CN106906291A - A kind of method of use specific primer Rapid identification jujube fly - Google Patents
A kind of method of use specific primer Rapid identification jujube fly Download PDFInfo
- Publication number
- CN106906291A CN106906291A CN201710190671.2A CN201710190671A CN106906291A CN 106906291 A CN106906291 A CN 106906291A CN 201710190671 A CN201710190671 A CN 201710190671A CN 106906291 A CN106906291 A CN 106906291A
- Authority
- CN
- China
- Prior art keywords
- fly
- primer
- jujube
- pcr
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a kind of method of use specific primer Rapid identification jujube fly, it is sequenced by the COI genetic fragments to jujube fly mtDNA, using species-specific primers PCR (SS PCR) and agarose gel electrophoresis (AGE) technology, 1 pair of specific primer of jujube fly is filtered out, specific primer sequences are respectively, and the primer sequence of CarF is CTCAACTAAATTATTCCCCAGCA；The primer sequence of CarR is GGGTATCAATGCACAAATCCA；According to the proximity of the ovum of jujube fly, larva, pupa and other Fruit fly forms, for common Fruit fly citrus fruit fly, melonfly, pumpkin fruit fly, Bactrocera correcta, Peach fruits fly as the negative control for checking primer specificity, prove the specificity of the primer pair jujube fly of present invention design, the qualification cycle of jujube fly is substantially reduced, with wide applicability.
Description
Technical field
The invention belongs to quarantine pest detection field, specifically, quick using specific primer the present invention relates to one kind
Identify the technical field of jujube fly.
Background technology
Jujube fly (CarpomyavesuvianaCosta) is a kind of great quarantine pest of invasion, belongs to Diptera
Diptera Tephritidae Tephritidae Trypetinae Trypetinae trypetids race Trypetini click Anastrephas
CarpomyaCosta, originates in India, is the important moth fruit insect of jujube, and " plant quarantine that enters the territory has to be put into China
Evil biology register ".Great quarantine pest jujube fly (CarpomyavesuvianaCosta) is in 2007 in Turfan Prefecture
It was found that, cause crushing loss to this area's jujube industry, and oriented other the area diffusions of epidemic situation trend (Zhang Runzhi etc.,
2007；Ah's soil fertility sandcastle that etc., 2008).With the high speed development of China's economic, either domestic interzone or international
Commerce and trade and people-to-people contacts all increasingly frequently, the diffusion probability of jujube fly also more and more higher.And once the invasion of jujube fly is new
Region, often to invasion ground fruit-growing industry and agricultural production bring serious consequence, have in addition can cause destroy
The strike of property.The invasion of jujube fly may constitute crushing harm to China's jujube industry production, and fly is mainly distributed on jujube at present
The countries such as Italy, Caucasia, Mauritius, Pakistan, Thailand, Afghanistan, the Turfan in Xinjiang is distributed only in China
Area, and the trend that oriented other areas of epidemic situation are spread.It can be seen that, how current maximum problem realizes the quick detection of jujube fly
Identification.Therefore, the quick inspection and quarantine of jujube fly is more and more important in agricultural safety with plant quarantine.However, jujube fly master
Will be with larva moth food pulp, adult not endanger jujube really, and the production loss that can generally cause is up to more than 20%, occur it is serious can
To cause whole jujube fruits to be compromised, so as to badly influence the product quality of jujube and its commodity value of entirety.It is so far
Only, the morphological feature of the identification Main Basiss adult of the kind of Fruit fly, and ovum, larva, pupa are small due to its feature difference, and
Some features are not sufficiently stable in its different developmental stage, therefore according to Morphological Identification method it is difficult to ensure that identifies is accurate
Degree.Even if the larva of jujube fly can be identified according to morphology, but rely heavily on the abundant identification warp of appraiser
Test, this just constrains the further development of different regions related work.In port quarantine work, generally larva culture is arrived
Adult identified again, and whole quarantine identification process time is up to several weeks, it is impossible to adapt to real work needs (NakaharaSet,
2002；Naeo1eCKMet, 2003；MurajiMet, 2002).Obviously, relying solely on morphological analysis carries out the system hair of trypetid
Educate the research of relation and Identification of Species, it is impossible to mutually coordinate with growing fruit and vegetable Trade Development, be also unfavorable for setting up one
The detection technique system of individual efficiently quick quarantine fruit fly.There is sizable difficulty so as to cause quarantine and prevention and control.
Therefore, it is highly desirable to study the new method of jujube fly Rapid identification, particularly the prematurity such as jujube fly larvae, pupa worm state is fast
Fast authentication method.
At present, identification of the inspection and quarantine department to jujube fly is main using the formalness feature of adult as foundation.But,
The often worm state such as ovum, larva or pupa intercepted and captured, conventional method is to carry out indoor feeding to it, after being reflected again after adult eclosion
Fixed, this needs the detection cycle of 5d-15d, it is impossible to which quick the testing for adapting to inspection and quarantine puts requirement.In interception prematurity worm state
The probability of (larva or pupa) is larger, and generally indoor feeding about needs the time of 5d-15d or so, detection cycle to adult
It is more long, it is impossible to meet the demand that the quarantine of trade fruits and vegetables scene speeds passage through customs, therefore utilize Protocols in Molecular Biology rapid quarantine
Identification pest species have turned into trend.
Species-specific primers PCR (species-specificPCR, SS-PCR) amplification technique is and universal primer PCR
(universal-primersPCR, UP-PCR) technology is distinguished and put forward, the principle of species-specific primers Standard PCR technology
It is similar to regular-PCR amplification, simply when design of primers is carried out according to target sequence, it is necessary to take into full account the specificity of primer, use
The primer of high specificity expands unknown template, by detecting the presence or absence of target fragment, reaches and target species is distinguished with other kinds
The purpose come.However, since jujube fly, in addition to Morphological Identification, at present both at home and abroad also without a set of jujube
Fly specific primer PCR identification technology.
The content of the invention
Report that disclosing jujube fly specific primer PCR specifically designed for quarantine pest jujube fly reflects for having no in the prior art
Determine the state of the art.The present invention in order to provide a kind of method of use specific primer Rapid identification jujube fly, can accurately and
When the ovum of doubtful jujube fly, pupa, larva, adult and residuum for intercepting and capturing etc. are identified, so as to set up a kind of Rapid identification jujube
The method of trypetid.
Technical scheme：The present invention is sequenced by the COI genetic fragments to jujube fly mtDNA, using kind
Specific primer PCR (SS-PCR) and agarose gel electrophoresis (AGE) technology, have filtered out 1 pair of specific primer of jujube fly；According to
According to the proximity of the ovum of jujube fly, larva, pupa and other Fruit fly forms, for citrus fruit fly, melonfly, pumpkin reality
More typical Fruit fly in the quarantine such as fly, Bactrocera correcta, Peach fruits fly, as the negative right of inspection primer specificity
According to, it was demonstrated that in the range of these sibling specieses that experiment is related to, the specificity of the primer pair jujube fly of present invention design, so as to build
The method that Standard PCR identifies jujube fly has been found, the qualification cycle of jujube fly has been substantially reduced.
The present invention specifically provides a kind of method of use specific primer Rapid identification jujube fly, and specific method is as follows：
(1) species-specific primers PCR (SS-PCR) and agarose gel electrophoresis (AGE) technology is applied, 1 pair of jujube has been filtered out
The specific primer CarF and CarR of fly.SS-PCR is carried out on quantitative grads PCR instrument (Biometra), reaction system：
10mmol/L10 × Buffer, 0.25mmol/LMg2+, 0.25mmol/LdNTP, upstream and downstream primer each 0.1umol/L, 1UTaq
Enzyme (Takara), the μ L of template DNA 1 add water to the μ L of cumulative volume 25, and reaction condition is 94 DEG C/5min, 95 DEG C/40s, 57 DEG C/30s,
72 DEG C/1min, 33 circulations, last 72 DEG C of extensions 5min；The μ L of PCR primer 5 are extracted respectively in 1.5% agar containing bromination ingot
Electrophoresis 30min (90V) on the multi-functional electrophoresis apparatus of gel, testing result on digital image analyzer, observe amplified band size and
Width；A pair of specific primers CarF and CarR are obtained, the pair of primers quick, accurate, specific can detect jujube
Each worm state even residuum of fly,
The primer sequence of CarF is CTCAACTAAATTATTCCCCAGCA；
The primer sequence of CarR is GGGTATCAATGCACAAATCCA.
(2) tested using the species specificity of SS-PCR primers：Respectively with single head citrus fruit fly, Bactrocera correcta, melon
Trypetid, pumpkin fruit fly, the DNA of Peach fruits fly is template, and jujube fly is positive control, checks jujube fly specific fragment amplimer
The species specificity of CarF and CarR；In order to check the specificity of CarF and CarR primers under conventional PCR method, removed in experiment material
Outside the jujube fly of differentiation to be identified, also by citrus fruit fly, Bactrocera correcta, melonfly, pumpkin fruit fly, Peach fruits fly etc. other
5 kinds of homology trypetids higher carry out Standard PCR reaction together, and screening obtains the specific primer of energy unique identification jujube fly
After CarF/CarR standard PCR amplification products are by agarose gel electrophoresis, except jujube fly has one specifically at 205bp
Property amplification band outside, negative control and other citrus fruit flies, Bactrocera correcta, melonfly, pumpkin fruit fly, 5 kinds of Peach fruits fly
, without specific targets fragment, so as to prove the primer in the range of these sibling specieses that experiment is related to, energy is specific for trypetid
Identification jujube fly；For this does harm to the common trypetid class of citrus fruit fly, melonfly, pumpkin fruit fly, Bactrocera correcta, Peach fruits fly
Worm is used as the negative control for checking primer specificity.
Specifically, invention further provides a kind of method of use specific primer Rapid identification jujube fly, its tool
Body method step is as follows：
(1) extraction of jujube fly genomic DNA.From the sample of jujube fly, extracted using the method for kit recommendation
Genomic DNA and sequencing.
(2) specific primer design of jujube fly：It is with COI gene orders in target jujube fly mitochondrial DNA (mtDNA)
Target sequence, Serial No. HQ687210, by conventional CLUSTAL methods, the COI genes with the trypetid that oneself knows other species
Sequence is compared analysis, Serial No. FJ571364.1, FJ571365.1 and GQ175824.1, is manually set using primer5
Meter primer, primer primer5 softwares check primer mispairing, dimer and hairpin structure, and with offer in GenBank
Blast program checkout homologous sequences, by screen obtain can unique identification jujube fly special primer CarF and CarR pairs, specifically
Primer sequence is respectively：
The primer sequence of CarF is CTCAACTAAATTATTCCCCAGCA；
The primer sequence of CarR is GGGTATCAATGCACAAATCCA；
The principle of primer screening be all primers under the reaction system and reaction condition of the SS-PCR of standard, can be specifically
Identify jujube fly.
(3) DNA quality examinations：Jujube fly DNA extracts quality and is checked with primer pair can-F/can-R.Primer sequence is
can-F：AAGAGCGACGGGCGATG；can-R：CTAGGATTAGATACCCTATT.The primer pair is used exclusively for checking trypetid
The universal primer of class insect template DNA quality, by after PCR reactions, extracting the μ L of PCR primer 5 respectively containing bromination ingot
Electrophoresis 30min (90V) on the multi-functional electrophoresis apparatus of 1.5% agar gel, testing result on digital image analyzer observes amplified band
Size and width, definite DNA concentration determined by nucleic acid-protein detector.
(4) the species specificity inspection of SS-PCR primers：Respectively with single head citrus fruit fly, Bactrocera correcta, melonfly, pumpkin
Trypetid, the DNA of Peach fruits fly is template, and jujube fly is positive control, inspection jujube fly specific fragment amplimer CarF and
The species specificity of CarR.SS-PCR is carried out on quantitative grads PCR instrument (Biometra), reaction system：10mmol/L10×
Buffer, 0.25mmol/LMg2+, 0.25mmol/LdNTP, each 0.1umol/L of upstream and downstream primer, 1UTaq enzymes (Takara), mould
Plate DNA1 μ L, add water to the μ L of cumulative volume 25, and reaction condition is 94 DEG C/5min, 95 DEG C/40s, 57 DEG C/30s, 72 DEG C/1min, 33
Individual circulation, last 72 DEG C of extensions 5min.The μ L of PCR primer 5 are extracted respectively in the multi-functional electricity of 1.5% agar gel containing bromination ingot
Electrophoresis 30min (90V) on swimming instrument, testing result on digital image analyzer observes the size and width of amplified band.
(5) expanding effect and sensitivity technique of SS-PCR primer pairs difference worm state：Respectively with extract larva, pupa and
The jujube fly DNA of adult difference worm state is template, carries out target fragments expanding effect inspection, takes the adult DNA moulds of various concentrations
Plate carries out the measure of minimum detection threshold value, and the detection limit of SS-PCR methods reaches below 0.1pg, and most suitable template DNA concentration is 1~
20ng。
By implementing the specific content of the invention of the present invention, following beneficial effect can be reached.
(1) present invention is sequenced by the COI genetic fragments to jujube fly mtDNA, devises jujube fly 15 to primer
On the basis of, using species-specific primers PCR (SS-PCR) and agarose gel electrophoresis (AGE) technology, filter out the 1 pair of jujube fly
Specific primer CarF and CarR.Ovum, larva, pupa and other Fruit fly forms for jujube fly is very close, but
Citrus fruit fly, melonfly, pumpkin fruit fly, Bactrocera correcta, Peach fruits fly belong to more typical trypetid class in China's port quarantine
Insect, thus using these species as inspection primer specificity negative control, it was demonstrated that in these sibling specieses for being related to of experiment
In the range of, the specificity of the primer pair jujube fly of present invention design, so as to establish the method that Standard PCR identifies jujube fly, greatly
The big qualification cycle for shortening jujube fly.Carried out quickly using Species specific PCR (species-specificPCR, SS-PCR)
Identify the research of jujube fly technology, it is intended to diffusion is propagated further for effective obstruction jujube fly.
(2) in the prior art, the cycle of trypetid Morphological Identification about need 15~25 days, because detection cycle is more long, it is impossible to full
The demand that the scene quarantine of sufficient trade fruits and vegetables speeds passage through customs.Primer designed by the present invention be able to can be carried out specifically to different worm states
Property amplification, as a result accurately and reliably, show the specificity to jujube fly in the range of these sibling specieses for being related to of experiment, so as to build
The method that Standard PCR identifies jujube fly is found.Long-standing problem Check and Examination of Port quarantine functionary is solved the problems, such as, it is not by material
Limitation, such as individual incompleteness, worm state, as long as the micro DNA of acquisition, adult, larva, pupa, ovum can be detected, the present invention can be by
The identification of jujube fly was shortened within one day, and so as to greatly shorten detection cycle, technical operation is simple and efficient, shortens clearance
Time, improve operating efficiency.Therefore, the technical system can be used for the Testing and appraisal work of jujube fly, and in quarantine evil
There is significant application value in the quarantine and examination of worm and detection monitoring.
Brief description of the drawings
Fig. 1 is can-F/can-R primer PCR template DNA quality electrophoretograms, and in figure, 1 is citrus fruit fly；2 is guava reality
Fly；3 is melonfly；4 is pumpkin fruit fly；5 is Peach fruits fly；6 is jujube fly；7 is negative control (template is water)；M is
DL2000DNAMarker。
Fig. 2 schemes for specific primer PCR specific detection jujubes fly, and in figure, 1 is citrus fruit fly；2 is Bactrocera correcta；3
It is melonfly；4 is pumpkin fruit fly；5 is Peach fruits fly；6 is jujube fly；7 is negative control (template is water)；M is
DL2000DNAMarker。
Fig. 3 is various concentrations jujube fly adult DNA profiling Standard PCR electrophoretogram, and in figure, 1 is 40ng；2 is 20ng；3 are
10ng；4 is 1ng；5 is 0.1ng；6 is 0.01ng；7 is 0.001ng；8 is negative control (template is water)；M is
DL2000DNAMarker。
Fig. 4 is the Standard PCR specific detection figure of jujube fly difference worm state, and in figure, 1 is larva larval；2 is pupa
pupa；3 is adult adult；4 is negative control (template is water)；M is DL2000DNAMarker.
Specific embodiment
Below, the present invention is illustrated for embodiment, but, the present invention is not limited to following embodiments.Equipment in the present invention
Have with material：
The jujube fly (larva, pupa and adult) of use：Pick up from the Shanshan County of In Turfan In Xinjiang, Toksun County and tell Shandong
Kind city different regions place.Citrus fruit fly, melonfly, pumpkin fruit fly, Bactrocera correcta, Peach fruits fly are adult, are gone out by Xinjiang
Passport control Quarantine Bureau provides.All trypetid samples are identified with stereomicroscope, to determine species.For molecular biosciences experiment
Trypetid sample it is alcohol-pickled with 100% and be stored in 4 DEG C of refrigerators.In view of the ovum of jujube fly, larva, pupa and other trypetid classes evil
Worm form is quite similar and be difficult to differentiate between, belong to according to citrus fruit fly, melonfly, pumpkin fruit fly, Bactrocera correcta, Peach fruits fly
More typical Fruit fly in quarantine, thus using these species as inspection primer specificity negative control.Using jujube
Fly reference standard sample is provided using Chinese Academy of Sciences animal.
The enzyme of use and other reagents：The SolutionA of use, SolutionC, RnaseAI, reagent B, Filtercup,
DBbuffer, Spincolumn, RinseA, RinseB include Takara kits wherein, all (big purchased from precious bioengineering
Even) Co., Ltd, Taq enzyme, PCR reaction systems reagent (dNTP, 10 × buffer and Mg2+), agarose, EB,
2000bpLadderMarker is purchased from precious bioengineering (Dalian) Co., Ltd.Animal tissue's genome DNA extracting reagent kit,
Taq enzyme, PCR reaction systems reagent (dNTP, 10 × buffer and Mg2+), agarose, EB, DL2000DNAMarker are purchased from
Biology Co., Ltd of village alliance.
Key instrument equipment：Quantitative grads PCRs instrument (Hua Yue) of Biometra, TGL-1613 table model high speed centrifuges (on
Sea), the multi-functional electrophoresis apparatuses of DYY-12C (Beijing Liuyi Instrument Factory), D56-26M types digital image analyzer (Beijing 61
Instrument plant), ThermoNanodrop2000 ultramicron ultraviolet specrophotometer (Beijing section praise industrial development in science and technology Co., Ltd),
SANYOMLS-3750 full-automatic high-pressures sterilizing instrument (Shanghai golden mean of the Confucian school inspection equipment Co., Ltd), XMTD-4000 water-baths (Beijing
Bright Medical Instruments factory forever of city), MDF-382E (N) SANYO ultra low temperature freezers (Shanghai golden mean of the Confucian school inspection equipment Co., Ltd) etc..
All raw and auxiliary materials, reagent and instrument, the equipment selected in the present invention are all well known in the art selection, but do not limit
Implementation of the invention is made, other some reagents well known in the art and equipment are applied both to the reality of implementation below of the present invention
Apply.
Embodiment one：Using the method for specific primer Rapid identification jujube fly
Using the method for specific primer Rapid identification jujube fly, main inventive point is as follows：
(1) species-specific primers PCR (SS-PCR) and agarose gel electrophoresis (AGE) technology is applied, 1 pair of jujube has been filtered out
The specific primer of fly.SS-PCR is carried out on quantitative grads PCR instrument (Biometra), reaction system：10mmol/L10×
Buffer, 0.25mmol/LMg2+, 0.25mmol/LdNTP, each 0.1umol/L of upstream and downstream primer, 1UTaq enzymes (Takara), mould
Plate DNA1 μ L, add water to the μ L of cumulative volume 25, and reaction condition is 94 DEG C/5min, 95 DEG C/40s, 57 DEG C/30s, 72 DEG C/1min, 33
Individual circulation, last 72 DEG C of extensions 5min；The μ L of PCR primer 5 are extracted respectively in the multi-functional electricity of 1.5% agar gel containing bromination ingot
Electrophoresis 30min (90V) on swimming instrument, testing result on digital image analyzer observes the size and width of amplified band；Obtain a pair
Specific primer CarF and CarR, the pair of primers quick, accurate, specific can detect each worm state of jujube fly very
To being residuum,
The primer sequence of CarF is：CTCAACTAAATTATTCCCCAGCA；
The primer sequence of CarR is GGGTATCAATGCACAAATCCA.
(2) tested using the species specificity of SS-PCR primers：Respectively with single head citrus fruit fly, Bactrocera correcta, melon
Trypetid, pumpkin fruit fly, the DNA of Peach fruits fly is template, and jujube fly is positive control, checks jujube fly specific fragment amplimer
The species specificity of CarF and CarR；In order to check the specificity of CarF and CarR primers under conventional PCR method, removed in experiment material
Outside the jujube fly of differentiation to be identified, also by citrus fruit fly, Bactrocera correcta, melonfly, pumpkin fruit fly, Peach fruits fly etc. other
5 kinds of homology trypetids higher carry out Standard PCR reaction together, and screening obtains the specific primer of energy unique identification jujube fly
After CarF/CarR standard PCR amplification products are by agarose gel electrophoresis, except jujube fly has one specifically at 205bp
Property amplification band outside, negative control and other citrus fruit flies, Bactrocera correcta, melonfly, pumpkin fruit fly, 5 kinds of Peach fruits fly
, without specific targets fragment, so as to prove the primer in the range of these sibling specieses that experiment is related to, energy is specific for trypetid
Identification jujube fly；For this does harm to the common trypetid class of citrus fruit fly, melonfly, pumpkin fruit fly, Bactrocera correcta, Peach fruits fly
Worm is used as the negative control for checking primer specificity.
Specifically, invention further provides a kind of method of use specific primer Rapid identification jujube fly, its tool
Body step is as follows：
(1) extraction of jujube fly genomic DNA.From the sample of jujube fly, extracted using the method for kit recommendation
Genomic DNA and sequencing.
(2) specific primer design of jujube fly：It is with COI gene orders in target jujube fly mitochondrial DNA (mtDNA)
Target sequence, Serial No. HQ687210, by conventional CLUSTAL methods, the COI genes with the trypetid that oneself knows other species
Sequence is compared analysis, Serial No. FJ571364.1, FJ571365.1 and GQ175824.1, is manually set using primer5
Meter primer, primer primer5 softwares check primer mispairing, dimer and hairpin structure, and with offer in GenBank
Blast program checkout homologous sequences, the special primer CarF and CarR of energy unique identification jujube fly are obtained by screening, and are specifically drawn
Thing sequence is respectively, sequence referring specifically to table 1,
The primer sequence of CarF is CTCAACTAAATTATTCCCCAGCA；
The primer sequence of CarR is GGGTATCAATGCACAAATCCA；
The principle of primer screening be all primers under the reaction system and reaction condition of the SS-PCR of standard, can be specifically
Identify jujube fly.
(3) DNA quality examinations：Jujube fly DNA extracts quality and is checked with primer pair can-F/can-R.Primer sequence is
can-F：AAGAGCGACGGGCGATG；
can-R：CTAGGATTAGATACCCTATT.
The primer pair is used exclusively for checking the universal primer of trypetid class insect template DNA quality, after PCR reacts,
The μ L of PCR primer 5 electrophoresis 30min (90V) on containing the bromination multi-functional electrophoresis apparatus of 1.5% agar gel of ingot, number are extracted respectively
Testing result on word image analyzer, observes the size and width of amplified band, and definite DNA concentration passes through nucleic acid-protein detector
Determine.
(4) the species specificity inspection of SS-PCR primers：Respectively with single head citrus fruit fly, Bactrocera correcta, melonfly, pumpkin
Trypetid, the DNA of Peach fruits fly is template, and jujube fly is positive control, inspection jujube fly specific fragment amplimer CarF and
The species specificity of CarR.SS-PCR is carried out on quantitative grads PCR instrument (Biometra), reaction system：10mmol/L10×
Buffer, 0.25mmol/LMg2+, 0.25mmol/LdNTP, each 0.1umol/L of upstream and downstream primer, 1UTaq enzymes (Takara), mould
Plate DNA1 μ L, add water to the μ L of cumulative volume 25, and reaction condition is 94 DEG C/5min, 95 DEG C/40s, 57 DEG C/30s, 72 DEG C/1min, 33
Individual circulation, last 72 DEG C of extensions 5min.The μ L of PCR primer 5 are extracted respectively in the multi-functional electricity of 1.5% agar gel containing bromination ingot
Electrophoresis 30min (90V) on swimming instrument, testing result on digital image analyzer observes the size and width of amplified band.
(5) expanding effect and sensitivity technique of SS-PCR primer pairs difference worm state：Respectively with extract larva, pupa and
The jujube fly DNA of adult difference worm state is template, carries out target fragments expanding effect inspection, takes the adult DNA moulds of various concentrations
Plate carries out the measure of minimum detection threshold value, and the detection limit of SS-PCR methods reaches below 0.1pg, and most suitable template DNA concentration is 1~
20ng。
In the present invention, COI gene order (sequence numbers in target jujube fly mitochondrial DNA (mtDNA) of use：
HQ687210) it is target sequence, the sequence is the first bar jujube fly gene order of applicant.
Embodiment two：DNA quality examinations
Jujube fly DNA extracts quality and is checked with primer pair can-F/can-R.The primer pair is used exclusively for checking trypetid
The universal primer of class insect template DNA quality, quantitative grads PCR instrument reaction system includes 10 × Buffer (being free of Mg2+) 2.5 μ
L, 25mmolMg2+2.5 μ L, 2.5mmoldNTP2.5 μ L, 10 μm of each 1 μ L, 1UTaq enzymes of ol upstream and downstream primers, the μ L of template DNA 1,
The μ L of cumulative volume 25 are added water to, reaction condition is 94 DEG C/5min, and 95 DEG C/40s, 55 DEG C/30s, 72 DEG C/1min, 30 circulate, most
72 DEG C extend 7min afterwards.After PCR reflections terminate, the μ L of PCR primer 5 are extracted respectively many in 1.5% agar gel containing bromination ingot
Electrophoresis 30min (90V) on function electrophoresis apparatus, testing result on digital image analyzer observes the size and width of amplified band, really
The DNA concentration cut determines (Wu Jiajiao etc., 2005 by nucleic acid-protein detector；JamnonglikWet, 2003).
In order to avoid the appearance of false negative phenomenon, jujube fly DNA extracts quality and is checked with primer can-F/can-R, and six
Trypetid template DNA amplification is planted referring to accompanying drawing 1.From accompanying drawing 1：COI gene universal primers successfully expand negative control group
Increase, there is an amplified band position of target fragment between 600-700bp, and luminance difference represents the difference of template concentrations.DNA is true
Concentration and purity are cut by nucleic acid-protein detector to determine.
Embodiment three：SS-PCR identifies jujube fly
Primer specificity is verified：The present invention obtains the specific primer 1 pair of energy unique identification jujube fly by screening, in order to
The specificity of the primer under inspection conventional PCR method, in experiment material in addition to the jujube fly of differentiation to be identified, also by the small reality of tangerine
Other 5 kinds of homologys such as fly, Bactrocera correcta, melonfly, pumpkin fruit fly, Peach fruits fly trypetid higher carries out routine together
PCR reacts, and screening obtains the specific primer CarF/CarR of energy unique identification jujube fly, and standard PCR amplification product is by agar
Sugared gel electrophoresis, referring to accompanying drawing 2.From accompanying drawing 2, in addition to jujube fly has a band for specific amplification at 205bp,
Negative control and other 5 kinds of trypetids are without specific targets fragment, so as to prove these nearly edge that the primer is related in experiment
In the range of kind, can specific identification jujube fly.
The detection sensitivity of SS-PCR methods：The detection sensitivity of SS-PCR methods uses 40ng, 20ng, 10ng respectively,
The jujube fly DNA profiling of 7 kinds of various concentrations such as 1ng, 0.1ng, 0.01ng0.001ng determines, referring to accompanying drawing 3.Can by accompanying drawing 3
See when template concentrations are 0.001ng, do not amplify specific band, only occurred in that when template concentrations are 0.01ng micro
Target stripe, amplified band is very weak, but when template concentrations are more than 0.1ng, can produce specific band.As a result table
Bright, the detection limit of SS-PCR methods reaches below 0.1pg, and most suitable template DNA concentration is 1~20ng.This research is designed to draw
Thing can carry out specific amplification to different worm states, as a result accurately and reliably, show these sibling species scopes being related in experiment
The interior specificity to jujube fly, so as to establish the method that Standard PCR identifies jujube fly.
Applications of the SS-PCR in jujube fly Rapid identification：The reliability of specific primer Standard PCR uses jujube fly respectively
Larva, pupa and adult three kinds of different worm states are verified.Test result indicate that, Standard PCR is not limited by worm state, and different worm states are equal
Energy specific amplification is determined referring to the specificity and the specificity of primer and the concentration of template of the explanation special primer Standard PCR of accompanying drawing 4.
It is fixed, and it is unrelated with the worm state and existing state of sample.SS-PCR products are sequenced：Except carrying out Ago-Gel to SS-PCR products
Electrophoresis, whether have expected consistent outer, while respectively to specifically drawing if checking the specific fragment size of jujube fly special primer amplification
The SS-PCR products of thing are sequenced and are carried out sequence analysis, and sequence is compared with former sequence, further confirm that product
Specificity.Test result indicate that, the sequencing result of PCR primer is consistent with former sequence, and sequence is as follows：
CTCAACTAAATTATTCCCCAGCAATATTATGAGCTTTAGGATTTGTATTTTTATTTACAGTAGGAGGATTAACAGGA
GTAGTATTAGCAAATTCATCAGTTGATATTATTCTTCATGACACTTATTATGTAGTTGCTCATTTTCATTATGTACT
ATCAATAGGAGCTGTATTTGCTATTATAGCTGGATTTGTGCATTGATACCC
Example IV：The Morphological Identification of jujube fly
Morphological observation is carried out to jujube fly larvae and pupa, head feature, valve shape, the tail of Microscopic observation larva is dissected
Portion's feature, valve characteristics of pupa etc., and taken pictures, while carrying out indoor culture to unnecessary larva and pupa.Jujube fly sample
Identification according to the morphological feature of jujube fly, observing each identification position with Stereo microscope includes head, compound eye, beak, mesothorax
Backboard, vein, stern bar, belly, female male worm genitals, basis《Trypetid class important pests identify atlas》Formalness is reflected
It is fixed, so that it is determined that the material used by the present invention is jujube fly.
Embodiment five：Jujube fly genomic DNA is extracted using the method for trypetid type specimen kit
The pupa for taking four-head jujube fly is put into the collecting pipe of ice bath precooling (collectionTube), is quickly ground with grinding rod
Pasty state is worn into, homogenate is ground to form with grinding rod acceleration after the RnaseAI of the SolutionA and 0.9 μ l of 350 μ l of addition, added
The SolutionA of 350 μ l pours the homogenate on grinding rod in collectionTube, and 65 DEG C are incubated after fully vibration is mixed
After 5min, the reagent B of 4 μ l is added, after fully mixing, adds the solution S olutionC of the prior precoolings in 4 DEG C of refrigerators of 1ml,
Rear 12000rpm centrifugations 3min is sufficiently mixed, one layer of clear liquid above is removed, the molten of the prior precoolings in 4 DEG C of refrigerators of 1ml is added
Liquid SolutionC, 12000rpm centrifugations 2min after concussion mixing；Removing carries blue organic phase clear liquid for one layer above, then will
In Filtercup of the aqueous phase solution transposition of colourless lower floor above collectionTube, 12000rpm centrifugation 1min are removed
Filtercup, DBbuffer400 μ l is added in filtrate and is fully mixed, and the Spincolumn in kit is placed in
On collectionTube, 12000rpm centrifugation lmin remove remaining liquid after filtering；By the RinseA of 500 μ l add to
12000rpm centrifugations 30sec, removes remaining liquid after filtering in Spincolumn；Add 700 μ l's in Spincolumn
RinseB carries out centrifugation 12000rpm30sec, removes remaining liquid after filtering；Spincolumn in kit is placed in
On collectionTube, 12000rpm centrifugation 1min remove remaining liquid after filtering；Spincolumn is placed in
On the centrifuge tube of 1.5ml, stand a few minutes, after waiting alcohol to be evaporated completely, by the sterile purified water of 60-100 μ l or
ElutionBuffer is added in the centre of Spincolumn films, and 1min is placed at ambient temperature, is centrifuged through 12000rpm
1min, eluted dna.
In above-mentioned steps, because upper strata (organic phase) is with blueness, it is necessary to eliminate.Prepared to prevent DNA to be attached to DNA
On film, it is not necessary to consider INTERPHASE CARBIDE PRECIPITATION, will be removed in filtering.
In above-mentioned steps, whether PLSCONFM is by the absolute ethyl alcohol addition RinseB of designated volume.Should be along during addition
Spincolumn tube wall surroundings, the salinity that will can so stick to completely on tube wall is rinsed well.
In above-mentioned steps, the distilled water after ElutionBuffer or sterilizing should be heated to 65 DEG C, had when so using
Beneficial to raising elution efficiency.
SEQUENCE LISTING
<110>Sichuan Ke Jing bio tech ltd
<120>A kind of method of use specific primer Rapid identification jujube fly
<130> 2017
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 44
<212> DNA
<213>Artificial sequence
<400> 1
ctcaactaaa ttattcccca gcagggtatc aatgcacaaa tcca 44
Claims (1)
1. a kind of method of use specific primer Rapid identification jujube fly, it is characterised in that specific method step is as follows：
(1) extraction of jujube fly genomic DNA：From the sample of jujube fly, gene is extracted using the method for kit recommendation
Group DNA and sequencing；
(2) specific primer design of jujube fly：COI gene orders are as target with target jujube fly mitochondrial DNA (mtDNA)
Sequence, Serial No. HQ687210, by conventional CLUSTAL methods, the COI gene orders with the trypetid of known other species
Analysis, Serial No. FJ571364.1, FJ571365.1 and GQ175824.1 are compared, are drawn using primer5 engineers
Thing, primer primer5 softwares check primer mispairing, dimer and hairpin structure, and with the Blast journeys of offer in GenBank
Sequence checks homologous sequence, by screen obtain can unique identification jujube fly a pair of special primer CarF and CarR, special primer
Sequence is respectively：
The primer sequence of CarF is CTCAACTAAATTATTCCCCAGCA；
The primer sequence of CarR is GGGTATCAATGCACAAATCCA；
The principle of primer screening be all primers under the reaction system and reaction condition of the SS-PCR of standard, can specifically identify
Go out jujube fly；
(3) DNA quality examinations：Jujube fly DNA extracts quality and is checked with primer pair can-F/can-R；Primer sequence is can-
F：AAGAGCGACGGGCGATG；can-R：CTAGGATTAGATACCCTATT；The primer pair is used exclusively for checking trypetid class elder brother
The universal primer of worm template DNA quality, by after PCR reactions, extracting the μ L of PCR primer 5 respectively in 1.5% fine jade containing bromination ingot
On the multi-functional electrophoresis apparatus of fat gel under 90V voltages electrophoresis 30min, testing result on digital image analyzer, observe amplified band
Size and width, definite DNA concentration determined by nucleic acid-protein detector；
(4) the species specificity inspection of SS-PCR primers：Respectively with single head citrus fruit fly, Bactrocera correcta, melonfly, pumpkin reality
Fly, the DNA of Peach fruits fly is template, and jujube fly is positive control, inspection jujube fly specific fragment amplimer CarF and CarR
Species specificity；SS-PCR is carried out on quantitative grads PCR instrument, reaction system：10mmol/L10 × Buffer, 0.25mmol/
LMg2+, 0.25mmol/LdNTP, each 0.1umol/L of upstream and downstream primer, 1UTaq enzymes, the μ L of template DNA 1 add water to the μ of cumulative volume 25
L, reaction condition is 94 DEG C/5min, 95 DEG C/40s, 57 DEG C/30s, 72 DEG C/1min, 33 circulations, last 72 DEG C of extensions 5min；
The μ L of PCR primer 5 electrophoresis under 90V voltages on containing the bromination multi-functional electrophoresis apparatus of 1.5% agar gel of ingot is extracted respectively
30min, testing result on digital image analyzer observes the size and width of amplified band；
(5) expanding effect and sensitivity technique of SS-PCR primer pairs difference worm state：Respectively with the larva of extraction, pupa and adult
The jujube fly DNA of different worm states is template, carries out target fragments expanding effect inspection, and the adult DNA profiling for taking various concentrations enters
The measure of the minimum detection threshold value of row, the detection limit of SS-PCR methods reaches below 0.1pg, and most suitable template DNA concentration is 1~
20ng。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710190671.2A CN106906291A (en) | 2017-03-28 | 2017-03-28 | A kind of method of use specific primer Rapid identification jujube fly |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710190671.2A CN106906291A (en) | 2017-03-28 | 2017-03-28 | A kind of method of use specific primer Rapid identification jujube fly |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106906291A true CN106906291A (en) | 2017-06-30 |
Family
ID=59195163
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710190671.2A Pending CN106906291A (en) | 2017-03-28 | 2017-03-28 | A kind of method of use specific primer Rapid identification jujube fly |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106906291A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113604586A (en) * | 2021-09-03 | 2021-11-05 | 上海市园林科学规划研究院 | Specific primer of bark beetle of black branch |
| CN113817848A (en) * | 2021-10-28 | 2021-12-21 | 青岛农业大学 | Method for detecting Bactrocera minax (Royle) comatus based on visual LAMP technology and application |
-
2017
- 2017-03-28 CN CN201710190671.2A patent/CN106906291A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113604586A (en) * | 2021-09-03 | 2021-11-05 | 上海市园林科学规划研究院 | Specific primer of bark beetle of black branch |
| CN113817848A (en) * | 2021-10-28 | 2021-12-21 | 青岛农业大学 | Method for detecting Bactrocera minax (Royle) comatus based on visual LAMP technology and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104313175B (en) | LAMP detection primer composition for phytophthora infestans and LAMP detection kit and LAMP detection method of LAMP detection primer composition | |
| CN105779652A (en) | Multiple RT-PCR method for fast detecting four kinds of pepper viruses | |
| CN105255883B (en) | A kind of PCR primer differentiating carpocapsa pononella clone and discrimination method thereof | |
| CN104017891B (en) | Application of septin1 gene to detection of nosema bombycis | |
| CN104017890A (en) | Application of EB1 gene to detection of nosema bombycis | |
| CN103276067B (en) | A kind of method adopting Auele Specific Primer Rapid identification jujube fly | |
| CN104593502B (en) | Loop-mediated isothermal amplification primer composition capable of detecting colletotrichum truncatum and application thereof | |
| CN106906291A (en) | A kind of method of use specific primer Rapid identification jujube fly | |
| CN103014152A (en) | LAMP (loop-mediated isothermal amplification) primer, kit and detecting method for detecting phytophthora sojae | |
| CN107988383B (en) | LAMP primer group and method for rapidly detecting meloidogyne incognita from complex sample | |
| MacKenzie et al. | RT-PCR and real-time RT-PCR methods for the detection of potato virus Y in potato leaves and tubers | |
| CN108559783B (en) | RPA primer, kit and detection method for detecting four common root-knot nematodes | |
| CN104178577B (en) | Method and kit for detecting resistance of plutella xylostella (L.) to insecticidal protein Cry1Ac generated by Bt (bacillus thuringiensis) based on ABCC2 (ATP-binding cassette C2) gene | |
| CN105671205B (en) | Detect the RT-LAMP primer sets and kit of apis cerana metacercoid virus | |
| CN114728872B (en) | Method for producing 3,5-dihydroxy-4-methoxybenzyl alcohol from plankton | |
| CN103898225B (en) | A kind of primer and discrimination method differentiating the hidden kind of Bemisia tabaci and trialeurodes vaporariorum | |
| CN101928771A (en) | Multiplex PCR method for quickly identifying species of chicken coccidia and kit | |
| CN107022615A (en) | LAMP primer group, kit and detection method for detecting pine wood nematode | |
| CN106520995B (en) | A kind of the LAMP primer group and its detection method of the quick withered nematode of Testing and appraisal florists chrysanthemum leaf | |
| CN115029484A (en) | RT-PCR detection method for papaya ringspot virus PRSV carried by cucurbitaceae seeds | |
| CN104178578B (en) | Detection method and its kit of the diamondback moth based on ABCC3 genes to Bt Cry1Ac protein resistances | |
| CN104328189A (en) | Primer combination for detecting Phialophora gregata by loop-mediated isotherm amplification technique and application thereof | |
| CN102367484B (en) | Method for detecting single root knot of enterolobium cyclocarpum meloidogyne and application thereof | |
| CN104313176B (en) | LAMP (loop-mediated isothermal amplification) detection primer combination for phytophthora palmivora, and LAMP detection kit and LAMP detection method thereof | |
| Wongkamchai et al. | Rapid differentiation of filariae in unstained and stained paraffin-embedded sections by a high-resolution melting analysis PCR assay |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170630 |
|
| WD01 | Invention patent application deemed withdrawn after publication |