be positive when SLE is inactive, therefore mostly as the important basis of retrospective diagnosis；Furthermore anti-ssDNA antibody
(ss-DNA) it also can be used as one of SLE diagnosis index.To the detection of four kinds of indexs described above in clinic blood examination at present, mainly
Using radioimmunoassay (RIA), although it is with preferable sensitivity, specificity and stability, detection process is more
It is loaded down with trivial details, it is inconvenient, and can only also analyze a kind of index every time, last it is longer, provided amount of diagnostic information it is limited without
Comprehensively, many deficiencies are that clinical diagnosis and treatment bring inconvenience.
A kind of examination of high mannose type N sugar chain level in specific detection serum antibody is disclosed in 104655852 A of CN
Agent is in preparation for the application in the diagnosis of systemic loupus erythematosus and/or the diagnostic tool of prognosis evaluation.The serum antibody
The generation of middle high mannose type N sugar chain level increased with systemic loupus erythematosus is closely related, can be used for systemic red yabbi
The early diagnosis of sore and/or prognosis evaluation, and then the treatment for instructing systemic loupus erythematosus.But this method is in mouse layer
Whether the experiment carried out on face can have corresponding identification result that can not be expected in human body.
105229470 A of CN discloses for diagnosing, the method and examination of prognosis and systemic lupus erythematosus (SLE)
Agent is related to according to red blood cell C4d (EC4d) marker, B cell C4d (BC4d) marker, antinuclear antibodies (ANA).This method
Involved in numerous marker detection types it is more, and detect it is inconvenient.
Currently, the most arduous challenge of the autoimmune disease (such as SLE) of clinical treatment complexity first is that the disease of patient
The accurate and Early Identification of disease.In addition, do not identify send as an envoy to clinician or other people can accurately determine SLE pathology it is raw
Manage performance, clinical event, to the response for the treatment of or the reliability diagnostic flag of prognosis.
Summary of the invention
A kind of construction method of the stage protein expression difference spectrum model for systemic lupus erythematosus of non-diagnostic purpose, packet
Include following steps: the peripheral blood mononuclear cells sample of acquisition system patients with SLE group, healthy control group respectively；Respectively
Total protein of cell extracting and determination of protein concentration are carried out to each peripheral blood mononuclear cells sample；By the total protein of cell
It after protease digestion, is marked with opposite and absolute quantitation equivalent dystopy label, it is different to obtain opposite and absolute quantitation equivalent
The polypeptide of position label multiple labelling；The polypeptide is separated through strong cation exchange and reversed-phase liquid chromatography, then carries out series connection matter
Spectrum identification and relative quantitative assay, obtain the stage protein expression difference spectrum model for systemic lupus erythematosus, pass through table
Type identification, final analysis have been obtained the two albumen of SERPINA6 and C4BPA, have been expressed using the albumen as biomarker it
Amount carries out detecting the early diagnosis that can be used for instructing in SLE patient.
Invention additionally provides the markers that SERPINA6 and C4BPA the two albumen are used to prepare SLE patient's diagnosis.
In addition, the present invention has carried out quantitative detection to expression of the SERPINA6 in lupus erythematosus patients blood.
Still further aspect, the present invention provides the aptamer of a species specific identification SERPINA6, sequence such as SEQ
Shown in ID NO:1-12.
Still further aspect, the present invention provide a kind of kit, for specificity diagnostic system lupus erythematosus, it includes
The sequence as shown in SEQ ID NO:1-12.
Still further aspect, the aptamer coupling have magnetic bead and selection markers.
The utility model has the advantages that the present invention is screened by differential protein, the experimental results showed that SERPINA6 is in systemic loupus erythematosus
There is obvious up-regulated expression, can be used as systemic loupus erythematosus disease clinical diagnosis marker.And the present invention passes through specificity
Screening obtain SERPINA6 protein-specific combination aptamer, can be used in the expression of quantitative detection SERPINA6 albumen
Amount, so as to be used for accurate detection system Erythematosus Disease.
Detailed description of the invention
Fig. 1 is the statistical analysis figure of the concentration of SERPINA6 in blood samples of patients and healthy control group blood.
Fig. 2 is the specificity and sensitivity that ROC curve shows protein diagnostic systemic loupus erythematosus.
Specific embodiment
It elaborates with reference to the accompanying drawing to specific embodiment provided by the invention.
Embodiment 1
The peripheral blood mononuclear cells sample of difference acquisition system patients with SLE 20, healthy control group 20；
Total protein of cell extracting and determination of protein concentration are carried out to each peripheral blood mononuclear cells sample respectively；The cell is total
Albumen is marked after protease digestion with opposite and absolute quantitation equivalent dystopy label, is obtained opposite and absolute quantitation etc.
Measure the polypeptide of dystopy label multiple labelling；The polypeptide is separated through strong cation exchange and reversed-phase liquid chromatography, then is gone here and there
Join Mass Spectrometric Identification and relative quantitative assay, obtain the stage protein expression difference spectrum model for systemic lupus erythematosus, leads to
Phenotypic evaluation is crossed, final analysis has obtained the two albumen of SERPINA6 and C4BPA, and differential expression is significant, can be used as biology
Marker carries out its expression quantity to detect the early diagnosis that can be used for instructing in SLE patient.
In addition it measures SERPINA6 concentration in patients serum and is apparently higher than control group serum (P < 0.05), referring to Fig. 1.
In addition, the cut-off value that ROC curve sets SERPINA6 according to fig. 2 is 100.3ng/ml, AUC reaches
0.9801, sensibility and specificity is all larger than 93%, positive rate 95.4%.Statistic analysis result is shown, in blood
SERPINA6 concentration and systemic loupus erythematosus are closely related, in summary experimental study, it can be deduced that conclusion, SERPINA6 exist
Hypersecretion in Patients with SLE can be used as the particularly preferred mark that SERPINA6 and normal population are distinguished
Object.
The acquisition of 2 aptamer of embodiment
Using SELEX technology, screening has obtained the aptamer of specific binding SERPINA6 albumen, the following library of sequence
For
TACGTAGAATGACTCGTGAG(N)35CAGTACGATGGATGCAGTGA
SER6-1:
TACGTAGAATGACTCGTGAGATAATCACCTTCCCTCACATTACAAATACATTCATCAGTACGATGGATG
CAGTGA
SER6-2:
TACGTAGAATGACTCGTGAGTATTCCAAACAAAAACCTCTCCACATACCTTTTTACAGTACGATGGATG
CAGTGA
SER6-3:
TACGTAGAATGACTCGTGAGCTAAAAAATTTCCTCCCACCCCCAATTCAACTTAACAGTACGATGGATG
CAGTGA
SER6-4:
TACGTAGAATGACTCGTGAGCTTATAAAAATCCAACCCCTACACTACATCACACTCAGTACGATGGATG
CAGTGA
SER6-5:
TACGTAGAATGACTCGTGAGTATATCAAATACCCAACTCCTCCCAATCTACATCCCAGTACGATGGATG
CAGTGA
SER6-6:
TACGTAGAATGACTCGTGAGCATCCCTACTCAATTAATACTAATACCATAATACTCAGTACGATGGATG
CAGTGA
SER6-7:
TACGTAGAATGACTCGTGAGTCCTATATACTACCTCTACAAATTCCACTTCATACCAGTACGATGGATG
CAGTGA
SER6-8:
TACGTAGAATGACTCGTGAGTTCCCATATACATCCCCAACATCTACCTACCCAAACAGTACGATGGATG
CAGTGA
SER6-9:
TACGTAGAATGACTCGTGAGCATACTTCATAATCTTTTCTCCCTCATTTCCATATCAGTACGATGGATG
CAGTGA
SER6-10:
TACGTAGAATGACTCGTGAGAATCTTAAATCCAAAATTACCCCATCTATCCTCCA
CAGTACGATGGATGCAGTGA
SER6-11:
TACGTAGAATGACTCGTGAGCCCTACTTATTCTCATCATCACTCCACCCTACCCTCAGTACGATGGATG
CAGTGA
SER6-12:
TACGTAGAATGACTCGTGAGCACTTACATTACCACAATCTCATTTTATACCATTACAGTACGATGGATG
CAGTGA
The performance measurement of 3 protein binding aptamer of embodiment
There is the characteristic of absorption single stranded DNA based on graphene oxide oxidation, construct oligonucleotide aptamer compatibility and test
Card method.By the SERPINA6 protein target (1 μ Μ) of fixed concentration respectively with a series of corresponding various concentrations (10,25,
50,75,100,150,200u Μ) candidate oligonucleotide aptamer be incubated for, total volume 300uL, 37 DEG C are protected from light incubation
2h, and replace target as negative control group using BB buffer.After hatching combination be added optimum amount ratio GO absorption not with target
The aptamer combined is marked, 520nm transmitting under exciting after centrifugally operated using F-7000 fluorescent spectrophotometer measuring supernatant 490nm
Fluorescence intensity, experimental setup repeat in parallel three times, and experiment uses and is protected from light processing.It is strong with respect to the fluorescence of negative control group with experimental group
Degree is used as ordinate, using aptamer concentration as abscissa, carries out nonlinear regression using 5.0 software of GraphPad Prism
The dissociation constant Kd value of the Fitting Calculation aptamer.As a result as follows:
| Title | Dissociation constant Kd (unit nM) |
| SER6-1 | 23.5 |
| SER6-2 | 24.6 |
| SER6-3 | 25.7 |
| SER6-4 | 30.2 |
| SER6-5 | 25.6 |
| SER6-6 | 26.4 |
| SER6-7 | 25.7 |
| SER6-8 | 28.7 |
| SER6-9 | 30.2 |
| SER6-10 | 31.5 |
| SER6-11 | 29.8 |
| SER6-12 | 27.4 |
| BB buffer blank | Without binding ability |
In addition, aptamer provided by the invention has preferable knot by being in contact with the albumen of human bodies other in serum
Specificity and stability are closed, while also there are preferable biological characteristics without any hemolytic.
The diagnosis of aptamer disease described in embodiment 4
12 aptamers are detected with 10 Patients with SLE patients respectively.
10 blood serum samples are added in ELISA Plate hole and compare healthy sample coating, and is added and passes through biotin labeling
Aptamer 12, be added HRP label streptavidin, 37 DEG C be incubated for 1.5 hours；PBS wash three times afterwards be added TMB shown
Color 5 minutes；Microplate reader is read after 2M sulfuric acid terminates reaction；It is detected, it is as a result shown, compared with healthy volunteer, systematicness
The 0D450 of SERPINA6 albumen is significantly raised (p=0.0035) in patients with SLE serum.By standard curve, calculate
It obtains, SERPINA6 protein concentration is all larger than 100.3ng/ml in serum, and the SERPINA6 protein concentration of normal population is remote
Much smaller than 100ng/ml, as a result prove that 12 aptamers have application prospect in systemic lupus erythematosus diagnosis.
These are only the preferred embodiment of the present invention, is not intended to restrict the invention, for those skilled in the art
For member, any modification, equivalent substitution, improvement and etc. done all within the spirits and principles of the present invention should be included in this
Within the protection scope of invention.
Sequence table
110 Shen the > winter of < is prosperous
120 > one kind of < is used for the kit of detection system lupus erythematosus (SLE)
〈160〉12
〈210〉1
〈211〉75
〈212〉DNA
213 > artificial sequence of <
〈400〉SER6-1
TACGTAGAATGACTCGTGAGATAATCACCTTCCCTCACATTACAAATACATTCATCAGTACGATGGATGCAGTGA
〈210〉2
〈211〉75
〈212〉DNA
213 > artificial sequence of <
〈400〉SER6-2
TACGTAGAATGACTCGTGAGTATTCCAAACAAAAACCTCTCCACATACCTTTTTACAGTACGATGGATGCAGTGA
〈210〉3
〈211〉75
〈212〉DNA
213 > artificial sequence of <
〈400〉SER6-3
TACGTAGAATGACTCGTGAGCTAAAAAATTTCCTCCCACCCCCAATTCAACTTAACAGTACGATGGATGCAGTGA
〈210〉4
〈211〉75
〈212〉DNA
213 > artificial sequence of <
〈400〉SER6-4
TACGTAGAATGACTCGTGAGCTTATAAAAATCCAACCCCTACACTACATCACACTCAGTACGATGGATGCAGTGA
〈210〉5
〈211〉75
〈212〉DNA
213 > artificial sequence of <
〈400〉SER6-5
TACGTAGAATGACTCGTGAGTATATCAAATACCCAACTCCTCCCAATCTACATCCCAGTACGATGGATGCAGTGA
〈210〉6
〈211〉75
〈212〉DNA
213 > artificial sequence of <
〈400〉SER6-6
TACGTAGAATGACTCGTGAGCATCCCTACTCAATTAATACTAATACCATAATACTCAGTACGATGGATGCAGTGA
〈210〉7
〈211〉75
〈212〉DNA
213 > artificial sequence of <
〈400〉SER6-7
TACGTAGAATGACTCGTGAGTCCTATATACTACCTCTACAAATTCCACTTCATACCAGTACGATGGATGCAGTGA
〈210〉8
〈211〉75
〈212〉DNA
213 > artificial sequence of <
〈400〉SER6-8
TACGTAGAATGACTCGTGAGTTCCCATATACATCCCCAACATCTACCTACCCAAACAGTACGATGGATGCAGTGA
〈210〉9
〈211〉75
〈212〉DNA
213 > artificial sequence of <
〈400〉SER6-9
TACGTAGAATGACTCGTGAGCATACTTCATAATCTTTTCTCCCTCATTTCCATATCAGTACGATGGATGCAGTGA
〈210〉10
〈211〉75
〈212〉DNA
213 > artificial sequence of <
〈400〉SER6-10
TACGTAGAATGACTCGTGAGAATCTTAAATCCAAAATTACCCCATCTATCCTCCACAGTACGATGGATGCAGTGA
〈210〉11
〈211〉75
〈212〉DNA
213 > artificial sequence of <
〈400〉SER6-11
TACGTAGAATGACTCGTGAGCCCTACTTATTCTCATCATCACTCCACCCTACCCTCAGTACGATGGATGCAGTGA
〈210〉12
〈211〉75
〈212〉DNA
213 > artificial sequence of <
〈400〉SER6-12
TACGTAGAATGACTCGTGAGCACTTACATTACCACAATCTCATTTTATACCATTACAGTACGATGGATGCAGTGA
Claims (1)
1. sequence as SEQ ID NO:1-12 it is any shown in aptamer preparing for detection system lupus erythematosus (SLE)
The application of kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710167336.0A CN106908600B (en) | 2017-03-20 | 2017-03-20 | One kind being used for the kit of detection system lupus erythematosus (SLE) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710167336.0A CN106908600B (en) | 2017-03-20 | 2017-03-20 | One kind being used for the kit of detection system lupus erythematosus (SLE) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106908600A CN106908600A (en) | 2017-06-30 |
| CN106908600B true CN106908600B (en) | 2019-02-15 |
Family
ID=59194460
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710167336.0A Expired - Fee Related CN106908600B (en) | 2017-03-20 | 2017-03-20 | One kind being used for the kit of detection system lupus erythematosus (SLE) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106908600B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105467118B (en) * | 2015-08-30 | 2017-07-04 | 南通大学附属医院 | A kind of pancreatic tumour mark and its application process |
-
2017
- 2017-03-20 CN CN201710167336.0A patent/CN106908600B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN106908600A (en) | 2017-06-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6452718B2 (en) | Peptides, reagents and methods for detecting food allergies | |
| EP3063543B1 (en) | Competitive ligand binding assay for detecting neutralizing antibodies | |
| WO2021251504A1 (en) | Method for predicting development of severe covid-19 utilizing blood rna | |
| JP2022512890A (en) | Sample quality evaluation method | |
| WO2011143597A1 (en) | Methods and devices for diagnosing alzheimers disease | |
| CN110441438A (en) | A kind of Acute Pancreatitis in its severe degree prediction model and its detection method based on S100 protein family | |
| JP2018205327A (en) | Method and composition for diagnosing preeclampsia | |
| CN106680411B (en) | One kind being used for the kit and its detection method of detecting system lupus erythematosus (SLE) | |
| Chao et al. | Towards proteome standards: the use of absolute quantitation in high-throughput biomarker discovery | |
| CN110716050A (en) | Application of antigen combination in preparation of kit for detecting lung cancer related autoantibody, corresponding kit and detection method | |
| CN109725158A (en) | Application of the polypeptide SLE2018-V001 in diagnostic system lupus erythematosus kit | |
| CN113125753A (en) | Kit for detecting specific antibody of dust mite component | |
| CN110291037A (en) | For determining the composition and method of the infection level in object | |
| CN106908600B (en) | One kind being used for the kit of detection system lupus erythematosus (SLE) | |
| May et al. | Use of whole blood for analysis of disease-associated biomarkers | |
| CN113125757B (en) | Protein biomarker for early pregnancy diagnosis of sows and method for detecting early pregnancy of sows by using protein biomarker | |
| JP2017526931A (en) | Recovery of aspartyl (asparaginyl) beta hydroxylase (HAAH) from exosome fraction of human serum derived from cancer patients | |
| US10781488B1 (en) | Test kit for detecting concentration of cardiovascular disease-related biomarker and concentration detection method for detecting concentration of cardiovascular disease-related biomarker | |
| CN110716054A (en) | Quantitative detection kit for serum cytotropic immunoglobulin E | |
| CN109725156A (en) | Application of the polypeptide SLE2018-V002 in diagnostic system lupus erythematosus kit | |
| WO2019244163A1 (en) | Aptamer against m.tb mpt51 and uses thereof | |
| AU2021105747A4 (en) | Application of diagnostic kit and MAK16 in preparation of reagent for early diagnosis of systemic lupus erythematosus | |
| RU2702900C1 (en) | Method for quantitative determination of antibodies to benzo[a]pyrene in human biological fluids | |
| TWI741914B (en) | Test kit for detecting cardiovascular disease and method for detecting concentration of cardiovascular disease-related biomarker | |
| TWI741915B (en) | Test kit for detecting cardiovascular disease and method for detecting concentration of cardiovascular disease-related biomarker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20190102 Address after: 519090 Golden Coast Biomedical Park, Sanzao Town, Jinwan District, Zhuhai City, Guangdong Province Applicant after: Zhuhai Anda Bioengineering Co.,Ltd. Address before: 610041 Sichuan University, Sichuan, 17 three South Road, Chengdu. Applicant before: Shen Dongchang |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190215 |