CN106906296A - A kind of label of high frequency zone Wei Si Salmonellas and its application - Google Patents
A kind of label of high frequency zone Wei Si Salmonellas and its application Download PDFInfo
- Publication number
- CN106906296A CN106906296A CN201710216629.3A CN201710216629A CN106906296A CN 106906296 A CN106906296 A CN 106906296A CN 201710216629 A CN201710216629 A CN 201710216629A CN 106906296 A CN106906296 A CN 106906296A
- Authority
- CN
- China
- Prior art keywords
- wei
- salmonellas
- primer
- bacterial strain
- sense primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Label and its application the invention discloses a kind of high frequency zone Wei Si Salmonellas, belong to technical field of microbial fermentation.The invention provides a kind of label of Wei Si Salmonellas, its sequence is as shown in SEQ ID NO.1.Whether there is as screening conditions, the method for high frequency zone Wei Si Salmonellas present invention also offers using the label.The screening cycle of the method is less than 36h, separates, identifies accuracy close to 100%, and the method quickly and efficiently, is capable of achieving high-throughput batch treatment, greatly reduces workload without cumbersome steps such as microscopy, extraction genomes, reduces cost.
Description
Technical field
Label and its application the present invention relates to a kind of high frequency zone Wei Si Salmonellas, belong to microbial fermentation technology neck
Domain.
Background technology
Wei Si Salmonellas are gram-positive bacterias, belong to amphimicrobian, are grown rapidly under aerobic conditions.Do not possess cell color
Element, negative catalase.D- and/or Pfansteihl can be produced by phosphopentose and phosphoketolase approach heterofermentation glucose
Institute, heterofermentation glucose also produces CO2, ethanol and (or) acetic acid.Wei Si Salmonellas can grow at 15 DEG C, general optimum growth temperature
At 30-37 DEG C, some bacterial strains can grow at 42~45 DEG C.Most of Wei Si Salmonellas derive from nutritious food, and food comes
The Wei Si Salmonellas fermentation lactic acid producing in source, acetic acid, ethanol can increase local flavor and the nutrition of fermented food, wherein bacteriocinogeny
W.cibaria is applied to food, can play corrosion-resistant effect；W.confusa synthesis glucan, levulan, can be effectively facilitated
Internal beneficial bacteria growing, suppresses corrupt bacteria growing；W.koreensis bacterial strains pass through synthetic cellulose in pickles, with anti-obesity
Effect.
Separating the technology of identification Wei Si Salmonellas at present has by colony morphology characteristic observation, Gram's staining mirror mirror, contact
The physiological and biochemical tests pair such as enzyme test, methyl red test, V-P experiments, gelatin liquefaction test, indole test, Starch Hydrolysis experiment
Bacterial strain carries out separation identification；Whether grown under 4%NaCl, 6.5%NaCl by sugar fermentating test, bacterial strain, bacterial strain is in temperature
Whether it is the experiment grown at 10,40,45 DEG C, tentatively carries out Wei Si Salmonella species identifications.But the screening cycle generally needs one
All left and right, and the parameter that need to be determined is more, complex steps, workload are big.Using physiological and biochemical index separation screening identification Wei Si Shi
Bacterium, accuracy is not high, and the 16S rDNA sequences that need to further expand bacterial strain are verified.
The content of the invention
First purpose of the invention is to provide a kind of label of Wei Si Salmonellas, and its sequence is as shown in SEQ ID NO.1.
Second object of the present invention is to provide a kind of method of screening Wei Si Salmonellas, the sequence according to SEQ ID NO.1
Row design primer, bacterium colony PCR is carried out to microorganism to be screened, then PCR primer is carried out into the electrophoretic analysis of gel nucleic acid and/or survey
Sequence verifies that amplification is obtained and SEQ ID NO, the bacterial strain of the nucleotide sequence of the presence of sequence shown in 1 >=75bp consecutive identical, or energy
Enough amplify the bacterial strain of the bacterial strain as Wei Si Shi category that clip size is 120~180bp.
In one embodiment of the invention, the primer sequence includes that (1)~(5) are any right, wherein,
(1) sense primer：GCTCTGAAGTGATTTTATCTGACA, anti-sense primer：AACCATGCGGTTGTTGGTA；
(2) sense primer：GGCGGATTGGTCTCTTTTTG, anti-sense primer：CACGCTCAGTAACCGTGTGC；
(3) sense primer：GCATCCGTCAGTTCATCAC；Anti-sense primer：GATTACGCACTTACCACAGG；
(4) sense primer：CGCAAACACAACAAGCCTAT；Anti-sense primer：TGTTGAGCAAGTTCCAAAGC；
(5) sense primer：GCTCTGAAGTGATTTTATCTGAC；Anti-sense primer：AACCATGCGGTTGTTGGTA.
In one embodiment of the invention, the PCR is carried out according to following procedure：94 DEG C of 30s, 94 DEG C
3min, 55 DEG C of 30s, 72 DEG C of 1min, 72 DEG C of 10min, 12 DEG C of holdings, period 32.
In one embodiment of the invention, using sense primer：Draw in GCTCTGAAGTGATTTTATCTGACA, downstream
Thing：AACCATGCGGTTGTTGGTA amplifications obtain the bacterial strain as Wei Si Shi category that clip size is 120~180bp
(Weissella) microorganism.
In one embodiment of the invention, using sense primer：GGCGGATTGGTCTCTTTTTG, anti-sense primer：
CACGCTCAGTAACCGTGTGC amplifications obtain the bacterial strain that clip size is 120~180bp and are fusion Wei Si Salmonellas
(Weissella confusa)。
In one embodiment of the invention, using sense primer：GCATCCGTCAGTTCATCAC；Anti-sense primer：
GATTACGCACTTACCACAGG amplifications obtain the bacterial strain as Dou Shi Wei Si Salmonellas that clip size is 120~180bp
(Weissella cibaria)。
In one embodiment of the invention, using sense primer：CGCAAACACAACAAGCCTAT；Anti-sense primer：
TGTTGAGCAAGTTCCAAAGC amplifications obtain the bacterial strain that clip size is 120~180bp and are green Wei Si Salmonellas
(Weissella viridescens)。
In one embodiment of the invention, using sense primer：GCTCTGAAGTGATTTTATCTGAC；Draw in downstream
Thing：AACCATGCGGTTGTTGGTA amplifications obtain the bacterial strain as class goldbeater's skin Wei Si Salmonellas that clip size is 120~180bp
(Weissella paramesenteroides)。
In one embodiment of the invention, methods described is in the selection containing vancomycin by Mixed Microbes to be separated
Property culture medium on cultivate, obtain single bacterium colony, then carry out bacterium colony PCR.
In one embodiment of the invention, the content of the vancomycin is 2.0~3.0g/L.
In one embodiment of the invention, the selective medium contains：8.0~12.0g/L of peptone, beef
4.0~6.0g/L of powder, 3.0~5.0g/L of dusty yeast, 20.0~30.0g/L of glucose, 1.0~2.0mL/L of Tween 80, phosphoric acid
2.0~3.0g/L of hydrogen dipotassium, 4.0~6.0g/L of sodium acetate, 2.0~3.0g/L of Triammonium citrate, 0.2~0.5g/L of magnesium sulfate,
0.05~0.1g/L of manganese sulfate, 0.5~1g/L of Cys, 1.0~1.5g/L of Natamycin, 2.0~3.0g/ of vancomycin
L, initial pH are 7.0~7.2.
In one embodiment of the invention, the selective medium contains：Peptone 10.0g/L, powdered beef
5.0g/L, dusty yeast 4.0g/L, glucose 20.0g/L, Tween 80 1.0mL/L, dipotassium hydrogen phosphate 2.0g/L, sodium acetate 5.0g/
L, Triammonium citrate 2.0g/L, magnesium sulfate 0.2g/L, manganese sulfate 0.05g/L, Cys 0.5g/L, Natamycin 1.0g/
L, vancomycin 2.0g/L, initial pH are 7.0~7.2.
In one embodiment of the invention, the Wei Si Salmonellas are the bacterial strain of Wei Si Shi category, including but not limited to class
Goldbeater's skin Wei Si Salmonellas, fusion Wei Si Salmonellas, Dou Shi Wei Si Salmonellas, green Wei Si Salmonellas, small Wei Si Salmonellas, He Lun Weis Si Shi
Bacterium, Kan Shi Wei Si Salmonellas, soil Wei Si Salmonellas.
In one embodiment of the invention, the culture is carried out by operations described below：By sample inoculation to be separated
To selective medium, 12~24h of enrichment culture is stood at 37 DEG C, above-mentioned nutrient solution dilution spread to solid is selectively cultivated
Base, 37 DEG C of 24~36h of culture.
In one embodiment of the invention, methods described is comprised the following steps that：
1) by sample inoculation in selective medium, it is placed in culture 24h in 37 DEG C of constant incubators and obtains nutrient solution, it is described
Selective medium formula is as follows：Peptone 10.0g/L, powdered beef 5.0g/L, dusty yeast 4.0g/L, glucose 20.0g/L, tell
80 1.0mL/L of temperature, dipotassium hydrogen phosphate 2.0g/L, sodium acetate 5.0g/L, Triammonium citrate 2.0g/L, magnesium sulfate 0.2g/L, sulfuric acid
Manganese 0.05g/L, Cys 0.5g/L, Natamycin 1.0g/L, vancomycin 20g/L, it is 7.0 to adjust initial pH,；
2) by above-mentioned nutrient solution dilution spread to solid selective medium, 37 DEG C of culture 36h；Described solid selectivity
Selective medium described in the step of culture medium is agar containing 20g/L (1)；
3) according to SEQ ID NO.1 design primer, selecting step 2) obtain single bacterium colony carry out specific primer bacterium colony
PCR, PCR primer is imaged with the agarose gel electrophoresis of 2% concentration, can obtain the bacterial strain of the band that size is 100~200bp
It is Wei Si Salmonellas.
The present invention also provides a kind of Wei Si Salmonellas selective medium, and the culture medium prescription is as follows：Peptone 10.0g/
L, powdered beef 5.0g/L, dusty yeast 4.0g/L, glucose 20.0g/L, Tween 80 1.0mL/L, dipotassium hydrogen phosphate 2.0g/L, second
Sour sodium 5.0g/L, Triammonium citrate 2.0g/L, magnesium sulfate 0.2g/L, manganese sulfate 0.05g/L, Cys 0.5g/L, he
It is 7.0 that mycin 1.0g/L, vancomycin 2g/L, agar 20g/L adjust initial pH.
The present invention also provides application of the label in terms of food, biology, field of medicaments identification Wei Si Salmonellas.
The present invention also provides application of the screening technique in high flux field.
Beneficial effect：The present invention carries out bacterium colony PCR to reach efficiently and accurately screening Wei Si Salmonellas by specific marker thing
Purpose, compared to traditional colonial morphology and physiological property screening, selective medium screening, 16S rDNA amplification, more
Efficiently and accurately, the cycle of screening process is less than 36h, separates, identifies accuracy close to 100%, and the method is without microscopy, extraction base
Because of cumbersome steps such as groups, quickly and efficiently, high-throughput batch treatment is capable of achieving, greatly reduces workload, reduce cost.
Brief description of the drawings
Fig. 1 is the gel electrophoresis figure of label specificity verification；M:500bp DNA maker；A, merges Wei Si Salmonellas
(W.confusa) the label band after expanding；Label band after B, Dou Shi Wei Si Salmonellas (W.cibaria) amplifications；C,
Label band after green Wei Si Salmonellas (W.viridescens) amplification；D, class goldbeater's skin Wei Si Salmonellas
(W.paramesenteroides) the label band after expanding；1, positive control；Blank, negative control.
Fig. 2 is the gel electrophoresis figure of label specificity verification in mixed thalline system；M:500bp DNA maker；Numeral is
Strain number；
Fig. 3 is the primer amplification gained gel electrophoresis figure of bacterial strain sequence number 1；M:500bp DNA maker；Numeral is bacterial strain
Numbering；
Fig. 4 is the primer amplification gained gel electrophoresis figure of bacterial strain sequence number 2；M:500bp DNA maker；Numeral is bacterial strain
Numbering；
Fig. 5 is the primer amplification gained gel electrophoresis figure of bacterial strain sequence number 3；M:500bp DNA maker；Numeral is bacterial strain
Numbering；
Fig. 6 is that the primer of bacterial strain label 4 expands gained gel electrophoresis figure；M:500bp DNA maker；Numeral is bacterial strain
Numbering；
Fig. 7 is the gel electrophoresis figure of Wei Si Salmonellas in moromi；M:500bp DNA maker；Numeral is strain number；
Fig. 8 is the gel electrophoresis figure of Wei Si Salmonellas in fermented grain；M:500bp DNA maker；Numeral is strain number；It is empty
In vain, it is negative control；
Fig. 9 is the gel electrophoresis figure of Wei Si Salmonellas in soil；M:500bp DNA maker；Numeral is strain number；It is empty
In vain, it is negative control.
Specific embodiment
Below in conjunction with specific example, the present invention is described in further detail.
Selective medium：Peptone 10.0g/L, powdered beef 5.0g/L, dusty yeast 4.0g/L, glucose 20.0g/L, tell
80 1.0mL/L of temperature, dipotassium hydrogen phosphate 2.0g/L, sodium acetate 5.0g/L, Triammonium citrate 2.0g/L, magnesium sulfate 0.2g/L, sulfuric acid
Manganese 0.05g/L, Cys 0.5g/L, vancomycin 20g/L, (the vancomycin addition time is to go out for 7.0 to adjust initial pH
When bacterium wild Oryza species temperature is cooled to 60~70 DEG C).
Solid selective medium：Peptone 10.0g/L, powdered beef 5.0g/L, dusty yeast 4.0g/L, glucose 20.0g/
L, Tween 80 1.0mL/L, dipotassium hydrogen phosphate 2.0g/L, sodium acetate 5.0g/L, Triammonium citrate 2.0g/L, magnesium sulfate 0.2g/L,
Manganese sulfate 0.05g/L, Cys 0.5g/L, Natamycin 1.0g/L, vancomycin 2g/L, agar 20g/L regulation are initial
PH is 7.0 (when the vancomycin addition time is that sterilizing wild Oryza species temperature is cooled to 60~70 DEG C).
Embodiment 1
(1) will fusion Wei Si Salmonellas (W.confusa), Dou Shi Wei Si Salmonellas (W.cibaria), green Wei Si Salmonellas
(W.viridescens), class goldbeater's skin Wei Si Salmonellas (W.paramesenteroides) are inoculated in MRS culture mediums respectively, at 37 DEG C
Quiescent culture 24h obtains bacterium solution, and the genome (number consecutively is A, B, C, D) of above-mentioned bacterial strains is extracted using kit.
(2) sequence according to SEQ ID NO.1 carries out design of primers, sense primer
GCTCTGAAGTGATTTTATCTGACA, anti-sense primer AACCATGCGGTTGTTGGTA, use the primer designed with label to enter
Performing PCR amplification (94 DEG C of 30s, 94 DEG C of 3min, 55 DEG C of 30s, 72 DEG C of 1min, 72 DEG C of 10min, 12 DEG C of holdings, period 32), with nothing
Bacterium water is negative control, using the grand genome of fermented grain as positive control, as a result as shown in Figure 1.Amplify size about 140bp's
Purpose fragment.
(3) performing PCR is directly entered using the bacterium solution after step (1) culture, primer is identical with step (2).Result shows, can
Amplify the purpose fragment of the formed objects gone out with genome amplification.
Embodiment 2
(1) bacillus amyloliquefaciens, bacillus subtilis, thermophilic salt tetrads, Roy's Si lactobacillus are inoculated in respectively
MRS culture mediums, bacterium solution is obtained in 37 DEG C of quiescent culture 24h, and (number consecutively is to extract the genome of above-mentioned bacterial strains using kit
E、F、G、H).Enter performing PCR to the bacterium solution and E, F, G, H after culture respectively using the identical primer of embodiment 4 and amplification condition to expand
Increase, as a result show, purpose fragment is not amplified.
Embodiment 3
(1) will fusion Wei Si Salmonellas (W.confusa), Dou Shi Wei Si Salmonellas (W.cibaria), green Wei Si Salmonellas
(W.viridescens), class goldbeater's skin Wei Si Salmonellas (W.paramesenteroides), bacillus amyloliquefaciens, bacillus subtilis
Bacterium, thermophilic salt tetrads, Roy's Si lactobacillus are inoculated in MRS culture mediums respectively, and bacterium solution is obtained in 37 DEG C of quiescent culture 24h.Will
Above-mentioned bacterium solution mixing, gradient dilution simultaneously coats the selective medium of solid.The sequences Design according to SEQ ID NO.1 is drawn
Thing, primer sequence is GCTCTGAAGTGATTTTATCTGACA/AACCATGCGGTTGTTGGTA.Bacterium colony is carried out using the primer
PCR, totally 72 bacterium colonies, PCR results are shown in Fig. 2.
(2) thalline obtained using the primer pair step (1) shown in table 1 carries out colony PCR amplification with primer 1~4 respectively.
Electrophoretogram after being expanded with the primer of sequence number 1 is as shown in Figure 3.The bacterial strain of band will not be amplified in Fig. 3, using drawing for sequence number 2
Thing enters performing PCR amplification, as a result as shown in Figure 3.The bacterial strain that purpose band will not be amplified in Fig. 3 is expanded with the primer of sequence number 3
Increase, as a result as shown in Figure 5.The bacterial strain that band will not be amplified in Fig. 5 is expanded with the primer of sequence number 4, as a result such as Fig. 6 institutes
Show.
(3) successful band is expanded to step 2 to be sequenced, as a result shown, only expanded by the primer of sequence number 1 and obtain mesh
Fragment sequence such as SEQ ID NO, shown in 2, and SEQ ID NO, 1 is identical compared to the from the 16th to the 100th nucleotide sequence, right
The bacterial strain answered is fusion Wei Si Salmonellas；Only expanded by the primer of sequence number 2 and obtain purpose fragment sequence such as SEQ ID NO, 3 institutes
Show,；With SEQ ID NO, 1 is identical compared to the from the 24th to the 102nd nucleotide sequence, and corresponding bacterial strain is Dou Shi Wei Si Salmonellas；
Only expanded by the primer of sequence number 3 and obtain purpose fragment sequence such as SEQ ID NO, shown in 4, and SEQ ID NO, 1 compared to from the
18 to the 102nd nucleotide sequences are identical, and corresponding bacterial strain is green Wei Si Salmonellas；Only expanded by the primer of sequence number 4 and obtained
Purpose fragment sequence such as SEQ ID NO, shown in 5, with SEQ ID NO, 1 is identical compared to the from the 34th to the 110th nucleotide sequence,
Corresponding bacterial strain is class goldbeater's skin Wei Si Salmonellas.
The Wei Si Salmonella specific primer sequences of table 1
(4) randomly select the genome sequences of the bacterial strain not of the same race that the identification of 20 plants of steps 3 is obtained, and numbering be 1~
8th, 21,46,47 this several plants bacterial strains for not amplifying purpose fragment, 16S rDNA expansions are carried out using universal primer 1492R and 27F
Increase, the sequence after amplification is compared with Genbank databases, the qualification result of verification step (2).Result shows,
The qualification result of 16SrDNA is consistent with the qualification result of step 3, and numbering is that 1~8,21,46,47 bacterial strain is not Wei Si Shi
The bacterial strain of category.Illustrate that primer GCTCTGAAGTGATTTTATCTGACA/AACCATGCGGTTGTTGGTA can successfully distinguish Wei Si
The microorganism of family name's category, the specific primer of table 1 further can carry out Accurate classification to the bacterial strain that Wei Si Shi belongs to.
The screening of Wei Si Salmonellas in the moromi of embodiment 4
1. the enrichment culture of bacterial strain
Preparation weighs 10~20g moromis sample inoculation in 200mL selective mediums, is placed in 37 DEG C of constant incubators and trains
Support 24h and obtain nutrient solution.
2. the screening of bacterial strain
To solid selective medium, 37 DEG C are trained 36h to the nutrient solution dilution spread that step 1 is obtained.On picking culture medium
It is 1~72 that 100 single bacterium colonies are numbered respectively, and carrying out specific primer bacterium colony PCR, PCR program to this 72 bacterial strains is：94℃
30s, 94 DEG C of 3min, 55 DEG C of 30s, 72 DEG C of 1min, 72 DEG C of 10min, 12 DEG C of holdings, period 32 are (right as feminine gender with sterilized water
According to).PCR primer is imaged with the agarose gel electrophoresis of 2% concentration, can obtain the specific band that size is 120~160bp
Bacterial strain for needed for bacterial strain.Amplification shows, 63 plants of bacterial strains being consistent with band are obtained.As shown in fig. 7, it is big to obtain fragment
The band of small about 140bp, it is consistent with label clip size shown in SEQ ID NO.1.
3. the identification of Wei Si Salmonellas
By 73 consistent inoculations of the purpose fragment obtained in step 2 in selective medium, training is stood at 37 DEG C
Foster 24h obtains bacterium solution, and the postgenome for extracting each bacterial strain using kit carries out 16S rRNA amplifications, sequencing identification bacterial strain.Knot
Fruit display, is Wei Si Salmonellas, wherein Weissella paramesenteroides bacterial strains 24, Weissella confusa
Bacterial strain 21, Weissella cibaria bacterial strains 17, Weissella viridescens bacterial strains 11.
The screening of Wei Si Salmonellas in the fermented grain of embodiment 5
1. in fermented grain sample bacterial strain enrichment culture
Weigh 10~20g wine and train sample inoculation in 200mL selective mediums, be placed in 37 DEG C of constant incubators and cultivate
24h obtains nutrient solution.
2. in fermented grain sample bacterial strain screening
By above-mentioned nutrient solution dilution spread to solid selective medium, 37 DEG C of training 36h.100 lists on picking culture medium
It is 1~100 that bacterium colony is numbered respectively, and specific primer bacterium colony PCR is carried out to this 100 bacterial strains.The PCR primer fine jade of 2% concentration
Sepharose electrophoretic image, is obtained 65 plants of bacterial strains being consistent with band, and part electrophoretogram is as shown in Figure 8.
3. in fermented grain sample Wei Si Salmonellas identification
By 65 consistent inoculations of the purpose fragment obtained in step 2 in selective medium, training is stood at 37 DEG C
Foster 24h obtains bacterium solution, and the postgenome for extracting each bacterial strain using kit carries out 16S rRNA amplifications, sequencing identification bacterial strain.Knot
Fruit display, is Wei Si Salmonellas, wherein Weissella paramesenteroides bacterial strains 16, Weissella confusa
Bacterial strain 19, Weissella cibaria bacterial strains 20, Weissella viridescens bacterial strains 10.
The screening of Wei Si Salmonellas in the soil of embodiment 6
1. in pedotheque bacterial strain enrichment culture
Weigh 10~20g pedotheques and be inoculated in 200mL selective mediums, be placed in 37 DEG C of constant incubators and cultivate
24h obtains nutrient solution.
2. in pedotheque bacterial strain screening
By above-mentioned nutrient solution dilution spread to solid selective medium, 37 DEG C of training 36h.100 lists on picking culture medium
It is 1~100 that bacterium colony is numbered respectively, and specific primer bacterium colony PCR is carried out to this 100 bacterial strains.The PCR primer fine jade of 2% concentration
Sepharose electrophoretic image, is obtained 69 plants of bacterial strains being consistent with band, and part electrophoretogram is as shown in Figure 9.
3. in pedotheque Wei Si Salmonellas identification
By 69 consistent inoculations of the purpose fragment obtained in step 2 in selective medium, training is stood at 37 DEG C
Foster 24h obtains bacterium solution, and the postgenome for extracting each bacterial strain using kit carries out 16S rRNA amplifications, sequencing identification bacterial strain.Knot
Fruit display, is Wei Si Salmonellas, wherein Weissella paramesenteroides bacterial strains 18, Weissella confusa
Bacterial strain 15, Weissella cibaria bacterial strains 20, Weissella viridescens bacterial strains 16.
Although the present invention is disclosed as above with preferred embodiment, it is not limited to the present invention, any to be familiar with this skill
The people of art, without departing from the spirit and scope of the present invention, can do various changes with modification, therefore protection model of the invention
Enclose being defined of being defined by claims.
SEQUENCE LISTING
<110>Southern Yangtze University
<120>A kind of label of high frequency zone Wei Si Salmonellas and its application
<160> 15
<170> PatentIn version 3.3
<210> 1
<211> 140
<212> DNA
<213>Artificial sequence
<400> 1
atcgtgagct gcatcggaat ggacgaaatg ttatccggat taatgggact ttgctcaacg 60
caacagcgtt aaaagaagtg ggcaatcatt tggttgatat tcatgggcaa aatgagcacc 120
aagcgttaat gcaggttgat 140
<210> 2
<211> 141
<212> DNA
<213>Artificial sequence
<400> 2
ggcggattgg tctctttttg ggaatggacg aaatgttatc cggattaatg ggactttgct 60
caacgcaaca gcgttaaaag aagtgggcaa tcatttggtt gatattcatg ggcaaaatga 120
gcacgctcag taaccgtgtg c 141
<210> 3
<211> 118
<212> DNA
<213>Artificial sequence
<400> 3
gcatccgtca gttcatcaca tggacgaaat gttatccgga ttaatgggac tttgctcaac 60
gcaacagcgt taaaagaagt gggcaatcat ttggttgaga ttacgcactt accacagg 118
<210> 4
<211> 119
<212> DNA
<213>Artificial sequence
<400> 4
cgcaaacaca acaagcctat tcggaatgga cgaaatgtta tccggattaa tgggactttg 60
ctcaacgcaa cagcgttaaa agaagtgggc aatcatttgt gttgagcaag ttccaaagc 119
<210> 5
<211> 117
<212> DNA
<213>Artificial sequence
<400> 5
gctctgaagt gattttatct gactccggat taatgggact ttgctcaacg caacagcgtt 60
aaaagaagtg ggcaatcatt tggttgatat tcatgggcaa ccatgcggtt gttggta 117
<210> 6
<211> 24
<212> DNA
<213>Artificial sequence
<400> 6
gctctgaagt gattttatct gaca 24
<210> 7
<211> 19
<212> DNA
<213>Artificial sequence
<400> 7
aaccatgcgg ttgttggta 19
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence
<400> 8
ggcggattgg tctctttttg 20
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence
<400> 9
cacgctcagt aaccgtgtgc 20
<210> 10
<211> 19
<212> DNA
<213>Artificial sequence
<400> 10
gcatccgtca gttcatcac 19
<210> 11
<211> 20
<212> DNA
<213>Artificial sequence
<400> 11
gattacgcac ttaccacagg 20
<210> 12
<211> 20
<212> DNA
<213>Artificial sequence
<400> 12
cgcaaacaca acaagcctat 20
<210> 13
<211> 20
<212> DNA
<213>Artificial sequence
<400> 13
tgttgagcaa gttccaaagc 20
<210> 14
<211> 23
<212> DNA
<213>Artificial sequence
<400> 14
gctctgaagt gattttatct gac 23
<210> 15
<211> 19
<212> DNA
<213>Artificial sequence
<400> 15
aaccatgcgg ttgttggta 19
Claims (10)
1. a kind of method of screening Wei Si Salmonellas, it is characterised in that the primers according to SEQ ID NO.1, treats
The microorganism of screening carries out bacterium colony PCR, then PCR primer is carried out into the electrophoretic analysis of gel nucleic acid and/or sequence verification, and amplification is obtained
With SEQ ID NO, the bacterial strain of the presence of sequence shown in 1 >=consecutive identical nucleotides of 75bp is the bacterial strain of Wei Si Shi category.
2. a kind of method of screening Wei Si Salmonellas, it is characterised in that the primers according to SEQ ID NO.1, treats
The microorganism of screening carries out bacterium colony PCR, then PCR primer is carried out into gel nucleic acid electrophoretic analysis, and Successful amplification goes out clip size and is
The bacterial strain of 120~180bp is the bacterial strain of Wei Si Shi category.
3. method according to claim 1 and 2, it is characterised in that it is any right in (1)~(5) that the primer sequence includes,
Wherein：
(1) sense primer：GCTCTGAAGTGATTTTATCTGACA, anti-sense primer：AACCATGCGGTTGTTGGTA；
(2) sense primer：GGCGGATTGGTCTCTTTTTG, anti-sense primer：CACGCTCAGTAACCGTGTGC；
(3) sense primer：GCATCCGTCAGTTCATCAC；Anti-sense primer：GATTACGCACTTACCACAGG；
(4) sense primer：CGCAAACACAACAAGCCTAT；Anti-sense primer：TGTTGAGCAAGTTCCAAAGC；
(5) sense primer：GCTCTGAAGTGATTTTATCTGAC；Anti-sense primer：AACCATGCGGTTGTTGGTA.
4. method according to claim 1 and 2, it is characterised in that by Mixed Microbes to be separated in the choosing containing vancomycin
Cultivated on selecting property culture medium, obtaining single bacterium colony carries out bacterium colony PCR；The selective medium contains：8.0~12.0g/ of peptone
L, 4.0~6.0g/L of powdered beef, 3.0~5.0g/L of dusty yeast, 20.0~30.0g/L of glucose, 1.0~2.0mL/L of Tween 80,
2.0~3.0g/L of dipotassium hydrogen phosphate, 4.0~6.0g/L of sodium acetate, 2.0~3.0g/L of Triammonium citrate, magnesium sulfate 0.2~
0.5g/L, 0.05~0.1g/L of manganese sulfate, 0.5~1g/L of Cys, 1.0~1.5g/L of Natamycin, vancomycin 2.0
~3.0g/L, initial pH are 7.0~7.2.
5. method according to claim 1 and 2, it is characterised in that the Wei Si Salmonellas are the bacterial strains of Wei Si Shi category, including
Class goldbeater's skin Wei Si Salmonellas, fusion Wei Si Salmonellas, Dou Shi Wei Si Salmonellas, green Wei Si Salmonellas, small Wei Si Salmonellas, He Lun Weis Si Shi
Bacterium, Kan Shi Wei Si Salmonellas or soil Wei Si Salmonellas.
6. method according to claim 5, it is characterised in that by sample inoculation to be separated to selective medium,
30~37 DEG C of standing 12~24h of enrichment culture, by the selective medium of above-mentioned nutrient solution dilution spread to solid, 30~37 DEG C
24~36h of culture.
7. method according to claim 2, it is characterised in that methods described is comprised the following steps that：
1) by sample inoculation to be screened in selective medium, culture 24h obtains nutrient solution in 37 DEG C of constant incubators, described
Selective medium formula it is as follows：Peptone 10.0g/L, powdered beef 5.0g/L, dusty yeast 4.0g/L, glucose 20.0g/
L, Tween 80 1.0mL/L, dipotassium hydrogen phosphate 2.0g/L, sodium acetate 5.0g/L, Triammonium citrate 2.0g/L, magnesium sulfate 0.2g/L,
Manganese sulfate 0.05g/L, Cys 0.5g/L, Natamycin 1.0g/L, vancomycin 20g/L, it is 7.0 to adjust initial pH；
2) by above-mentioned nutrient solution dilution spread to solid selective medium, 37 DEG C of culture 36h；Described solid is selectively cultivated
Selective medium described in the step of base is agar containing 20g/L (1)；
3) according to SEQ ID NO.1 design primer, picking step 2) obtain single bacterium colony carry out specific primer bacterium colony PCR, PCR
Product is imaged with the agarose gel electrophoresis of 2% concentration, and the bacterial strain that can obtain the band that size is 120~180bp is Wei Si
Salmonella.
8. a kind of label of Wei Si Salmonellas, it is characterised in that nucleotide sequence is as shown in SEQ ID NO.1.
9. application of the label described in claim 8 in terms of food, biology, field of medicaments identification strain.
10. application of any described method of claim 1~7 in terms of high flux screening.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710216629.3A CN106906296A (en) | 2017-04-05 | 2017-04-05 | A kind of label of high frequency zone Wei Si Salmonellas and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710216629.3A CN106906296A (en) | 2017-04-05 | 2017-04-05 | A kind of label of high frequency zone Wei Si Salmonellas and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106906296A true CN106906296A (en) | 2017-06-30 |
Family
ID=59195659
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710216629.3A Pending CN106906296A (en) | 2017-04-05 | 2017-04-05 | A kind of label of high frequency zone Wei Si Salmonellas and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106906296A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108504754A (en) * | 2018-04-03 | 2018-09-07 | 河南师范大学 | Green Wei Si Salmonellas real-time fluorescence quantitative PCR quick detection kit and its detection method |
| CN108611274A (en) * | 2018-03-29 | 2018-10-02 | 中冶华天南京工程技术有限公司 | The method of directed screening soil objective microbe flora |
| CN109943342A (en) * | 2019-04-12 | 2019-06-28 | 徐州工程学院 | A kind of cadmium pollution soil in-situ immobilization agent based on Wei Si Salmonella |
| CN110669855A (en) * | 2019-11-13 | 2020-01-10 | 临沂大学 | Weissella viridescens rapid detection method based on micro-droplet digital PCR |
| CN111690574A (en) * | 2020-07-22 | 2020-09-22 | 云南省畜牧兽医科学院 | Weissella mesenteroides and application thereof |
| CN113355330A (en) * | 2021-07-21 | 2021-09-07 | 江南大学 | ssDNA aptamer for specifically recognizing Weissella viridescens and screening method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086206A (en) * | 2016-07-26 | 2016-11-09 | 河南师范大学 | Green Wei Si Salmonella loop-mediated isothermal gene amplification fast detecting kit and detection method |
-
2017
- 2017-04-05 CN CN201710216629.3A patent/CN106906296A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086206A (en) * | 2016-07-26 | 2016-11-09 | 河南师范大学 | Green Wei Si Salmonella loop-mediated isothermal gene amplification fast detecting kit and detection method |
Non-Patent Citations (2)
| Title |
|---|
| LEE, MYEONGJAE 等: "Development and Application of PCR-Based Weissella Species Detection Method with recN Gene Targeted Species-Specific Primers", 《KOREAN J. MICROBIOL. BIOTECHNOL.》 * |
| MI-SUN KANG 等: "Quantitative Analysis of Weissella cibaria against Periodontopathic Bacteria by Real-time PCR", 《JOURNAL OF BACTERIOLOGY AND VIROLOGY》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108611274A (en) * | 2018-03-29 | 2018-10-02 | 中冶华天南京工程技术有限公司 | The method of directed screening soil objective microbe flora |
| CN108611274B (en) * | 2018-03-29 | 2021-10-12 | 中冶华天南京工程技术有限公司 | Method for directionally screening target microbial flora in soil |
| CN108504754A (en) * | 2018-04-03 | 2018-09-07 | 河南师范大学 | Green Wei Si Salmonellas real-time fluorescence quantitative PCR quick detection kit and its detection method |
| CN109943342A (en) * | 2019-04-12 | 2019-06-28 | 徐州工程学院 | A kind of cadmium pollution soil in-situ immobilization agent based on Wei Si Salmonella |
| CN110669855A (en) * | 2019-11-13 | 2020-01-10 | 临沂大学 | Weissella viridescens rapid detection method based on micro-droplet digital PCR |
| CN111690574A (en) * | 2020-07-22 | 2020-09-22 | 云南省畜牧兽医科学院 | Weissella mesenteroides and application thereof |
| CN111690574B (en) * | 2020-07-22 | 2021-05-25 | 云南省畜牧兽医科学院 | Weissella mesenteroides and application thereof |
| CN113355330A (en) * | 2021-07-21 | 2021-09-07 | 江南大学 | ssDNA aptamer for specifically recognizing Weissella viridescens and screening method and application thereof |
| CN113355330B (en) * | 2021-07-21 | 2022-04-01 | 江南大学 | ssDNA aptamer for specifically recognizing Weissella viridescens and screening method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106906296A (en) | A kind of label of high frequency zone Wei Si Salmonellas and its application | |
| CN106434409B (en) | The rice endogeny rayungus OsiLf-2 of one plant of external efficiently antagonism Pyricularia oryzae | |
| CN103421704B (en) | Lactobacillus plantarum for freshwater fish fermentation product and application thereof | |
| CN109468243B (en) | Bacillus siamensis and application thereof | |
| CN106010997B (en) | Lactobacillus plantarum and culture separation method, screening method and application thereof | |
| CN104694424A (en) | Bacillus amyloliquefaciens separated from fermented soya beans and used for producing protease | |
| CN103571782A (en) | Weissella confuse and application thereof | |
| CN107418920A (en) | A kind of screening technique of bacillus coagulans | |
| CN110004096A (en) | One lactobacillus plantarum and its application | |
| CN114921360A (en) | Bacillus belgii UB201712 and preparation method and application of fermentation broth of bacillus belgii UB201712 | |
| CN108004177A (en) | A kind of lactobacillus paracasei and its characteristic research of degradable nitrite | |
| CN110184224A (en) | One staphylococcus epidermidis and its application | |
| CN110484478A (en) | A kind of bacillus subtilis JZ2-1-12 and its application | |
| CN110172431A (en) | A method of vinegar miscellaneous bacteria is shone in separation, identification | |
| Izumi et al. | Characterisation of endobacterial communities in ectomycorrhizas by DNA-and RNA-based molecular methods | |
| CN106967612B (en) | Method for producing five ustilaginoidea virens toxins by using ustilaginoidea virens | |
| CN111254102B (en) | Leuconostoc citreum and application thereof in precipitated starch slurry | |
| CN111040969B (en) | Compound lactobacillus agent and application thereof in buffalo silage | |
| CN110055189B (en) | Lactobacillus plantarum YL15 and application thereof in red wine flavor yoghourt | |
| CN113801800A (en) | Saccharomyces cerevisiae and application thereof | |
| CN113684158A (en) | Siamese bacillus JY-1 and preparation and application thereof | |
| CN103937699A (en) | Bacillus cereus bacterial strain and applications thereof | |
| Neves et al. | Physiological and genetic variability of commercial isolates of culinary-medicinal mushroom Agaricus brasiliensis S. Wasser et al.(Agaricomycetideae) cultivated in Brazil | |
| CN105670948B (en) | A kind of method of Candida bacteria strain and its application and Pu'er tea processing | |
| CN112280715B (en) | Vinegar-polluted bacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170630 |