CN106906295A - Digital pcr detects point mutation method and device - Google Patents
Digital pcr detects point mutation method and device Download PDFInfo
- Publication number
- CN106906295A CN106906295A CN201710210482.7A CN201710210482A CN106906295A CN 106906295 A CN106906295 A CN 106906295A CN 201710210482 A CN201710210482 A CN 201710210482A CN 106906295 A CN106906295 A CN 106906295A
- Authority
- CN
- China
- Prior art keywords
- threshold
- value
- fam
- data
- fluorescent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B40/00—ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B45/00—ICT specially adapted for bioinformatics-related data visualisation, e.g. displaying of maps or networks
Abstract
The invention discloses a kind of digital pcr detection point mutation method and device.Wherein, including：The amplification data of machine under acquisition digital pcr chip reading instrument；The data of phosphor dot are screened from amplification data；Fluorescent graphic is drawn using the data of phosphor dot according to threshold value；Mutation analysis is carried out according to fluorescent graphic.The present invention solve cannot accurately judge detect sample in the presence or absence of point mutation technical problem.
Description
Technical field
The present invention relates to field of gene detection, point mutation method and dress are detected in particular to a kind of digital pcr
Put.
Background technology
Digital pcr technology is a kind of detection of nucleic acids and quantitative/qualitative method, using hyperpycnal flow control chip technology, will be examined
Test sample is originally evenly distributed to 20, in 000 single reacting hole, each reacting hole as an independent reactor, comprising or
The target molecule (DNA profiling) copied not comprising one or more, " unimolecule template PCR amplifications " are realized with this, by presenting
The number and ratio of negative and positive signal type of reactor carry out statistical analysis, calculate the template copy in original sample
Number.
The QuantStudio 3D digital pcr systems that Life-technologies is released, are also to use digital pcr technology,
And supporting QuantStudioTM 3D AnalysisSuiteTMSoftware is used, can be to QuantStudio 3D digital pcr systems
The amplification data of lower machine carries out drawing treatment.
But, QuantStudio 3D digital pcrs systems and QuantStudio that Life-technologies is releasedTM
3D AnalysisSuiteTMSoftware cannot directly obtain yin and yang attribute result, be unfavorable for doing qualitative analysis, and join without yin and yang attribute
In the case of examining product control, it is impossible to provide correct threshold decision, so that with the presence or absence of base in cannot accurately judging detection sample
Because of point mutation.
For it is above-mentioned cannot accurately judge detect sample in the presence or absence of point mutation problem, at present not yet propose have
The solution of effect.
The content of the invention
A kind of digital pcr detection point mutation method and device is the embodiment of the invention provides, so that at least solve cannot
With the presence or absence of the technical problem of point mutation in accurate judgement detection sample.
One side according to embodiments of the present invention, there is provided a kind of digital pcr detects point mutation method, including：
The amplification data of machine under acquisition digital pcr chip reading instrument；The data of phosphor dot are screened from amplification data；Used according to threshold value
The data of phosphor dot draw fluorescent graphic；Mutation analysis is carried out according to fluorescent graphic.
Further, obtaining amplification data includes：By the control of interface display first, wherein, listed in the first control
The file of all predetermined formats under predetermined file folder；One file is selected from the file of all predetermined formats by the first control
As amplification data.
Further, before fluorescent graphic is drawn using the data of the phosphor dot according to threshold value, methods described is also wrapped
Include：Using the numerical value being pre-configured with as the threshold value.
Further, in the case where that cannot use the numerical value being pre-configured with as the threshold value, methods described also includes：
By the control of interface display second, wherein, second control includes at least one input frame；It is input into by described at least one
Frame receives the numerical value of user input as the threshold value.
Further, after mutation analysis is carried out according to fluorescent graphic, method also includes：Storage carry out mutation analysis it
The result for obtaining afterwards；Generated according to result and reported.
Further, the data of phosphor dot include：The data of VIC and FAM phosphor dots；Fluorescent graphic includes：VIC-FAM is glimmering
Light figure.
Further, mutation analysis includes at least one of：Yin and yang attribute point number is calculated, the frequency of mutation is calculated, is judged
Yin and yang attribute result.
Further, amplification data carries out digital pcr by the way that the PCR reaction systems of genes of interest are placed in microreactor
Obtain.
Further, genes of interest is EGFR gene, and the PCR reaction systems of EGFR gene are included for detecting EGFR gene
The primer and probe of the 20th exon mutation.
Further, primer includes：First sense primer SEQ ID NO:1：CCTCACCTCCACCGTGC, the first downstream
Primer SEQ ID NO:2：ACCAGTTGAGCAGGTACTGG；Second sense primer SEQ ID NO:3：
TGCCTCACCTCCACCG, the second anti-sense primer SEQ ID NO:4：ACCAGTTGAGCAGGTACTGG；3rd sense primer SEQ
ID NO:5：GCATCTGCCTCACCTCCACC, the 3rd anti-sense primer SEQ ID NO:6：
ACCAGTTGAGCAGGTACTGGGAGC；4th sense primer SEQ ID NO:7：GGGCATCTGCCTCACCTCCAC, under the 4th
Trip primer SEQ ID NO:8：ACACCAGTTGAGCAGGTACTGGGAG；Probe includes：First probe FAM SEQ ID NO:9：
AGCTCATCATGCAGCTCAT, the second probe VIC SEQ ID NO:10：AGCTCATCACGCAGCTCAT.
Further, before fluorescent graphic is drawn using the data of the phosphor dot according to the threshold value, methods described
Also include：The threshold value is obtained, wherein, the threshold value includes at least one of：VIC threshold values, FAM threshold values.
Further, obtaining the VIC threshold values includes：The data of the phosphor dot are ranked up and obtain the first data
Collection；The standard deviation for including multiple subsets of predetermined quantity phosphor dot and obtaining each subset is obtained from first data set；
Using maximum standard deviation set as threshold value dividing subset；Subset intermediate value+1 is chosen as the VIC threshold values.
Further, obtaining the FAM threshold values includes：Fluorescence under same fluorescent value is obtained to count out the first numerical value of maximum
As the first peak value；Obtain in the case of the fluorescent value of the fluorescent value more than first peak value, the phosphor dot
Number is only second to the second value of first numerical value as the second peak value；Obtaining first threshold includes：Obtain the first peak
Two fluorescence value sets of the difference maximum that the adjacent fluorescence is counted out between value and second peak value, will wherein less institute
Fluorescent value is stated as first threshold；Obtaining Second Threshold includes：Obtain adjacent between first peak value and second peak value
Two second largest fluorescence value sets of difference that the fluorescence is counted out, will the wherein less fluorescent value as Second Threshold；
Obtaining the 3rd threshold value includes：Set the first peak value serial number a, maximum fluorescence value serial number b, minimum fluorescent value serial number c；
If b-a>A-c then chooses a~c for first calculates subset；If b-a<A-c then chooses a~b for second calculates subset, according to described
First calculates subset and described second calculates subset calculating standard deviation；3rd threshold value is the described of+6 times of first peak value
Standard deviation；Based on the first threshold, the Second Threshold and the 3rd threshold value, the FAM threshold values are judged.
Further, based on the first threshold, the Second Threshold and the 3rd threshold value, the FAM thresholds are judged
Value includes：In the first threshold-Second Threshold>The situation of (the maximum fluorescence value-minimum fluorescent value) x0.09
Under, determine the Second Threshold as optimal threshold；Otherwise determine the first threshold as the optimal threshold.
Further, it is determined that after the optimal threshold, methods described also includes：Set up the VIC- of the data of phosphor dot
FAM coordinate diagrams；The VIC-FAM coordinate diagrams are divided by 4 quadrants according to the VIC threshold values and the optimal threshold, if first
Quadrantal points quantity is between 3-10, and the optimal threshold-the 3rd threshold value>The 3rd threshold value x0.15, then take described
3rd threshold value+1 is used as the FAM threshold values；If the first quartile point quantity is less than 2, the Second Threshold+1 is taken as institute
State FAM threshold values；Otherwise using the optimal threshold+1 as the FAM threshold values.
Further, judge that the FAM threshold values also include：4 point groups are divided with VIC threshold values and the FAM threshold values, if first
Quadrantal points quantity is 0, then using the FAM maximum fluorescences value+1 as the FAM threshold values.
Another aspect according to embodiments of the present invention, additionally provides a kind of digital pcr detection point mutation device, bag
Include：Acquiring unit, the amplification data for obtaining machine under digital pcr chip reading instrument；Screening unit, for from amplification data
Screen the data of phosphor dot；Drawing unit, for drawing fluorescent graphic using the data of phosphor dot according to threshold value；Mutation analysis list
Unit, for carrying out mutation analysis according to fluorescent graphic.
Further, acquiring unit includes：First display module, for by the control of interface display first, wherein, first
The file of all predetermined formats under predetermined file is pressed from both sides is listed in control；Selecting module, for by the first control from all pre-
A file is selected in the file of the formula that fixes as amplification data.
Further, drawing unit includes：Second display module, for by the control of interface display second, wherein, second
Control includes at least one input frame；Receiver module, the numerical value for being received user input by least one input frame is used as
Threshold value.
Further, in the case of the numerical value for not detecting user input at least one input frame, device is also wrapped
Include：Using module, for using the numerical value being pre-configured with as threshold value.
Further, after mutation analysis unit, device also includes：Memory module, mutation analysis is carried out for storing
The result for obtaining afterwards；Generation module, reports for being generated according to result.
Further, the data of phosphor dot include：The data of VIC and FAM phosphor dots；Fluorescent graphic includes：VIC-FAM is glimmering
Light figure.
Further, mutation analysis includes at least one of：Yin and yang attribute point number is calculated, the frequency of mutation is calculated, is judged
Yin and yang attribute result.
Another aspect according to embodiments of the present invention, additionally provides a kind of storage medium, and the storage medium includes storage
Program, wherein, the equipment where the storage medium is controlled when program is run performs digital pcr detection point mutation method.
Another aspect according to embodiments of the present invention, additionally provides a kind of processor, and the processor is used for operation program, its
In, digital pcr detection point mutation method is performed when program is run.
In embodiments of the present invention, by obtaining the amplification data of machine under digital pcr chip reading instrument, then therefrom filter out
The nucleotides of the data with phosphor dot, then according to specific threshold algorithm, draws out corresponding fluorescent graphic, and according to fluorescence
Figure carries out mutation analysis.By the amplification data of machine under digital pcr chip reading instrument, corresponding figure knot is rationally drawn out
Really, and on the basis of the figure it is analyzed, obtains mutation rate and yin and yang attribute judges information, stores information, and provide pdf lattice
Formula report, more easily and accurately sample is judged, so solve cannot accurately judge detection sample in whether there is
The technical problem of point mutation.
Brief description of the drawings
Accompanying drawing described herein is used for providing a further understanding of the present invention, constitutes the part of the application, this hair
Bright schematic description and description does not constitute inappropriate limitation of the present invention for explaining the present invention.In the accompanying drawings：
Fig. 1 is the flow chart that a kind of digital pcr according to embodiments of the present invention detects point mutation method；
Fig. 2 is the schematic diagram that a kind of digital pcr according to embodiments of the present invention detects point mutation device；
Fig. 3 is the schematic diagram that a kind of optional digital pcr according to embodiments of the present invention detects point mutation device；
Fig. 4 is a kind of schematic diagram at welcome interface according to embodiments of the present invention；
Fig. 5 is a kind of schematic diagram of sample interface according to embodiments of the present invention；
Fig. 6 is a kind of schematic diagram of drawing interface according to embodiments of the present invention；
Fig. 7 is a kind of schematic diagram of result interface according to embodiments of the present invention；
Fig. 8 is a kind of schematic diagram at record interface according to embodiments of the present invention.
Specific embodiment
In order that those skilled in the art more fully understand the present invention program, below in conjunction with the embodiment of the present invention
Accompanying drawing, is clearly and completely described to the technical scheme in the embodiment of the present invention, it is clear that described embodiment is only
The embodiment of a part of the invention, rather than whole embodiments.Based on the embodiment in the present invention, ordinary skill people
The every other embodiment that member is obtained under the premise of creative work is not made, should all belong to the model of present invention protection
Enclose.
It should be noted that term " first ", " in description and claims of this specification and above-mentioned accompanying drawing
Two " it is etc. for distinguishing similar object, without for describing specific order or precedence.It should be appreciated that so using
Data can exchange in the appropriate case, so as to embodiments of the invention described herein can with except illustrating herein or
Order beyond those of description is implemented.Additionally, term " comprising " and " having " and their any deformation, it is intended that cover
Lid is non-exclusive to be included, for example, the process, method, system, product or the equipment that contain series of steps or unit are not necessarily limited to
Those steps or unit clearly listed, but may include not list clearly or for these processes, method, product
Or other intrinsic steps of equipment or unit.
According to embodiments of the present invention, there is provided a kind of embodiment of digital pcr detection point mutation method is, it is necessary to illustrate
, can be held in the such as one group computer system of computer executable instructions the step of the flow of accompanying drawing is illustrated
OK, and, although show logical order in flow charts, but in some cases, can be with different from order herein
Perform shown or described step.
Fig. 1 is the flow chart that a kind of digital pcr according to embodiments of the present invention detects point mutation method, such as Fig. 1 institutes
Show, the method comprises the following steps：
Step S102, obtains the amplification data of machine under digital pcr chip reading instrument；
Step S104, screens the data of phosphor dot from amplification data；
Step S106, fluorescent graphic is drawn according to threshold value using the data of phosphor dot；
Step S108, mutation analysis is carried out according to fluorescent graphic.
In the above-described embodiments, by obtaining the amplification data of machine under digital pcr chip reading instrument, then band is therefrom filtered out
There is the nucleotides of the data of phosphor dot, then according to specific threshold algorithm, draw out corresponding fluorescent graphic, and according to fluorogram
Shape carries out mutation analysis.By the amplification data of machine under pcr chip reading apparatus, corresponding graphic result is rationally drawn out, and
It is analyzed on the basis of the figure, obtains mutation rate and yin and yang attribute judges information, store information, and provides pdf form reports,
More easily and accurately sample is judged, so solve cannot accurately judge detection sample in the presence or absence of gene point dash forward
The technical problem of change.
It should be noted that PCR refers to PCR, it is a kind of dividing for the amplification specific DNA fragmentation of amplification
Sub- biology techniques, it is considered as the special DNA replication dna of in vitro, the maximum feature of PCR, and being can be big by micro DNA
Width increases, therefore, according to the cell of organism, as long as the DNA of a wee bit can be isolated, can just be amplified with PCR, compared
It is right.
Specifically, PCR (PCR) is that high temperature (95 degrees Celsius) time variation can become single in vitro using DNA
Chain, at low temperature (about 60 degrees centigrade), primer is combined with single-stranded by the principle of base pair complementarity, then temperature regulating is poly- to DNA
The optimal reactive temperature (72 degrees centigrade) of synthase, archaeal dna polymerase along phosphoric acid to pentose direction composition complementary strand.
It should be noted that digital pcr is a kind of brand-new detection of nucleic acids and quantitative approach, sample treatment is divided into many
Individual single real-time fluorescence quantitative PCR reaction；A part among these reflections contains target molecules (positive), and it is other then
Without target molecules (feminine gender).By after PCR amplifications and signal analysis, the ratio according to negative reflection is to the target in sample
Molecular data carries out absolute counting, without reference standard or endogenous control.
Digital pcr mainly uses micro-fluidic or droplet method, and the nucleic acid PCR reaction system after Macrodilution is dispersed to
In the microreactor or droplet of chip, the nucleic acid-templated number of each reactor is less than or equal to 1.So by PCR cycle
Afterwards, having a reactor for nucleic acid templates will provide fluorescence signal, and the reactor for not having template is just believed without fluorescence
Number.According to relative scale and the volume of reactor, it is possible to extrapolate the nucleic acid concentration of original solution.The present invention is with digital pcr
It is platform, PCR primer and TaqMan probe is added in reaction system, (mark is different using two different TaqMan probes
Type fluorescence) wild and mutant DNA template is detected；According to the type of DNA profiling in fluorescence types judgement sample.It is preferred that
Digital pcr is carried out by the way of microreactor and obtains amplification data.
Specifically, the PCR primer in digital pcr reaction system can be entered according to the purpose point mutation on specific purposes gene
Row rationally design.In a kind of preferred embodiment of the application, genes of interest fragment is the 20th extron on EGFR
T790M point mutation, the primer of its PCR amplifications includes：First sense primer SEQ ID NO:1：CCTCACCTCCACCGTGC, the
One anti-sense primer SEQ ID NO:2：ACCAGTTGAGCAGGTACTGG；Second sense primer SEQ ID NO:3：
TGCCTCACCTCCACCG, the second anti-sense primer SEQ ID NO:4：ACCAGTTGAGCAGGTACTGG；3rd sense primer SEQ
ID NO:5：GCATCTGCCTCACCTCCACC, the 3rd anti-sense primer SEQ ID NO:6：
ACCAGTTGAGCAGGTACTGGGAGC；4th sense primer SEQ ID NO:7：GGGCATCTGCCTCACCTCCAC, under the 4th
Trip primer SEQ ID NO:8：ACACCAGTTGAGCAGGTACTGGGAG.Two kinds of species of the fluorophor of probe institute band are different,
First probe carries FAM fluorophors, and the second probe carries VIC fluorophors.The sequence of specific first probe and the second probe
It is classified as SEQ ID NO:9：The sequence of AGCTCATCATGCAGCTCAT, the second probe VIC is SEQ ID NO:10：
AGCTCATCACGCAGCTCAT.It is highly preferred that the concentration of the first probe FAM is 280~320nmol/L, the second probe VIC's
Concentration is 750~850nmol/L.
In an optional embodiment, obtaining amplification data includes：By the control of interface display first, wherein, first
The file of all predetermined formats under predetermined file is pressed from both sides is listed in control；By the first control from the file of all predetermined formats
One file of selection is used as amplification data.
Specifically, amplification data is obtained to be completed by first control at interface, wherein, included in the control of interface display first
One Folder List, the list represents the file of the whole predetermined formats preserved under predetermined file folder, by the first control,
A file is selected from the file of whole predetermined formats as amplification data, for subsequent operation.
As an optional embodiment, before fluorescent graphic is drawn using the data of phosphor dot according to threshold value, method
Also include：Using the numerical value being pre-configured with as threshold value.
Specifically, between fluorescent graphic is drawn using the data of phosphor dot according to threshold value, it is possible to use be pre-configured with
Numerical value is used as threshold value.Using the numerical value being pre-configured with as threshold value, the glimmering figure of the threshold rendering can be quickly and easily used,
Carry out mutation analysis.
An optional embodiment, in the case where that cannot use the numerical value being pre-configured with as threshold value, method also includes：
By the control of interface display second, wherein, the second control includes at least one input frame；Received by least one input frame and used
The numerical value of family input is used as threshold value.
Specifically, in the case where the numerical value for pre-setting cannot be used as threshold value, can be empty in interface display second
Between, the numerical value of user input is received at least one of the second control input frame as threshold value, such that it is able to according to user
The numerical value of input meets the drafting of the fluorescent graphic of special circumstances as threshold rendering fluorescent graphic, carries out mutation analysis.
In an optional embodiment, after mutation analysis is carried out according to fluorescent graphic, method also includes：It is stored in
The result obtained after row mutation analysis；Generated according to result and reported.
Specifically, after mutation analysis is carried out according to fluorescent graphic, the result of mutation analysis is stored, and according to
The result generation report of the mutation analysis of storage.
Alternatively, the result of mutation analysis is stored, the result of mutation analysis can be saved in result form.
Alternatively, generated according to result and reported, the report of pdf forms can be generated according to result.
An optional embodiment, the data of phosphor dot include：The data of VIC and FAM phosphor dots；Fluorescent graphic includes：
VIC-FAM fluorescent graphics.
It should be noted that VIC and FAM are conventional fluorescent dyes.FAM, Fluoresceincarboxylic acid is fluorescein derivative
One kind, is widely present in fluorescent labeling reagent box, also, FAM is very fast with amino reaction, and product is relatively stablized.
Used as an optional embodiment, mutation analysis includes at least one of：Calculate yin and yang attribute point number, calculate prominent
Frequency, judge yin and yang attribute result.
As an optional embodiment, before fluorescent graphic is drawn using the data of phosphor dot according to threshold value, method
Also include：Threshold value is obtained, wherein, threshold value includes at least one of：VIC threshold values, FAM threshold values.According to VIC threshold values, FAM threshold values
The threshold value that can be obtained is more accurate.
In an optional embodiment, obtaining VIC threshold values includes：The data of phosphor dot are ranked up and obtain the first number
According to collection；The standard deviation for including multiple subsets of predetermined quantity phosphor dot and obtaining each subset is obtained from the first data set；Will
Maximum standard deviation set is used as threshold value dividing subset；Subset intermediate value+1 is chosen as VIC threshold values.Using above-mentioned reality of the invention
Example is applied, the VIC threshold values of acquisition can be made more accurate.
In another optional embodiment, obtaining FAM threshold values includes：Fluorescence under same fluorescent value is obtained to count out maximum
The first numerical value as the first peak value；Obtain in the case of fluorescent value of the fluorescent value more than the first peak value, fluorescence is counted out only
Inferior to the first numerical value second value as the second peak value；Obtaining first threshold includes：Obtain the first peak value and the second peak value it
Between the maximum two fluorescence value sets of the difference counted out of adjacent phosphor, will wherein less fluorescent value as first threshold；Obtain
Second Threshold includes：Obtain two second largest fluorescent value collection of adjacent phosphor is counted out between the first peak value and the second peak value difference
Close, will wherein less fluorescent value as Second Threshold；Obtaining the 3rd threshold value includes：The first peak value serial number a is set, it is maximum glimmering
Light value serial number b, minimum fluorescent value serial number c；If b-a>A-c then chooses a~c for first calculates subset；If b-a<A-c is then selected
A~b is taken for second calculates subset, calculating subset and second according to first calculates subset calculating standard deviation；3rd threshold value is first
+ 6 times of standard deviations of peak value；Based on first threshold, Second Threshold and the 3rd threshold value, FAM threshold values are judged.It is above-mentioned using the present invention
Embodiment, can make the FAM threshold values of acquisition more accurate.
As an optional embodiment, based on first threshold, Second Threshold and the 3rd threshold value, FAM threshold value bags are judged
Include：In first threshold-Second Threshold>In the case of (maximum fluorescence value-minimum fluorescent value) x0.09, Second Threshold conduct is determined
Optimal threshold；Otherwise determine first threshold as optimal threshold.Using the above embodiment of the present invention, by obtaining the optimal of FAM
Threshold value can be in order to subsequently accurately determine FAM threshold values.
As an optional embodiment, it is determined that after optimal threshold, method also includes：Set up the data of phosphor dot
VIC-FAM coordinate diagrams；VIC-FAM coordinate diagrams are divided by 4 quadrants according to VIC threshold values and optimal threshold, if first quartile is counted
Amount is between 3-10, and the threshold value of optimal threshold-the three>3rd threshold value x0.15, then take the 3rd threshold value+1 as FAM threshold values；If
First quartile point quantity is less than 2, then take Second Threshold+1 as FAM threshold values；Otherwise using optimal threshold+1 as FAM threshold values.Adopt
With the above embodiment of the present invention, the FAM threshold values of acquisition can be made more accurate.
It is alternatively possible to the VIC values of the data according to phosphor dot are used as abscissa, the FAM values of the data according to phosphor dot
As ordinate, figure of the phosphor dot in VIC-FAM coordinate systems is set up, two are set up directly with the optimal threshold of VIC threshold values and FAM
Line, four quadrants are divided into by phosphor dot in the figure of VIC-FAM coordinate systems, wherein, it is optimal higher than FAM less than VIC threshold values
Quadrant where the phosphor dot of threshold value is first quartile；Higher than VIC threshold values, and where the phosphor dot of optimal threshold higher than FAM
Quadrant is the second quadrant；Higher than VIC threshold values, and the phosphor dot place quadrant of the optimal threshold less than FAM is third quadrant；It is low
In VIC threshold values, and the phosphor dot place quadrant of the optimal threshold less than FAM is fourth quadrant.
In an optional embodiment, judge that FAM threshold values also include：4 point groups are divided with VIC threshold values and FAM threshold values, if
First quartile point quantity is 0, then using FAM maximum fluorescences value+1 as FAM threshold values.Using the above embodiment of the present invention, can make
The FAM threshold values of acquisition are more accurate.
Alternatively, the relation of the VIC values of the data according to phosphor dot and VIC threshold values；The VIC values of the data of phosphor dot with
The relation of FAM threshold values, 4 point groups are divided into by fluorescence labeling point, wherein, less than VIC threshold values, optimal threshold higher than FAM
Phosphor dot is located at the first point group；Higher than VIC threshold values, and the optimal threshold higher than FAM phosphor dot positioned at second point group；It is higher than
VIC threshold values, and the phosphor dot of optimal threshold less than FAM is located at and thirdly rolls into a ball；It is less than VIC threshold values and optimal less than FAM
The phosphor dot of threshold value is located at the 4th point group.
According to embodiments of the present invention, additionally providing a kind of digital pcr detects point mutation device embodiment, it is necessary to illustrate
, the digital pcr detection gene point that digital pcr detection point mutation device can be used for performing in the embodiment of the present invention
Mutation method, the digital pcr detection point mutation method in the embodiment of the present invention can dash forward in digital pcr detection gene point
Become execution in device.
Fig. 2 is the schematic diagram that a kind of digital pcr according to embodiments of the present invention detects point mutation device, such as Fig. 2 institutes
Show, the device can include：Acquiring unit 21, the amplification data for obtaining machine under digital pcr chip reading instrument；Screening unit
23, the data for screening phosphor dot from amplification data；Drawing unit 25, for being painted using the data of phosphor dot according to threshold value
Fluorescent graphic processed；Mutation analysis unit 27, for carrying out mutation analysis according to fluorescent graphic.
It should be noted that the acquiring unit 21 in the embodiment can be used for performing the step in the embodiment of the present application
S102, the screening unit 23 in the embodiment can be used for performing the step S104 in the embodiment of the present application, in the embodiment
Drawing unit 25 can be used for performing the step S106 in the embodiment of the present application, and mutation analysis unit 27 in the embodiment can be with
For performing the step S108 in the embodiment of the present application.Example and application scenarios phase that above-mentioned module is realized with corresponding step
Together, but it is not limited to above-described embodiment disclosure of that.
In the above-described embodiments, by obtaining the amplification data of machine under digital pcr chip reading instrument, then band is therefrom filtered out
There is the nucleotides of the data of phosphor dot, then according to specific threshold algorithm, draw out corresponding fluorescent graphic, and according to fluorogram
Shape carries out mutation analysis.By the amplification data of machine under pcr chip reading apparatus, corresponding graphic result is rationally drawn out, and
It is analyzed on the basis of the figure, obtains mutation rate and yin and yang attribute judges information, store information, and provides pdf form reports,
More easily and accurately sample is judged, so solve cannot accurately judge detection sample in the presence or absence of gene point dash forward
The technical problem of change.
In an optional embodiment, acquiring unit includes：First display module, for being controlled by interface display first
Part, wherein, the file of all predetermined formats under predetermined file folder is listed in the first control；Selecting module, for by first
Control selects a file as amplification data from the file of all predetermined formats.
Used as an optional embodiment, drawing unit includes：Second display module, for being controlled by interface display second
Part, wherein, the second control includes at least one input frame；Receiver module, it is defeated for receiving user by least one input frame
The numerical value for entering is used as threshold value.
An optional embodiment, in the case of the numerical value for not detecting user input at least one input frame,
Device also includes：Using module, for using the numerical value being pre-configured with as threshold value.
In an optional embodiment, after mutation analysis unit, device also includes：Memory module, for storing
Carry out the result obtained after mutation analysis；Generation module, reports for being generated according to result.
Used as an optional embodiment, the data of phosphor dot include：The data of VIC and FAM phosphor dots；Fluorescent graphic bag
Include：VIC-FAM fluorescent graphics.
In an optional embodiment, mutation analysis includes at least one of：Calculate yin and yang attribute point number, calculate prominent
Frequency, judge yin and yang attribute result.
Another aspect according to embodiments of the present invention, additionally provides a kind of storage medium, and storage medium includes the journey of storage
Sequence, wherein, the equipment where controlling storage medium when program is run performs digital pcr detection point mutation method.
Another aspect according to embodiments of the present invention, additionally provides a kind of processor, it is characterised in that processor is used to transport
Line program, wherein, digital pcr detection point mutation method is performed when program is run.
Fig. 3 is the schematic diagram that a kind of optional digital pcr according to embodiments of the present invention detects point mutation device, such as
Shown in Fig. 3, the device can include：Welcome interface 31, including main interface and setting function；Sample interface 33, including sample tube
Reason function；Drawing interface 35, including drawing function；Result interface 37, result data statistical function；And record interface 39, bag
Include writing function.By built-in algorithms, sample interface includes the first control to the device, pre- is fixed from all by the first control
A file is selected in the file of formula as amplification data；Drawing interface includes the second control, by defeated in the second control
Enter frame and receive the numerical value of user input, and the numerical value is drawn as threshold value；Result interface includes generation module, is used for
According to the fluorescent graphic analysis that drawing interface is drawn, the result of mutation analysis is obtained, and the result generation of mutation analysis is reported, its
In, this report includes the report of pdf forms；Record interface includes memory module, and the knot after mutation analysis is carried out for storage
Really, recording-related information.
Fig. 4 is a kind of schematic diagram at welcome interface according to embodiments of the present invention, as shown in figure 4, it is initial to welcome interface
Change interface, comprising company logo, device name, four parts of device related description and setting.Wherein, can by settings button
Interface is set to enter, by setting interface to " working folder ", " compressed software ", " report files " and " eds is common
Enjoy file " carry out related setting.
Fig. 5 is a kind of schematic diagram of sample interface according to embodiments of the present invention, as shown in figure 5, being included in sample interface
Shared Folders list, selects sample list and sample operations correlation function.Shared Folders list can automatically read what is set
Eds files in " eds Shared Folders ", and include to come successively according to the date；Selection sample list can show and carry out sample
Sample list after operation, is sequentially operation order；Sample operations include " importing sample ", " deletion sample " and " emptying sample "
Three kinds, its literal function is corresponded to respectively.Wherein " importing sample " and " deletion sample " can carry out multisample operation.
Fig. 6 is a kind of schematic diagram of drawing interface according to embodiments of the present invention, as shown in fig. 6, it is sample to draw interface
Drawing interface, comprising sample list, figure sets related and graphic result function.Sample list is arranged with the sample in sample interface
Table is identical, and drawing treatment can be carried out by selecting sample therein；Draw and function is set, it is possible to use " acquiescence " or " certainly
Definition " function." acquiescence " correspond to built-in algorithms, and suitable VIC-FAM fluorograms are drawn out automatically and rational threshold value is marked.
" self-defined " correspond to personalized algorithm, and the numerical value of the user input that will be received can also be manually entered X, Y1, Y2 as threshold value
Threshold value；After good threshold is set, using refreshing or batch refresh can carry out mapping operation to sample, then to choosing
Sample drawing goes out corresponding VIC-FAM fluorograms, and provides corresponding data message.
Fig. 7 is a kind of schematic diagram of result interface according to embodiments of the present invention, as shown in fig. 7, result interface is sample
Result interface, comprising testing result form, analysis result form, full choosing and printed report function.Part in testing result form
Total data in data and analysis result form, is that device built-in algorithms are calculated；The related letter of result form is filled in when complete
After breath, can choose or select sample in result form entirely, then carry out printed report associative operation；Printed report being capable of basis
As a result relevant information in form, is automatically performed corresponding pdf report generations.
Fig. 8 is a kind of schematic diagram at record interface according to embodiments of the present invention, as shown in figure 8, record interface is sample
Record interface, comprising result record form.As a result after record form installs tape deck, the sample of all printed report operations
Relevant information, for inquiry.
According to the above embodiment of the present invention, can be led to according to " .eds " amplification data of machine under digital pcr chip reading instrument
Cross and screen VIC therein, the data of FAM phosphor dots, according to specific thresholding algorithm, draw out VIC-FAM fluorescent graphics, and root
According to graphical information, yin and yang attribute point number, the calculating of the frequency of mutation and the judgement of yin and yang attribute result are carried out, store information, and provide
Pdf form reports.
In the above-described embodiments, using digital pcr method, with Human epidermal growth factor receptor gene T790M mutation analysis kit (digital pcrs
Method), it is used clinically for carrying out qualitative detection to the analyte in the plasma DNA sample of human body, including it is non-
The detection project of the EGFR gene T790M saltant types of ED-SCLC.
Device according to the above embodiment of the present invention, digital pcr chip reading instrument is used exclusively for entering digital pcr chip
Row reads the instrument of analysis, the chip that is expanded by PCR can be imaged and be analyzed, and provide the phase of target nucleic acid sequence
To abundance, so that judge whether contain target nucleic acid sequence in detection sample, by machine datagraphic under digital pcr chip reading instrument
Change, allow the medical worker without information analysis experience more easily to provide clinical detection and report.Device is mainly used in number
The data analysis of word pcr chip reading apparatus, with semi-automated analytical data and can provide report.The device is to " digital pcr chip
Machine " .eds " data, are drawn, are analyzed under reading apparatus ", obtain mutation rate and yin and yang attribute judges information, store information, and go out
Tool pdf form reports.
The present invention through overtesting, simulate its feasibility, wherein negative sample 106, coincidence rate is 100%；Positive sample
98, coincidence rate is 97.86%.
The embodiments of the present invention are for illustration only, and the quality of embodiment is not represented.
In the above embodiment of the present invention, the description to each embodiment all emphasizes particularly on different fields, and does not have in certain embodiment
The part of detailed description, may refer to the associated description of other embodiment.
In several embodiments provided herein, it should be understood that disclosed technology contents, can be by other
Mode is realized.Wherein, device embodiment described above is only schematical, such as division of described unit, Ke Yiwei
A kind of division of logic function, can there is other dividing mode when actually realizing, such as multiple units or component can combine or
Person is desirably integrated into another system, or some features can be ignored, or does not perform.Another, shown or discussed is mutual
Between coupling or direct-coupling or communication connection can be the INDIRECT COUPLING or communication link of unit or module by some interfaces
Connect, can be electrical or other forms.
The unit that is illustrated as separating component can be or may not be it is physically separate, it is aobvious as unit
The part for showing can be or may not be physical location, you can with positioned at a place, or can also be distributed to multiple
On unit.Some or all of unit therein can be according to the actual needs selected to realize the purpose of this embodiment scheme.
In addition, during each functional unit in each embodiment of the invention can be integrated in a processing unit, it is also possible to
It is that unit is individually physically present, it is also possible to which two or more units are integrated in a unit.Above-mentioned integrated list
Unit can both be realized in the form of hardware, it would however also be possible to employ the form of SFU software functional unit is realized.
If the integrated unit is to realize in the form of SFU software functional unit and as independent production marketing or use
When, can store in a computer read/write memory medium.Based on such understanding, technical scheme is substantially
The part for being contributed to prior art in other words or all or part of the technical scheme can be in the form of software products
Embody, the computer software product is stored in a storage medium, including some instructions are used to so that a computer
Equipment (can be personal computer, server or network equipment etc.) perform each embodiment methods described of the invention whole or
Part steps.And foregoing storage medium includes：USB flash disk, read-only storage (ROM, Read-Only Memory), arbitrary access are deposited
Reservoir (RAM, Random Access Memory), mobile hard disk, magnetic disc or CD etc. are various can be with store program codes
Medium.
The above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, under the premise without departing from the principles of the invention, some improvements and modifications can also be made, these improvements and modifications also should
It is considered as protection scope of the present invention.
Sequence table
<110>Tianjin Nuo Hezhi sources biological information Science and Technology Ltd.
<120>Digital pcr detects point mutation method and device
<130> PN64200NHZY
<160> 10
<170> PatentIn version 3.5
<210> 1
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223>The sense primers of EGFR-T790M first
<400> 1
cctcacctcc accgtgc 17
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223>The anti-sense primers of EGFR-T790M first
<400> 2
accagttgag caggtactgg 20
<210> 3
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
<223>The sense primers of EGFR-T790M second
<400> 3
tgcctcacct ccaccg 16
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223>The second downstreams of EGFR-T790 M primers
<400> 4
accagttgag caggtactgg 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223>The sense primers of EGFR-T790M the 3rd
<400> 5
gcatctgcct cacctccacc 20
<210> 6
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223>The anti-sense primers of EGFR-T790M the 3rd
<400> 6
accagttgag caggtactgg gagc 24
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223>The sense primers of EGFR-T790M the 4th
<400> 7
gggcatctgc ctcacctcca c 21
<210> 8
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223>The anti-sense primers of EGFR-T790M the 4th
<400> 8
acaccagttg agcaggtact gggag 25
<210> 9
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223>The probes of EGFR-T790M first
<400> 9
agctcatcat gcagctcat 19
<210> 10
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223>The probes of EGFR_T790M second
<400> 10
agctcatcac gcagctcat 19
Claims (21)
1. a kind of method that digital pcr detects point mutation, it is characterised in that methods described includes：
The amplification data of machine under acquisition digital pcr chip reading instrument；
The data of phosphor dot are screened from the amplification data；
Fluorescent graphic is drawn using the data of the phosphor dot according to threshold value；
Mutation analysis is carried out according to the fluorescent graphic.
2. method according to claim 1, it is characterised in that obtaining the amplification data includes：
By the control of interface display first, wherein, all predetermined formats under predetermined file is pressed from both sides are listed in first control
File；
A file is selected to be used as the amplification data from the file of all predetermined formats by first control.
3. method according to claim 1, it is characterised in that drawing glimmering using the data of the phosphor dot according to threshold value
Before light figure, methods described also includes：
Using the numerical value being pre-configured with as the threshold value.
4. method according to claim 3, it is characterised in that the numerical value being pre-configured with cannot used as the threshold value
In the case of, methods described also includes：
By the control of interface display second, wherein, second control includes at least one input frame；
The numerical value for receiving user input by least one input frame is used as the threshold value.
5. method according to claim 1, it is characterised in that after mutation analysis is carried out according to the fluorescent graphic,
Methods described also includes：
Storage carries out the result obtained after the mutation analysis；
Generated according to the result and reported.
6. method according to claim 1, it is characterised in that
The data of the phosphor dot include：The data of VIC and FAM phosphor dots；
The fluorescent graphic includes：VIC-FAM fluorescent graphics.
7. method according to claim 1, it is characterised in that the mutation analysis includes at least one of：Calculate cloudy
Positobe focus number, calculate the frequency of mutation, judge yin and yang attribute result.
8. method according to claim 1, it is characterised in that the amplification data reacts by by the PCR of genes of interest
System is placed in microreactor and carries out digital pcr and obtain.
9. method according to claim 8, it is characterised in that the genes of interest is EGFR gene, the EGFR gene
PCR reaction systems include for detect the exon of the EGFR gene the 20th mutation primer and probe.
10. method according to claim 9, it is characterised in that the primer includes：
First sense primer SEQ ID NO:1：CCTCACCTCCACCGTGC,
First anti-sense primer SEQ ID NO:2：ACCAGTTGAGCAGGTACTGG；
Second sense primer SEQ ID NO:3：TGCCTCACCTCCACCG,
Second anti-sense primer SEQ ID NO:4：ACCAGTTGAGCAGGTACTGG；
3rd sense primer SEQ ID NO:5：GCATCTGCCTCACCTCCACC,
3rd anti-sense primer SEQ ID NO:6：ACCAGTTGAGCAGGTACTGGGAGC；
4th sense primer SEQ ID NO:7：GGGCATCTGCCTCACCTCCAC,
4th anti-sense primer SEQ ID NO:8：ACACCAGTTGAGCAGGTACTGGGAG；
The probe includes：
First probe FAM SEQ ID NO:9：AGCTCATCATGCAGCTCAT,
Second probe VIC SEQ ID NO:10：AGCTCATCACGCAGCTCAT.
11. methods according to claim 1, it is characterised in that the data of the phosphor dot are being used according to the threshold value
Before drawing fluorescent graphic, methods described also includes：
The threshold value is obtained, wherein, the threshold value includes at least one of：VIC threshold values, FAM threshold values.
12. methods according to claim 11, it is characterised in that obtaining the VIC threshold values includes：
The data of the phosphor dot are ranked up and obtain the first data set；
The standard deviation for including multiple subsets of predetermined quantity phosphor dot and obtaining each subset is obtained from first data set；
Using maximum standard deviation set as threshold value dividing subset；
Subset intermediate value+1 is chosen as the VIC threshold values.
13. methods according to claim 12, it is characterised in that obtaining the FAM threshold values includes：
Fluorescence counts out the first maximum numerical value as the first peak value under obtaining same fluorescent value；
Obtain in the case of the fluorescent value of the fluorescent value more than first peak value, the fluorescence is counted out and is only second to
The second value of first numerical value is used as the second peak value；
Obtaining first threshold includes：Obtain the difference that the adjacent fluorescence is counted out between first peak value and second peak value
Two maximum fluorescence value sets, will the wherein less fluorescent value as first threshold；
Obtaining Second Threshold includes：Obtain the difference that the adjacent fluorescence is counted out between first peak value and second peak value
The two second largest fluorescence value sets, will the wherein less fluorescent value as Second Threshold；
Obtaining the 3rd threshold value includes：Set the first peak value serial number a, maximum fluorescence value serial number b, minimum fluorescent value sequence number
It is c；If b-a>A-c then chooses a~c for first calculates subset；If b-a<A-c then chooses a~b for second calculates subset, according to
Described first calculates subset and described second calculates subset calculating standard deviation；3rd threshold value is+6 times of first peak value
The standard deviation；
Based on the first threshold, the Second Threshold and the 3rd threshold value, the FAM threshold values are judged.
14. methods according to claim 13, it is characterised in that based on the first threshold, the Second Threshold and
3rd threshold value, judges that the FAM threshold values include：
In the first threshold-Second Threshold>In the case of (the maximum fluorescence value-minimum fluorescent value) x0.09,
Determine the Second Threshold as optimal threshold；Otherwise determine the first threshold as the optimal threshold.
15. methods according to claim 14, it is characterised in that it is determined that after the optimal threshold, methods described is also
Including：
Set up the VIC-FAM coordinate diagrams of the data of phosphor dot；
The VIC-FAM coordinate diagrams are divided by 4 quadrants according to the VIC threshold values and the optimal threshold,
If first quartile point quantity is between 3-10, and the optimal threshold-the 3rd threshold value>3rd threshold value
X0.15, then take the 3rd threshold value+1 as the FAM threshold values；
If the first quartile point quantity is less than 2, the Second Threshold+1 is taken as the FAM threshold values；
Otherwise using the optimal threshold+1 as the FAM threshold values.
16. method according to claim 13 or 15, it is characterised in that judge that the FAM threshold values also include：
4 point groups are divided with the VIC threshold values and the FAM threshold values, it is if first quartile point quantity is 0, the FAM maximums is glimmering
Light value+1 is used as the FAM threshold values.
A kind of 17. digital pcr detection point mutation devices, it is characterised in that including：
Acquiring unit, the amplification data for obtaining machine under digital pcr chip reading instrument；
Screening unit, the data for screening phosphor dot from the amplification data；
Drawing unit, for drawing fluorescent graphic using the data of the phosphor dot according to threshold value；
Mutation analysis unit, for carrying out mutation analysis according to the fluorescent graphic.
18. devices according to claim 17, it is characterised in that the acquiring unit includes：
First display module, for by the control of interface display first, wherein, predetermined file folder is listed in first control
Under all predetermined formats file；
Selecting module, for selecting a file to be used as institute from the file of all predetermined formats by first control
State amplification data.
19. devices according to claim 17, it is characterised in that the drawing unit includes：
Second display module, for by the control of interface display second, wherein, second control includes at least one input
Frame；
Receiver module, the numerical value for receiving user input by least one input frame is used as the threshold value.
20. a kind of storage mediums, it is characterised in that the storage medium includes the program of storage, wherein, in described program operation
When control the storage medium where equipment perform claim requirement 1 to 16 in method described in any one.
21. a kind of processors, it is characterised in that the processor is used for operation program, wherein, right of execution when described program is run
Profit requires the method described in any one in 1 to 16.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710210482.7A CN106906295B (en) | 2017-03-31 | 2017-03-31 | Method and device for detecting gene point mutation by digital PCR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710210482.7A CN106906295B (en) | 2017-03-31 | 2017-03-31 | Method and device for detecting gene point mutation by digital PCR |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106906295A true CN106906295A (en) | 2017-06-30 |
| CN106906295B CN106906295B (en) | 2020-12-08 |
Family
ID=59195328
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710210482.7A Active CN106906295B (en) | 2017-03-31 | 2017-03-31 | Method and device for detecting gene point mutation by digital PCR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106906295B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107312850A (en) * | 2017-07-19 | 2017-11-03 | 华东医药（杭州）基因科技有限公司 | A kind of detection method of the invalid amplifications of PCR |
| CN107365867A (en) * | 2017-09-04 | 2017-11-21 | 天津华大医学检验所有限公司 | A kind of Primer composition and its application for being used to detect genome target region |
| CN108330171A (en) * | 2017-09-27 | 2018-07-27 | 天津诺禾医学检验所有限公司 | Detect kit, the method and its application of the 19th exon deletion mutation of EGFR gene |
| CN108384843A (en) * | 2018-04-26 | 2018-08-10 | 新羿制造科技（北京）有限公司 | A method of identifying single copy gene mutated-genotype using digital pcr |
| CN109712683A (en) * | 2018-12-17 | 2019-05-03 | 上海派森诺医学检验所有限公司 | A kind of examining report generation method of automation |
| CN111534574A (en) * | 2020-06-02 | 2020-08-14 | 北京鑫诺美迪基因检测技术有限公司 | Gene enrichment method for enhancing sequencing sensitivity |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101193905A (en) * | 2005-02-11 | 2008-06-04 | 纪念斯隆-凯特林癌症中心 | Methods and compositions for detecting a drug resistant EGFR mutant |
| WO2014043581A1 (en) * | 2012-09-14 | 2014-03-20 | Life Technologies Corporation | Methods and systems for a digital pcr experiment designer |
| CN104462869A (en) * | 2014-11-28 | 2015-03-25 | 天津诺禾致源生物信息科技有限公司 | Method and device for detecting somatic cell SNP |
| CN104903899A (en) * | 2012-11-07 | 2015-09-09 | 生命技术公司 | Visualization tools for digital polymerase chain reaction (PCR) data |
| CN105143469A (en) * | 2013-05-24 | 2015-12-09 | 株式会社日立高新技术 | Nucleic acid analyzer and nucleic acid analysis method using same |
| CN106434941A (en) * | 2016-10-19 | 2017-02-22 | 北京泛生子基因科技有限公司 | Kit, reaction system and method for detecting human EGFR gene mutation |
-
2017
- 2017-03-31 CN CN201710210482.7A patent/CN106906295B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101193905A (en) * | 2005-02-11 | 2008-06-04 | 纪念斯隆-凯特林癌症中心 | Methods and compositions for detecting a drug resistant EGFR mutant |
| WO2014043581A1 (en) * | 2012-09-14 | 2014-03-20 | Life Technologies Corporation | Methods and systems for a digital pcr experiment designer |
| CN104903899A (en) * | 2012-11-07 | 2015-09-09 | 生命技术公司 | Visualization tools for digital polymerase chain reaction (PCR) data |
| CN105143469A (en) * | 2013-05-24 | 2015-12-09 | 株式会社日立高新技术 | Nucleic acid analyzer and nucleic acid analysis method using same |
| CN104462869A (en) * | 2014-11-28 | 2015-03-25 | 天津诺禾致源生物信息科技有限公司 | Method and device for detecting somatic cell SNP |
| CN106434941A (en) * | 2016-10-19 | 2017-02-22 | 北京泛生子基因科技有限公司 | Kit, reaction system and method for detecting human EGFR gene mutation |
Non-Patent Citations (1)
| Title |
|---|
| LIFE TECHNOLOGIES: "《QuantStudio 3D AnalysisSuite Software for use with QuantStudio 3D Digital PCR System》", 16 July 2013 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107312850A (en) * | 2017-07-19 | 2017-11-03 | 华东医药（杭州）基因科技有限公司 | A kind of detection method of the invalid amplifications of PCR |
| CN107365867A (en) * | 2017-09-04 | 2017-11-21 | 天津华大医学检验所有限公司 | A kind of Primer composition and its application for being used to detect genome target region |
| CN108330171A (en) * | 2017-09-27 | 2018-07-27 | 天津诺禾医学检验所有限公司 | Detect kit, the method and its application of the 19th exon deletion mutation of EGFR gene |
| CN108384843A (en) * | 2018-04-26 | 2018-08-10 | 新羿制造科技（北京）有限公司 | A method of identifying single copy gene mutated-genotype using digital pcr |
| CN109712683A (en) * | 2018-12-17 | 2019-05-03 | 上海派森诺医学检验所有限公司 | A kind of examining report generation method of automation |
| CN111534574A (en) * | 2020-06-02 | 2020-08-14 | 北京鑫诺美迪基因检测技术有限公司 | Gene enrichment method for enhancing sequencing sensitivity |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106906295B (en) | 2020-12-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106906295A (en) | Digital pcr detects point mutation method and device | |
| Ridout et al. | Use of AFLP in cereals research | |
| US8129990B2 (en) | Image processing apparatus and computer program product | |
| EP2926288B1 (en) | Accurate and fast mapping of targeted sequencing reads | |
| RU2610691C2 (en) | Method for microdeletion detection near chromosome with dna-marking section | |
| CN108319813A (en) | Circulating tumor DNA copies the detection method and device of number variation | |
| CN101270390B (en) | 26-pair PCR primer for mitochondrion sequencing and parting method based on the primer | |
| CN104903899A (en) | Visualization tools for digital polymerase chain reaction (PCR) data | |
| Buen Abad Najar et al. | Coverage-dependent bias creates the appearance of binary splicing in single cells | |
| CN107408163A (en) | For analyzing the method and device of gene | |
| CN115428088A (en) | Systems and methods for joint interactive visualization of gene expression and DNA chromatin accessibility | |
| CN112048560B (en) | Kit for analyzing HER2 gene copy number variation by combining multiple internal references with sequential probability ratio test and use method | |
| CN109859797A (en) | A kind of miRNA data analysing method without ginseng based on miRBase database | |
| CN108642568A (en) | A kind of special SNP chip design method of domesticated dog full-length genome low-density cultivar identification | |
| CN114530199A (en) | Method and device for detecting low-frequency mutation based on double sequencing data and storage medium | |
| CN111088327B (en) | Method for detecting cattle body size characters under assistance of SIKE1 gene CNV marker and application thereof | |
| CN110088840A (en) | Method, system and the computer-readable media that base in the repeat region of calibration nucleic acid sequence reading is called | |
| US20230140008A1 (en) | Systems and methods for evaluating biological samples | |
| EP1630709B1 (en) | Mathematical analysis for the estimation of changes in the level of gene expression | |
| CN102576389A (en) | Analyzing tool for amplification reactions | |
| WO2022029484A1 (en) | Methods of assessing breast cancer using circulating hormone receptor transcripts | |
| JPWO2022138736A5 (en) | ||
| CN104120190B (en) | F11 gene copy number variation detection kit | |
| US6994965B2 (en) | Method for displaying results of hybridization experiment | |
| CN108304693B (en) | Method for analyzing gene fusion by using high-throughput sequencing data |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |