CN106906223B - A kind of application of soybean salt-tolerance gene GmMYB173 and its expression vector and expression vector - Google Patents
A kind of application of soybean salt-tolerance gene GmMYB173 and its expression vector and expression vector Download PDFInfo
- Publication number
- CN106906223B CN106906223B CN201710271602.4A CN201710271602A CN106906223B CN 106906223 B CN106906223 B CN 106906223B CN 201710271602 A CN201710271602 A CN 201710271602A CN 106906223 B CN106906223 B CN 106906223B
- Authority
- CN
- China
- Prior art keywords
- gmmyb173
- pdl28
- rfp
- expression vector
- digestion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Abstract
The present invention relates to the applications of a kind of soybean salt-tolerance gene GmMYB173 and its expression vector and expression vector, provide a kind of soybean salt-tolerance gene GmMYB173, nucleotide sequence is as shown in SEQ ID No.1.Soybean salt-tolerance gene GmMYB173 provided by the invention can be improved the salt resistance ability of soybean.
Description
Technical field
The invention belongs to technical field of molecular biology more particularly to a kind of soybean salt-tolerance gene GmMYB173 and its expression
The application of carrier and expression vector.
Background technique
The soil salinization is a global ecological problem, and irrigation soils of the whole world close to 20% are by saliferous
It threatens, and salinization of cultivated land situation is increasingly severe.Wherein, there are about 34,600,000 hectares of soils to endanger by salination in China, about
Account for the 25% of national arable area.It is even dead that the salinity of soil middle and high concentration causes plant growth to slow down, and is limitation crop
One of main abiotic stress factor of yield.
Studies have shown that salt stress mainly passes through Na in soil+Plant is caused to damage, Na+Cause peroxide after into cell
The accumulation of compound, excessive activating oxide can damage the structure and function of protein, nucleic acid and other macromoleculars, or even lead
Cause cell death.Under the conditions of eubolism, the generation and removing of intracellular reactive oxide are in dynamic equilibrium.Once losing
It goes to balance, activating oxide will attack the amino acid residue of protein.To resist the harm of activating oxide caused by salt stress, plant
Object forms a series of mechanism of scavenging capacity oxides during evolution, includes two systems of enzymatic and non-enzymatic, enzymatic
System includes superoxide dismutase, ascorbate peroxidase enzyme etc.；Non-enzyme antioxidant is mainly some small-molecular-weights
Organic matter, including ascorbic acid, glutathione, mannitol and flavonoids etc..
Flavonoid substances play very important role in the response that plant resists various environment stresses.Yan etc.
(2014) studies have shown that soybean can be improved to salt stress by the metabolism of regulation flavonoid substances in soybean flavonoids synzyme
Tolerance level.In addition in flavonoids biosynthetic process, myb transcription factor plays key regulatory, can regulate and control synthesis
The expression of key gene (such as GmF3H, GmCHS, GmCHI and GmFNSII) in approach, present invention discover that a kind of MYB transcription because
Sub- GmMYB173, be to the raising of the tolerance level of salt stress to soybean it is positively related, summary of the invention is as follows.
Summary of the invention
In view of this, in view of the above-mentioned deficiencies in the prior art, it is an object of the present invention to and providing a kind of soybean salt-tolerance gene
GmMYB173 can be improved the salt resistance ability of soybean.
The present invention provides a kind of soybean salt-tolerance gene GmMYB173, and nucleotide sequence is as shown in SEQID No.1.
The present invention also provides the coding protein of soybean salt-tolerance gene GmMYB173 a kind of, amino acid sequence such as SEQID
Shown in No.2.
The present invention also provides the expression vectors for the resistant gene of salt GmMYB173 that above-mentioned technical proposal provides, including pDL28-
HA-GmMYB173-RFP, pDL28-HA-GmMYB173-59A-RFP, pDL28-HA-GmMYB173-59D-RFP or pDL28-
HA-RNAiMYB173-RFP。
The expression vector obtained the present invention also provides above scheme is cultivating the application in salt-resistant plant.
The present invention provides a kind of soybean salt-tolerance gene GmMYB173, and nucleotide sequence is as shown in SEQ ID No.1.Soybean
Resistant gene of salt GmMYB173 can reduce peroxide content in soybean root system, to promote soybean to the adaptation energy of saline-alkali environment
Power.According to embodiments of the present invention it is found that soybean salt-tolerance gene GmMYB173 provided by the invention can be improved the salt tolerant energy of soybean
Power.
Detailed description of the invention
Fig. 1 is experimental group salt stress phenotypic results, and EV indicates wild type, and OE indicates that overexpression, 59A indicate GmMYB173
The 59th threonine of albumen is mutated into glycine (neutrality is similar not to be phosphorylated), and 59D indicates the 59th, GmMYB173 albumen
Threonine is mutated into aspartic acid (negative to select similar be phosphorylated), point mutation 59D (adding salt), point mutation 59D (salt is not added), KD
Indicate that gene silencing, control indicate control group (salt treatment is not added), NaCl (+) indicates experimental group (adding salt treatment).
Specific embodiment
The present invention provides a kind of soybean salt-tolerance gene GmMYB173, and nucleotide sequence is as shown in SEQ ID No.1.
The present invention preferably uses Beijing health to have for century biotechnology the acquisition of the soybean salt-tolerance gene GmMYB173
The RNApure Plant Kit and HiFiScript 1st Strand cDNA Synthesis Kit of limit company production
HiFiScript cDNA is acquired, what the method for the acquisition was sold according to Beijing CoWin Bioscience Co., Ltd.
The operation instructions of kit carry out.
The present invention also provides the coding protein of soybean salt-tolerance gene GmMYB173 a kind of, amino acid sequence such as SEQID
Shown in No.2.
The present invention also provides the expression vectors for the resistant gene of salt GmMYB173 that above-mentioned technical proposal provides, including pDL28-
HA-GmMYB173-RFP, pDL28-HA-GmMYB173-59A-RFP, pDL28-HA-GmMYB173-59D-RFP or pDL28-
HA-RNAiMYB173-RFP.The present invention is not particularly limited the source of the pDL28-HA-RFP, using those skilled in the art
The commercial goods that member routinely selects.
In the present invention, the 59A in the expression vector pDL28-HA-GmMYB173-59A-RFP is GmMYB173 gene
59th threonine of coding protein is sported glycine, and the codon of glycine herein is GCC.The expression carries
59D in body pDL28-HA-GmMYB173-59D-RFP is the 59th threonine quilt of GmMYB173 DNA encoding the protein
Aspartic acid is sported, the codon of aspartic acid herein is GAC.The expression vector pDL28-HA-RNAiMYB173-
The RNA interference fragment that RNAiMYB173 in RFP is GmMYB173.
In the present invention, the pDL28-HA-GmMYB173-RFP construction method the following steps are included:
1) carrier pDL28-HA-RFP obtains carrier digestion products through I double digestion of Sac I and Kpn；
2) cloning vector GmMYB173Tvector obtains cloning vector digestion products through I double digestion of Sac I and Kpn；
3) the carrier digestion products that the step 1) obtains and the cloning vector digestion products that step 2) obtains are mixed, even
It connects, obtains pDL28-HA-GmMYB173-RFP；
The step 1) and step 2) are limited without time sequencing.
In the present invention, the system of the digestion in the step 1) preferably includes: I 2ul of pDL28-HA-RFP 1ug, Sac,
Kpn I 2ul, 2ul 10 × Kbuffer, 2ul 0.1%BSA, distilled water complement to 20ul.The condition of the digestion is preferably 25
~42 DEG C of reactions 1~3h, more preferably 30~40 DEG C reactions 1.5~2.5h, most preferably 37 DEG C reaction 2h.The present invention is to above-mentioned
The source of reagent is not particularly limited, the commercial product routinely selected using those skilled in the art.
In the present invention, using Beijing CoWin Bioscience Co., Ltd. production RNApure Plant Kit and
HiFiScript 1st Strand cDNA Synthesis Kit HiFiScript cDNA acquires GmMYB173 gene
GmMYB173 genetic fragment is attached with carrier T, obtains cloning vector GmMYB173T vector by segment.In the present invention
In, the system of the connection are as follows: PCR product GmMYB173 genetic fragment 50ng, carrier T 1ul, distilled water complement to 5ul.Institute
The condition for stating connection preferably includes 20~30 DEG C of reaction 20~40min, more preferably 22~28 DEG C reaction 25~30min, optimal
It is selected as 25 DEG C of reaction 30min.The present invention is not particularly limited the source of mentioned reagent, is routinely selected using those skilled in the art
Commercial product.
In the present invention, the system of the digestion in the step 2) preferably includes: cloning vector 1ug, SacI2ul, KpnI
2ul, 2ul 10 × Kbuffer, 2ul 0.1%BSA, distilled water complement to 20ul.The condition of the digestion is preferably 25~42
DEG C reaction 1~3h, more preferably 30~40 DEG C reactions 1.5~2.5h, most preferably 37 DEG C reaction 2h.The present invention is to mentioned reagent
Source be not particularly limited, the commercial product routinely selected using those skilled in the art.
The carrier digestion products that the step 1) obtains are mixed with the cloning vector digestion products that step 2) obtains, even
It connects, obtains pDL28-HA-GmMYB173-RFP.In the present invention, the system of the connection preferably includes: GmMYB173T
Vector segment 200ng, pDL28-HA-RFP segment 1ul, T4DNA ligase 1ul, T4DNA buffer 1ul, is mended with distilled water
Enough to 10ul.In the present invention, the condition of the connection is preferred are as follows: 10~25 DEG C of connections are stayed overnight, more preferably 14~20 DEG C of companies
Night is taken over, most preferably 16 DEG C connections are overnight.The present invention is not particularly limited the source of mentioned reagent, using art technology
The commercial product that personnel routinely select.
After the present invention obtains expression vector pDL28-HA-GmMYB173-RFP, to expression vector pDL28-HA-
The step of GmMYB173-RFP is verified, the verifying preferably includes: using OEMYB173-F and OEMYB173-R as primer into
Row PCR verifying expression vector pDL28-HA-GmMYB173-RFP shows if electrophoresis obtains the single bright band of 0.9k or so
To expression vector pDL28-HA-GmMYB173-RFP.
In the present invention, the amplification system is preferred are as follows: pDL28-HA-GmMYB173-RFP 0.5ul, OEMYB173-F
(10pmol/ μ L) 1ul, OEMYB173-R (10pmol/ μ L) 1ul, Primer STAR Mix 10ul, ddH2O 7.5ul.It is described
The program of amplification is preferably 94 DEG C of 5min, 94 DEG C of 30sec, 53 DEG C of 30sec, and 38 recycle, 72 DEG C of 1min, 72 DEG C of 10min, and 4 DEG C
It saves.
In the present invention, the sequence of the OEMYB173-F (SEQ ID No.9) and OEMYB173-R (SEQ ID No.10)
Column are as follows:
OEMYB173-F:CGAGCTCATGTCTCGCGCCTCCTCCOEMYB173-R:GGGGTACCAGCAACACTAATG
ATGCTTTCTCC。
In the present invention, also preferable to the verifying of the expression vector pDL28-HA-GmMYB173-RFP are as follows: using limit
Property restriction endonuclease Sac I and Kpn I processed to expression vector pDL28-HA-GmMYB173-RFP carry out double digestion, after the digestion to
The digestion products arrived carry out electrophoresis and show to obtain expression vector pDL28- if electrophoresis obtains two bright bands of 0.8k and 10k or so
HA-GmMYB173-RFP。
In the present invention, the system of the double digestion is preferred are as follows: including pDL28-HA-GmMYB173-RFP1ug, Sac I
2ul, Kpn I 2ul, 2ul 10 × Kbuffer, 2ul 0.1%BSA, distilled water complement to 20ul.The condition of the double digestion is excellent
It is selected as 25~42 DEG C of reactions 1~3h, more preferably 30~40 DEG C reactions 1.5~2.5h, most preferably 37 DEG C reaction 2h.The present invention
The source of mentioned reagent is not particularly limited, the commercial product routinely selected using those skilled in the art.
In the present invention, the expression vector pDL28-HA-GmMYB173-59A-RFP and expression vector pDL28-HA-
The construction method of GmMYB173-59D-RFP preferably includes following steps:
1) using cloning vector GmMYB173T vector as template, drawn respectively with MYB173S59A-F and MYB173S59A-R
Object carries out cyclic amplification to, MYB173S59D-F and MYB173S59D-R primer pair, respectively obtains MYB173S59A amplified production
With MYB173S59D amplified production；
2) the MYB173S59A amplified production and MYB173S59D amplified production obtained the step 1) respectively with carrier T
It is attached, obtains MYB173S59A connection product and MYB173S59D connection product；
3) the MYB173S59A connection product and MYB173S59D connection product obtained the step 2) is respectively through Sac I
With I double digestion of Kpn, MYB173S59A segment and MYB173S59D segment are obtained；
4) carrier pDL28-HA-RFP is obtained into pDL28-HA-RFP segment through I double digestion of Sac I and Kpn；
5) MYB173S59A segment and MYB173S59D segment that the step 3) obtains are obtained with step 4) respectively
PDL28-HA-RFP segment is attached, and respectively obtains expression vector pDL28-HA-GmMYB173-59A-RFP and expression vector
pDL28-HA-GmMYB173-59D-RFP；
The step 3) and step 4) are limited without time sequencing.
In the present invention, the system of amplification preferably includes template GmMYB173T vector clone's load in the step 1)
Body 80ng, primer each 1ul, high fidelity enzyme 2ul complement to 20ul with distilled water.The program of the cyclic amplification is preferred are as follows: 94 DEG C
5min, 94 DEG C of 30sec, 53 DEG C of 30sec, 30 circulations, 72 DEG C of 1min, 72 DEG C of 10min, 4 DEG C of preservations.The present invention is to mentioned reagent
Source be not particularly limited, the commercial product routinely selected using those skilled in the art.
In the present invention, the MYB173S59A-F (SEQ ID No.5) and MYB173S59A-R (SEQ ID No.6),
The sequence of MYB173S59D-F (SEQ ID No.7) and MYB173S59D-R (SEQ ID No.8) are preferably as follows:
MYB173S59A-F:GTCGTCGGCGGCGGCGTAACCGG
MYB173S59A-R:CCGGTTACGCCGCCGCCGACGAC
MYB173S59D-F:GGCGTCGTCGGCGTCGGCGTAACCGGCG
MYB173S59D-R:CGCCGGTTACGCCGACGCCGACGACGCC。
In the present invention, using Beijing CoWin Bioscience Co., Ltd. production RNApure Plant Kit and
HiFiScript 1st Strand cDNA Synthesis Kit HiFiScript cDNA acquires GmMYB173 gene
GmMYB173 genetic fragment is attached with carrier T, obtains cloning vector GmMYB173T vector by segment.In the present invention
In, the system of the connection are as follows: PCR product GmMYB173 genetic fragment 50ng, carrier T 1ul, distilled water complement to 5ul.Institute
The condition for stating connection preferably includes 20~30 DEG C of reaction 20~40min, more preferably 22~28 DEG C reaction 25~30min, optimal
It is selected as 25 DEG C of reaction 30min.The present invention is not particularly limited the source of mentioned reagent, is routinely selected using those skilled in the art
Commercial product.
After obtaining amplified production, by MYB173S59A amplified production and MYB173S59D amplified production respectively with carrier T into
Row connection, obtains MYB173S59A connection product and MYB173S59D connection product.The system of the connection is preferably that PCR is produced
Object GmMYB173 genetic fragment 45ng, carrier T 1ul, distilled water complement to 5ul.The condition of connection is preferably 25 DEG C of reactions
30min.The present invention is not particularly limited the source of mentioned reagent, the commercial product routinely selected using those skilled in the art
?.
After obtaining MYB173S59A connection product and MYB173S59D connection product, by the MYB173S59A connection product
With MYB173S59D connection product respectively through I double digestion of Sac I and Kpn, MYB173S59A segment and MYB173S59D piece are obtained
Section.In the present invention, the system of the digestion is preferably cloning vector 1ug, and Sac I 2ul, Kpn I 2ul, 2ul 10 ×
Kbuffer, 2ul 0.1%BSA, distilled water complement to 20ul.The double conditions cut of the enzyme are preferably 37 DEG C of reaction 2h.The present invention
The source of mentioned reagent is not particularly limited, the commercial product routinely selected using those skilled in the art.
In the present invention, the carrier pDL28-HA-RFP obtains pDL28-HA-RFP piece through I double digestion of Sac I and Kpn
Section.In the present invention, the system of the double digestion is preferred are as follows: carrier pDL28-HA-RFP 1ug, Sac I 2ul, I 2ul of Kpn,
2ul 10 × Kbuffer, 2ul 0.1%BSA, distilled water complement to 20ul.In the present invention, the condition of the double digestion is preferred
For 25~42 DEG C of reactions 1~3h, more preferably 30~40 DEG C reactions 1.5~2.5h, most preferably 37 DEG C reaction 2h.The present invention couple
The source of mentioned reagent does not have particular/special requirement, the commercial product routinely selected using those skilled in the art.
In the present invention, by obtained MYB173S59A segment and MYB173S59D segment respectively with pDL28-HA-RFP piece
Section mixing, connection, obtain expression vector pDL28-HA-GmMYB173-59A-RFP and expression vector pDL28-HA-GmMYB173-
59D-RFP。
In the present invention, the MYB173S59A segment and MYB173S59D segment connect with pDL28-HA-RFP segment respectively
The system connect preferably includes: MYB173S59A segment or MYB173S59D segment 200ng, pDL28-HA-RFP segment 1ul,
T4DNA ligase 1ul, T4DNA buffer 1ul, distilled water complement to 10ul.The condition of the connection is preferably 16 DEG C and connected
Night.The present invention is not particularly limited the source of mentioned reagent, the reagent routinely selected using those skilled in the art.
In the present invention, the construction method of the expression vector pDL28-HA-RNAiMYB173-RFP preferably includes following
Step:
1) the silencing piece in GmMYB173 complete sequence is found out using software (Oligoengine Workstation 2)
Section, the silencing segment is as shown in SEQ ID No.3, with the silencing segment (as GmMYB173-1 forward direction chain-ordering) for mould
Version design obtains RNAiMYB173 primer, then carries out cyclic amplification by template of SEQ ID No.3 sequence, obtains RNAiMYB173
Sequence；
2) the RNAiMYB173 sequence that the step 1) obtains is connect with carrier T, obtains RNAiMYB173-T carrier；
3) the RNAiMYB173-T carrier obtained using Xba I and III digestion step 2) of Hind, obtains RNAiMYB173-T enzyme
Product is cut, using III digestion PKANNBAL carrier of Xba I and Hind, PKANNBAL digestion products are obtained, by RNAiMYB173-T enzyme
Cut product, PKANNBAL digestion products are connect with No. GmMYB1731 positive chain with T4 carrier, obtain pKANNIBAL-MYB173-
1；
4) pKANNIBAL-MYB173-1 obtained using step 3) described in I digestion of Kpn I and EcoR, is obtained
PKANNIBAL-MYB173-1 digestion products, the RNAiMYB173-T carrier obtained using Kpn I and I digestion step 2 of EcoR, are obtained
To RNAiMYB173-T carrier digestion products (as GmMYB1732 reverse strand), pKANNIBAL-MYB173-1 digestion is produced
Object and RNAiMYB173-T carrier digestion products are connect with T4 carrier, obtain PKANNIBAL-RNAi-MYB173 (at this point,
No. GmMYB1731 positive chain, because restriction enzyme used in digestion is different, has formed reverse mutual with GmMYB1732 reverse strand
It mends)；
5) PKANNIBAL-RNAi-MYB173 obtained using step 4) described in I digestion of Sal I and Spe, is obtained
PKANNIBAL-RNAi-MYB173 digestion products obtain pDL28-HA-RFP using I digestion pDL28-HA-RFP of Sal I and Spe
PKANNIBAL-RNAi-MYB173 digestion products, pDL28-HA-RFP digestion products connect with T4 carrier, obtain by digestion products
To expression vector pDL28-HA-RNAiMYB173-RFP；
The sequence of described No. MYB1731 positive chain is as shown in SEQ ID No.3；
The sequence of the MYB1732 reverse strand is as shown in SEQ ID No.4.
In the present invention, the sequence of the RNAiMYB173 primer in the step 1) is as follows:
RNAiMYB173-F(SEQ ID No.11):
CGGGGTACCAAGCTTAACCTCTCACAGTACGAGCATCC
RNAiMYB173-R(SEQ ID No.12):
CCGGAATTCTCTAGAGGCACATTATGTTTTTCCACG。
In the present invention, the system of cyclic amplification is preferably pDL28-HA-GmMYB173-RFP in the step 1)
50ng, RNAiMYB173-F (10pmol/ μ L) 1ul, RNAiMYB173-R (10pmol/ μ L) 1ul, Primer
STARMix10ul, ddH2O 7.5ul.The program of the amplification is preferably 94 DEG C of 5min, 94 DEG C of 30sec, 53 DEG C of 30sec, and 38
Circulation, 72 DEG C of 1min, 72 DEG C of 10min, 4 DEG C of preservations.The present invention is not particularly limited the source of mentioned reagent, using this field
The commercial product that technical staff routinely selects.
In the present invention, the RNAiMYB173 sequence and the system of carrier T connection are preferably PCR product GmMYB173
Genetic fragment 50ng, carrier T 1ul, distilled water complement to 5ul.The condition of the connection is preferably 25 DEG C of 30min.The present invention couple
The source of mentioned reagent is not particularly limited, the commercial product routinely selected using those skilled in the art.
In the present invention, the system of the digestion in the step 3) be preferably No. 1 forward direction chain 1ug of cloning vector or
PKANNIBAL carrier 1ugKpn I 2ul and EcoR I 2ul, 2ul 10 × Kbuffer, 2ul 0.1%BSA, distilled water complement to
20ul.Most preferably 37 DEG C reaction 2h.The digestion products, the body of No. MYB1731 positive chain and the connection of pKANNIBAL segment
System's preferably No. MYB1731 positive chain segment 100ng, pKANNIBAL segment 100ng, T4DNA ligase 1ul, T4DNA buffering
Liquid 1ul, distilled water complement to 10ul.The condition of the connection is preferably that 16 DEG C of connections are stayed overnight, and obtains pKANNIBAL-
MYB173-1 carrier.The present invention is not particularly limited the source of mentioned reagent, is routinely selected using those skilled in the art
Commercial product.
In the present invention, the sequence of described No. MYB1731 positive chain is as shown in SEQ ID No.3.
In the present invention, the system of the digestion in the step 4) is preferably each 1ug of carrier, and III enzyme of XbaI, Hind is each
2ul, 2ul 10 × M buffer, distilled water complement to 20ul.The condition of the digestion is preferably 37 DEG C of digestion 2h.The digestion
Product, MYB1732 reverse strand and pKANNIBAL-MYB173-1 carrier, the system of T4 connection are preferably No. MYB1732 anti-
To chain segment and each 100ng of pKANNIBAL-MYB173-1 carrier, T4DNA ligase 1ul, T4DNA buffer 1ul, distilled water
Complement to 10ul.The condition of the connection is preferably that 16 DEG C of connections are stayed overnight.The present invention does not have special limit to the source of mentioned reagent
It is fixed, the commercial product routinely selected using those skilled in the art.
In the present invention, the sequence of the MYB1732 reverse strand is as shown in SEQ ID No.4.
The expression vector obtained the present invention also provides above scheme is cultivating the application in salt-resistant plant.In the present invention
In, the plant is preferably bean.
Provided by the invention kind of soybean salt-tolerance gene GmMYB173 and its expression vector are carried out below with reference to embodiment detailed
Thin explanation, but they cannot be interpreted as limiting the scope of the present invention.
Embodiment 1
The clone of GmMYB173 gene:
The extraction of 1.1 soybean total serum IgEs:
1.1.1 liquid nitrogen is poured into mortar in advance, be placed directly in grinding and grind from the new fresh root sample 100mg of clip in soybean
Mill, obtains powder, powder is moved in preprepared 1.5ml Ep pipe, beta -mercaptoethanol, β-sulfydryl second are added in Ep pipe
The volume of alcohol is the 1% of powder volume, and the health for adding 600ul is ShiJi Co., Ltd RLC or RL.
1.1.2 be vortexed 1min, then stands 5min on ice, cracks sample sufficiently.
1.1.3 lysate obtained above is slowly transferred to 2mL centrifuge tube, is centrifuged under conditions of 4 DEG C, 12000rpm
2min；
1.1.4 prepare new 1.5ml RNase-Free centrifuge tube, the filtrate in step 3) is transferred in centrifuge tube, be added
The dehydrated alcohol of 0.5 times of volume, rapid oscillation mix.
1.1.5 the mixed liquor in 1.1.4) is packed into 2mL Spin Column pipe, 12000rpm abandons filter after being centrifuged 5min
Liquid, and adsorption column is placed back in centrifuge tube.
1.1.6 350ul BufferRW1 is added to adsorption column, 1min is centrifuged under conditions of 4 DEG C, 12000rpm, abandon filter
Liquid, and adsorption column is placed back in centrifuge tube.
1.1.7 80 μ l DNase I mixed liquors are added, the group of DNase I mixed liquor is divided into 52ul RNase-Free
Water, 8 μ 10 × Reaction of l Buffer and 20 μ l DNaseI, 5000rpm are centrifuged 5min mixing, 20~30 DEG C of incubations
15min。
1.1.8 350ul BufferRW1 is added to adsorption column, 1min is centrifuged under conditions of 4 DEG C, 12000rpm, abandon filter
Liquid, and adsorption column is placed back in centrifuge tube.
1.1.9 500ul BufferRW2 is added to adsorption column, 1min is centrifuged under conditions of 4 DEG C, 12000rpm, abandon filter
Liquid, and adsorption column is placed back in centrifuge tube.
1.1.10 500ul Buffer RW2 is added to adsorption column, is centrifuged 1min under conditions of 4 DEG C, 12000rpm, abandon
Filtrate, and adsorption column is placed back in centrifuge tube.
1.1.11 idle running centrifugation 1min under conditions of 4 DEG C, 12000rpm, is placed in a new 1.5ml for adsorption column
In RNase-Free centrifuge tube, room temperature dries up 10min.
1.1.12 30RNase-FreeWater is added to adsorption column, 1 minute is placed at room temperature for, in 4 DEG C, the item of 12000rpm
Be centrifuged 1 minute under part, obtain RNA template, be stored in -80 DEG C it is spare.
1.2 cDNA reverse transcriptions
1.2.1 PrimerMix, dNTPMix, DTT, 5 × RTBuffer and RNase-Free Water dissolution are placed in
It is spare on ice, after its dissolution, RNA template and reverse transcriptase taking-up are placed on ice.
1.2.2 reaction system is dNTPMix4ul, PrimerMix2ul, RNA template 5ug, 5XRTBuffer4ul, DTT
2ul, reverse transcriptase 1ul, RNAse-Free Water supply 20ul.
1.2.3 after the reagent in 1.1.2 being added to Ep pipe, Ep pipe is placed on palm centrifuge at 25 DEG C and is centrifuged 10 seconds
Left and right.
1.2.4 42 DEG C of incubations 2h, 85 DEG C of incubation 5min in PCR instrument.After reaction, Ep pipe is placed on palm centrifuge
Upper centrifugation 10 seconds or so.It is placed in cooled on ice, obtains cDNA template, -20 DEG C save backup.
The clone of 1.3 target gene
1.3.1 the cDNA obtained using reverse transcription in 1.2.2 carries out PCR amplification as template.Amplification system are as follows: cDNA template
0.5ul, OEMYB173-F (10pmol/ μ L) 1ul, OEMYB173-R (10pmol/ μ L) 1ul, Primer STARMix10ul,
ddH2O 7.5ul。
OEMYB173-F:CGAGCTCATGTCTCGCGCCTCCTCCOEMYB173-R:GGGGTACCAGCAACACTAATG
ATGCTTTCTCC。
1.3.2 the program expanded are as follows: 94 DEG C of 5min, 94 DEG C of 30sec, 53 DEG C of 30sec, 38 circulations, 72 DEG C of 1min, 72 DEG C
10min, 4 DEG C of preservations.
1.3.3 electrophoresis is carried out to PCR product, recycles Ago-Gel.
The building of 1.4GmMYB173Tvector cloning vector
1.4.1 recycling target gene DNA fragmentation
1.4.1.1 target fragment is cut in the UV lamp from Ago-Gel, is put into centrifuge tube, claimed on balance
It weighs and records.
1.4.1.2 the gel piece cut is smashed to pieces with sterile pipette tips, is added the DE-A solution of 3 times of volumes, 75 DEG C of water-baths 6~
8min, interval lightly turn upside down within two minutes it is several under, until blob of viscose is completely dissolved.
1.4.1.3 after gel dissolution, centrifuge tube is taken out from water-bath, is cooled to room temperature, 1.5 times of volume DE-B are added
Solution, mixing of turning upside down.
1.4.1.4 mixed liquor is drawn, is transferred in the 2ml collecting pipe containing adsorption column, under conditions of 25 DEG C, 12000rpm
It is centrifuged 2min, filtrate is abandoned, adsorption column is put back in collecting pipe.
1.4.1.5 500 μ l BufferW1 are added into adsorption tube, are centrifuged 1min under conditions of 25 DEG C, 12000rpm,
Filtrate is abandoned, and adsorption column is placed back in centrifuge tube.
1.4.1.6 700 μ l BufferW2 are added into adsorption tube again, are centrifuged under conditions of 25 DEG C, 12000rpm
1min abandons filtrate, and adsorption column is placed back in centrifuge tube.
1.4.1.7 700 μ l BufferW2 are added into adsorption tube again, are centrifuged under conditions of 25 DEG C, 12000rpm
1min abandons filtrate, and adsorption column is placed back in centrifuge tube.
1.4.1.8 idle running centrifugation 1min under conditions of 25 DEG C of 12000rpm, is placed in one for the adsorption column in 1.4.1.7
In new 1.5ml RNase-Free centrifuge tube, room temperature dries up 10min.
1.4.1.9 10 μ l eluents are added into centrifuge tube, 1min are placed at room temperature for, under conditions of 25 DEG C, 12000rpm
It is centrifuged 1min, GmMYB173PCR segment is obtained and is stored in -20 DEG C.
1.4.2 the connection of GmMYB173-Tvector carrier and conversion
UsingObtained in the 1.4.1.9 of-BluntZero Cloning Kit kit by recovery purifying
PCR product with- BluntZero Cloning carrier is attached, linked system are as follows: 1 μ l of PCR product,- BluntZero CloningVector 1 μ l, ddH23 μ l, Total5 μ l of O.
Above-mentioned reaction carries out in the PCR pipe of 200 μ L, is gently stirred with finger, by EP pipe be placed on palm centrifuge from
10 seconds or so at 25 DEG C of the heart, 25 DEG C of incubation 30min, are placed on ice after reaction in PCR instrument, are ready for conversion DH5 α sense
By state cell, the step of converting DH5 α competent cell, is as follows:
1.4.2.1 DH5 α competent cell is placed on ice to melt 5min from -80 DEG C of refrigerator taking-ups, performs label.It will be upper
It states 5 μ l of linked system and is all added to competent cell, obtain mixed liquor, mixed liquor ice is set into 30min；
1.4.2.2 mixed liquor ice postponed is placed in 42 DEG C of water-baths and is incubated for 90s, is subsequently placed in 10min on ice；
1.4.2.3 37 DEG C of 400 μ LLB liquid mediums (being free of kanamycins), 37 DEG C, 200rpm recovery culture is added
60min；
1.4.2.4 prepare LB+Kan (final concentration 50ug/L) solid medium plate, by bacterium solution at 25 DEG C, 4000rpm
Under conditions of be centrifuged 1min, remove 400 μ L supernatants, remaining supernatant is used to suspension thalline, and culture dish is inverted in 37 DEG C by coating
12~14h of incubator.After second day colonies is grown, 3 colonies of picking, with primer M13-F/R (sequence M13R:
CAG GAAACAGCTATG ACC；M13F:TGTAAAACGACG GCCAGT) do PCR cycle amplification, amplification program and 1.3.2 phase
Together.Electrophoresis obtains the segment of 0.8k or so, sends to the raw work sequencing in Shanghai after recycling segment, the list of correct positive colony will be sequenced
Bacterium colony is expanded with 3~5ml LB liquid medium to be cultivated, second day extraction plasmid.
1.4.3 the extraction of Plasmid DNA
1.4.3.1 correct positive colony DMI3-T vector is sequenced in picking, in 3~5ml LB+Kan 50mg/LLB liquid
It is incubated overnight in body culture medium；
1.4.3.2 it is centrifuged 3min under conditions of 25 DEG C, 6200rpm, to collect thallus, in the centrifuge tube of Xiang Liuyou thallus
250 μ l Buffer S1 (1%RNaseA is added before step 1.4.3.2) are added, are blown and beaten repeatedly with liquid-transfering gun, abundant suspended bacteria
Body is gone in another 1.5ml EP centrifuge tube.
1.4.3.3 250 μ l Buffer S2, mixing 4~6 of lightly turning upside down is added into 1.5ml EP centrifuge tube again
It is secondary, make cellular lysate.
1.4.3.4 350 μ l Buffer S3 are added into centrifuge tube again in 5min, turns upside down rapidly 6~10 times, makes
Bacterium solution mixes well, and has white flock precipitate appearance, is centrifuged 10min under conditions of 25 DEG C, 12000rpm.
1.4.3.5 Aspirate supernatant is transferred in the 2ml collecting pipe containing adsorption column, under conditions of 25 DEG C, 12000rpm
It is centrifuged 1min, filtrate is abandoned, adsorption column is put back in collecting pipe.
1.4.3.6 500 μ l BufferW1 are added into adsorption tube again, are centrifuged under conditions of 25 DEG C, 12000rpm
1min abandons filtrate, and adsorption column is placed back in centrifuge tube.
1.4.3.7 700 μ l BufferW2 are added into adsorption tube again, are centrifuged under conditions of 25 DEG C, 12000rpm
1min abandons filtrate, and adsorption column is placed back in centrifuge tube.
1.4.3.8 700 μ l BufferW2 are added into adsorption tube, are centrifuged 1min under conditions of 25 DEG C, 12000rpm,
Filtrate is abandoned, and adsorption column is placed back in centrifuge tube.
1.4.3.9 idle running centrifugation 1min under conditions of 25 DEG C, 12000rpm, is placed in another 1.5ml for adsorption column
In RNase-Free centrifuge tube, room temperature dries up 10min.
1.4.3.10 50 μ l eluents are added into centrifuge tube, places 1min, is centrifuged under conditions of 25 DEG C, 12000rpm
1min obtains GmMYB173 gene, by GmMYB173 Gene conservation in -20 DEG C.
Embodiment 2
The construction of eukaryotic expression vector of the gene containing GmMYB173
2.1.1 over-express vector constructs
2.1.1.1 carrier pDL28-HA-RFP (including CAM35S promoter) is through I double digestion of Sac I and Kpn, electrophoresis, recycling
10k segment, obtains digestion products；Digestion system is carrier 1ug, Sac I 2ul, Kpn I 2ul, 2ul 10 × Kbuffer, 2ul
0.1%BSA, distilled water complement to 20ul；Digestion condition is 37 DEG C of reaction 2h.
2.1.1.2 cloning vector GmMYB173Tvector is through I double digestion of Sac I and Kpn, electrophoresis, recycling 0.8k or so piece
Section, obtains digestion products；Digestion system is cloning vector 1ug, Sac I 2ul, Kpn I 2ul, 2ul10 × Kbuffer, 2ul
0.1%BSA, distilled water complement to 20ul；Digestion condition is 37 DEG C of reaction 2h.
2.1.1.3 after the digestion products in the digestion products and 2.1.1.2 in 2.1.1.1 being mixed, 16 DEG C of connections are stayed overnight,
Plasmid pDL28-HA-GmMYB173-RFP is obtained, turns to change again to Escherichia coli, selects positive colony；Linked system are as follows:
GmMYB173Tvector segment 7ul, pDL28-HA-RFP segment 1ul, T4DNA ligase 1ul, T4DNA buffer 1ul.
2.1.1.4 PCR is carried out as primer using OEMYB173-F and OEMYB173-R and verifies plasmid pDL28-HA-
GmMYB173-RFP, electrophoresis obtain the single bright band of 0.9k or so.Restriction enzyme Sac I and Kpn I carries out double digestion verifying
Plasmid pDL28-HA-GmMYB173-RFP, electrophoresis obtain two bright bands of 0.8k and 10k or so.
2.2.1 point mutation vector construction
2.2.1.1 using cloning vector GmMYB173Tvector as template, respectively with MYB173S59A-F and
MYB173S59A-R, MYB173S59D-F and MYB173S59D-R are that primer carries out cyclic amplification, amplification system are as follows:
GmMYB173T vector template 0.5ul, respectively with MYB173S59A-F and MYB173S59A-R, MYB173S59D-F and
MYB173S59D-R (10pmol/ μ L) 1ul, OEMYB173-R (10pmol/ μ L) 1ul, high fidelity enzyme 10ul supplies ddH2O is extremely
20ul。
.The program of amplification are as follows: 94 DEG C of 5min, 94 DEG C of 30sec, 53 DEG C of 30sec, 30 circulations, 72 DEG C of 1min, 72 DEG C
10min, 4 DEG C of preservations.The sequence of above-mentioned primer is as follows:
MYB173S59A-F:GTCGTCGGCGGCGGCGTAACCGG
MYB173S59A-R:CCGGTTACGCCGCCGCCGACGAC
MYB173S59D-F:GGCGTCGTCGGCGTCGGCGTAACCGGCG
MYB173S59D-R:CGCCGGTTACGCCGACGCCGACGACGCC
Electrophoresis, recycling 0.8k or so segment are carried out after PCR；1 μ l of system PCR product,-BluntZero
CloningVector 1 μ l, ddH23 μ l, Total5 μ l of O.It connects T to carry, obtains connection product, connection product is sequenced.
2.2.1.2 after sequencing result feedback, software DNAMAN aligned sequences are sequenced correctly point such as 1.2.4 and shake bacterium culture,
As 1.3 extraction plasmids, then double digestion, the system of digestion preferably include carrier 1ug, SacI 2ul, KpnI 2ul, 2ul10 X
Kbuffer, 2ul 0.1%BSA, distilled water complement to 20ul；The preferred wield37 DEG C of digestion 2h of the condition of digestion.It obtains a little dashing forward
Become segment, electrophoresis recycles 0.8k segment.
2.2.1.3 carrier pDL28-HA-RFP obtains pDL28-HA-RFP segment, digestion body through SacI and KpnI double digestion
System: carrier 1ug, SacI2ul, KpnI2ul, buffer 2ul, distilled water complement to 20ul, digestion condition are as follows: 37 DEG C of reaction 2h.
Electrophoresis is carried out after digestion, recycles 10k segment.
2.2.1.4 16 DEG C of connections after being gently mixed the point mutation segment in 2.2.1.2 and the digestion products in 2.2.1.3
Overnight, linked system are as follows: point mutation segment 7ul, pDL28-HA-RFP segment 1ul, T4DNA ligase 1ul, T4DNA buffer
1ul.It is ligated and transformed into bacillus coli DH 5 alpha, selects positive colony.
Constitute plasmid name: pDL28-HA-GmMYB173-59A-RFP, pDL28-HA-GmMYB173-59D-RFP.
2.1.2 Agrobacterium k599 is converted
2.1.2.1 k599 competent cell is placed on ice to melt 5min from -80 DEG C of refrigerator taking-ups, performs label.By matter
Grain pDL28-HA-GmMYB173-RFP, pDL28-HA-GmMYB173-59A-RFP, pDL28-HA-GmMYB173-59D-RFP point
1ug is not taken to be added to 100ul competent cell, ice sets 30min.
2.1.2.2 competent cell is placed in liquid nitrogen and is incubated for 1min, 2min is incubated in 37 DEG C of water-baths, repeat this operation
Once, it is subsequently placed in 10min on ice.
2.1.2.3 the 400 μ LLB liquid mediums (without kan antibiotic) for adding 37 DEG C, in 37 DEG C, the item of 200rpm
Recovery culture 60min, obtains bacterium solution under part.
2.1.2.4 prepare LB+Kan 50mg/L solid medium plate, bacterium solution be centrifuged 1min in room temperature, 4000rpm,
Remove 400 μ L supernatants, remaining about 100ul supernatant is used to suspension thalline, is then all coated on solid medium plate, will
Culture dish is inverted in 37 DEG C of 12~14h of incubator, chooses a little, is verified with M13F/R primer PCR cyclic amplification, electrophoresis obtains
The single band of 0.9k or so is verified correctly, and k599-pDL28-HA-GmMYB173-RFP is named as, and (contains 50mg/ with 4ml LB
LKan) fluid nutrient medium shakes bacterium, cultivates 16h under conditions of 37 DEG C, 220rpm.1ml dimethyl sulfoxide is added after culture, dispenses ,-
80 DEG C of preservations.
2.3.1 gene silencing vector constructs
2.3.1.1 the silencing piece in GmMYB173 complete sequence is found out with software (Oligoengine Workstation2)
Section, sequence is as shown in GmMYB173-1 forward direction chain-ordering；
2.3.1.2 designated rna i primer, PDK intron are the important segments to form hairpin structure, therefore are selected from two sections of PDK
Suitable digestion position is taken, two sections of silencing segments are connected into, (the two restriction enzyme sites are in PDK respectively with III/Xba of Hind I
Sequentially be Hind III to Xba I on the right of intron, design No. 1 positive chain) and Kpn I/EcoR (the two restriction enzyme sites are in PDK
The left side intron is sequentially EcoR I to Kpn I, designs No. 2 reverse strands) structure enters in pKANNIBAL carrier, and both direction is opposite
Segment separated by PDKintron, hairpin structure is formed after transcription.
Design primer:
RNAiMYB173-F:CGGGGTACCAAGCTTAACCTCTCACAGTACGAGCA TCC KpnI HindⅢ
RNAiMYB173-R:CCGGAATTCTCTAGAGGCACATTATGTTTTTCCACG EcoRI XbaⅠ
2.3.1.3 RNAi sequence is obtained with RNAiMYB173-F and RNAiMYB173-RPCR cyclic amplification, method is shown in
1.3.2
2.3.1.4 RNAiMYB173-T carrier is constructed, is converted, sequencing, upgrading grain, method is shown in 1.4；
2.3.1.5 it is first inserted into No. 1 positive chain, is carried with III digestion RNAiMYB173-T of XbaI, Hind and PKANNBAL carrier,
Each 1ug of carrier, III enzyme of XbaI, Hind each 2ul, 10 × Mbuffer of 2ul, distilled water complement to 20ul, 37 DEG C of digestion 2h.Glue returns
It receives, then carries out T4 connection, after being proved to be successful, the carrier after connection is named as pKANNIBAL-MYB173-1；
2.3.1.6 No. 2 reverse strands are inserted into, using correct pKANNIBAL-MYB173-1 as template, with KpnI and EcoRI
Digestion RNAiMYB173-T is carried and pKANNIBAL-MYB173-1 carrier, each 1ug of carrier, KpnI and EcoRI enzyme each 2ul, 2ul
10 × Mbuffer, distilled water complement to 20ul, 37 DEG C of digestion 2h.Glue recycling, then T4 connection, after being proved to be successful, after connection
Carrier is named as PKANNIBAL-RNAi-MYB173；
2.3.1.7 use restriction enzyme SalI, SpeI by pKANNIBAL-RNAi-MYB173 and expression vector pDL28-HA-RFP
Digestion, the system of the digestion preferably include carrier 1ug, SalI 2ul, SpeI 2ul, 2ul Mbuffer, and distilled water complements to
20ul；The condition of the digestion is preferably 37 DEG C of digestion 2h.Glue recycling, then T4 connection, after being proved to be successful, by the carrier after connection
Name pDL28-HA-RNAiMYB173-RFP；
2.3.1.8 plasmid pDL28-HA-RNAiMYB173-RFP is converted according to 2.1.2, coated plate is chosen a little, and verifying is correct, such as
2.1.1.3.K599-pDL28-HA-RNAiMYB173-RFP is named, is shaken with LB+Kan (final concentration 50ug/ml) fluid nutrient medium
Bacterium, -80 DEG C of preservations.
Embodiment 3
Soybean hairy conversion:
1) Agrobacterium k599 is activated in the LB lining out containing kan, activation condition is 30 DEG C of culture 48h or so；It is white by standing
The volume ratio of bleaching water and sterile water is that 1:2 configures mixed liquor, is added to the 50ml centrifugation containing 50 complete full soybean
Guan Zhong is totally submerged soybean in mixed liquor, is placed horizontally in superclean bench and handles 5min, with sterile water wash soybean
5 times, when wherein the 4th is cleaned, 5min is put in side.After cleaning, soybean is laid in the square ware that filter paper and sterile water is added,
The additional amount of sterile water can make filter paper moisten no liquid flowing, and after having spread one layer, filter paper is placed again by side on soy, filter paper
Processing is same as above, and every layer of upper layer and lower layer filter paper respectively places 15~20 soybean, 25~28 DEG C of dark culture 48h in constant incubator；
2) soybean is infected:
Prepare FM solid medium: configuration FM solid medium, autoclave sterilization, a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices after cooling is spare, plate
Diameter is 10cm.
Cut root: cutting newborn Soybean Root, a removal kind skin, then along cotyledon direction by cotyledonary node to hemisection, by cotyledonary node portion
Graduation wound, scratches at 5~7 altogether；
It infects: Agrobacterium being applied to cotyledonary node wound part, the soybean infected is placed on FM culture medium, every plate
10~12, after cultivating 8d under conditions of 25 DEG C, 50lux illumination, soybean is transferred on root media, root media
Are as follows:+1.5% sucrose of FM solid medium+cephalosporin (final concentration of 50ug/ml)；
3) electropositive radical screen: body formula fluorescence microscope electropositive radical, the electropositive radical of leave strip red fluorescence, excision without
The non-electropositive radical of fluorescence, positive Miao Jiashui moisturizing are stayed overnight；
4) using the rectangular flowerpot of the plastics of 10*10, the vermiculite and pearl that basinful volume ratio is 1:1 soybean planting: is added
The composite soil of salt, every basin kind 1 positive seedling, adds 200ml FM fluid nutrient medium.Every kind of transgenic seedling requires 2 kinds of processing
Sample (adds salt, salt is not added), 5 repetitions of every kind of processing sample；
5) salt stress is handled: after soil dries out in flowerpot, soybean adds every group of the salt group sodium chloride for pouring 100ml (200mM) molten
Liquid is not added single steaming water that equivalent is added in sodium chloride solution group, pours altogether twice, every 3~5d of minor tick；
6) it receives sample: after salt treatment, collecting each experimental group Soybean Root, share wild type EV (adding salt), wild type EV (no
Add salt), be overexpressed OE (adding salt), be overexpressed OE (salt is not added), be overexpressed point mutation 59A (adding salt), be overexpressed point mutation 59A
(salt is not added) is overexpressed point mutation 59D (adding salt), is overexpressed point mutation 59D (salt is not added), Knockdown KD (adding salt), gene
Strike low 10 groups of KD (salt is not added), the result is shown in Figure 1.
It weighs to each experimental group root sample, each experimental group single plant root sample mean fresh is shown in Table 1:
1 single plant root sample mean fresh of table
From the result of table 1 it can be concluded that, each experimental group of soybean by salt treatment by different degrees of salt stress,
Biomass reduces in various degree；The overexpression of gene GmMYB173, the root sample fresh weight of experimental group are that wild type adds salt group
1.26 times, be 2.30 times of Knockdown group；The biomass of the experimental group (59D) of phosphorylation is wherein simulated than other experimental groups
Height is 1.77 times that wild type adds salt group, and Knockdown adds 3.23 times of salt group, and resistance to salt stress ability will be apparently higher than other
Group.
As seen from the above embodiment, soybean salt-tolerance gene GmMYB173 provided by the invention can be improved the salt tolerant energy of soybean
Power.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered
It is considered as protection scope of the present invention.
SEQUENCE LISTING
<110>Hangzhou Pedagogic University
<120>application of a kind of soybean salt-tolerance gene GmMYB173 and its expression vector and expression vector
05 day 04 month<130>2017 years
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 864
<212> DNA
<213>artificial sequence
<400> 1
atgtctcgcg cctcctccgc cgcagattcc gccgcctccg gtgagatcat actgttcgga 60
gtcagagtcg tcgtcgattc catgaggaag agcgtcagca tgagcaacct ctcacagtac 120
gagcatcctc aagacggcag caacaacaaa gacgctctcg ccgccggtta cgcctccgcc 180
gacgacgccg ctcctcagaa ctccggccgc ctccgggagc gcgagcgaaa gcgaggagtt 240
ccgtggacgg aggaagagca caagctgttt ttggttggat tgcagaaggt agggaaaggt 300
gattggagag gaatctccaa aaactacgtc aaaacgcgaa cgccaacgca ggttgcgagc 360
catgctcaga agtactttct ccgacgaagc aacctcaatc gccgtcgccg tagatccagc 420
ctctttgaca tcaccaccga cacggtctct gcaattccaa tggagggaga acaggtccag 480
aatcaagaca cgctgtctca ttcacaacaa caatcaccct tgtttcctgc tgaaactagc 540
aaaatcaatg ggtttccaat gatgccagtg tatcagtttg ggtttggttc ttctggagtg 600
atttcagtcc aaggtggcaa tggaaaccca atggaagaac tcactctggg acaaggaaac 660
gtggaaaaac ataatgtgcc aaacaaggtc tctacagtgt ctgatatcat caccccgagt 720
tcttctagtt ctgccgttga cccaccgaca ctgtccctgg ggctatcctt ttcatctgac 780
caaagacaga catcatcaag acattcagct ttacatgcca tacaatgttt cagcaatgga 840
gaaagcatca ttagtgttgc ttga 864
<210> 2
<211> 287
<212> PRT
<213>artificial sequence
<400> 2
Met Ser Arg Ala Ser Ser Ala Ala Asp Ser Ala Ala Ser Gly Glu Ile
1 5 10 15
Ile Leu Phe Gly Val Arg Val Val Val Asp Ser Met Arg Lys Ser Val
20 25 30
Ser Met Ser Asn Leu Ser Gln Tyr Glu His Pro Gln Asp Gly Ser Asn
35 40 45
Asn Lys Asp Ala Leu Ala Ala Gly Tyr Ala Ser Ala Asp Asp Ala Ala
50 55 60
Pro Gln Asn Ser Gly Arg Leu Arg Glu Arg Glu Arg Lys Arg Gly Val
65 70 75 80
Pro Trp Thr Glu Glu Glu His Lys Leu Phe Leu Val Gly Leu Gln Lys
85 90 95
Val Gly Lys Gly Asp Trp Arg Gly Ile Ser Lys Asn Tyr Val Lys Thr
100 105 110
Arg Thr Pro Thr Gln Val Ala Ser His Ala Gln Lys Tyr Phe Leu Arg
115 120 125
Arg Ser Asn Leu Asn Arg Arg Arg Arg Arg Ser Ser Leu Phe Asp Ile
130 135 140
Thr Thr Asp Thr Val Ser Ala Ile Pro Met Glu Gly Glu Gln Val Gln
145 150 155 160
Asn Gln Asp Thr Leu Ser His Ser Gln Gln Gln Ser Pro Leu Phe Pro
165 170 175
Ala Glu Thr Ser Lys Ile Asn Gly Phe Pro Met Met Pro Val Tyr Gln
180 185 190
Phe Gly Phe Gly Ser Ser Gly Val Ile Ser Val Gln Gly Gly Asn Gly
195 200 205
Asn Pro Met Glu Glu Leu Thr Leu Gly Gln Gly Asn Val Glu Lys His
210 215 220
Asn Val Pro Asn Lys Val Ser Thr Val Ser Asp Ile Ile Thr Pro Ser
225 230 235 240
Ser Ser Ser Ser Ala Val Asp Pro Pro Thr Leu Ser Leu Gly Leu Ser
245 250 255
Phe Ser Ser Asp Gln Arg Gln Thr Ser Ser Arg His Ser Ala Leu His
260 265 270
Ala Ile Gln Cys Phe Ser Asn Gly Glu Ser Ile Ile Ser Val Ala
275 280 285
<210> 3
<211> 575
<212> DNA
<213>artificial sequence
<400> 3
aacctctcac agtacgagca tcctcaagac ggcagcaaca acaaagacgc tctcgccgcc 60
ggttacgcct ccgccgacga cgccgctcct cagaactccg gccgcctccg ggagcgcgag 120
cgaaagcgag gagttccgtg gacggaggaa gagcacaagc tgtttttggt tggattgcag 180
aaggtaggga aaggtgattg gagaggaatc tccaaaaact acgtcaaaac gcgaacgcca 240
acgcaggttg cgagccatgc tcagaagtac tttctccgac gaagcaacct caatcgccgt 300
cgccgtagat ccagcctctt tgacatcacc accgacacgg tctctgcaat tccaatggag 360
ggagaacagg tccagaatca agacacgctg tctcattcac aacaacaatc acccttgttt 420
cctgctgaaa ctagcaaaat caatgggttt ccaatgatgc cagtgtatca gtttgggttt 480
ggttcttctg gagtgatttc agtccaaggt ggcaatggaa acccaatgga agaactcact 540
ctgggacaag gaaacgtgga aaaacataat gtgcc 575
<210> 4
<211> 575
<212> DNA
<213>artificial sequence
<400> 4
ggcacattat gtttttccac gtttccttgt cccagagtga gttcttccat tgggtttcca 60
ttgccacctt ggactgaaat cactccagaa gaaccaaacc caaactgata cactggcatc 120
attggaaacc cattgatttt gctagtttca gcaggaaaca agggtgattg ttgttgtgaa 180
tgagacagcg tgtcttgatt ctggacctgt tctccctcca ttggaattgc agagaccgtg 240
tcggtggtga tgtcaaagag gctggatcta cggcgacggc gattgaggtt gcttcgtcgg 300
agaaagtact tctgagcatg gctcgcaacc tgcgttggcg ttcgcgtttt gacgtagttt 360
ttggagattc ctctccaatc acctttccct accttctgca atccaaccaa aaacagcttg 420
tgctcttcct ccgtccacgg aactcctcgc tttcgctcgc gctcccggag gcggccggag 480
ttctgaggag cggcgtcgtc ggcggaggcg taaccggcgg cgagagcgtc tttgttgttg 540
ctgccgtctt gaggatgctc gtactgtgag aggtt 575
<210> 5
<211> 23
<212> DNA
<213>artificial sequence
<400> 5
gtcgtcggcg gcggcgtaac cgg 23
<210> 6
<211> 23
<212> DNA
<213>artificial sequence
<400> 6
ccggttacgc cgccgccgac gac 23
<210> 7
<211> 28
<212> DNA
<213>artificial sequence
<400> 7
ggcgtcgtcg gcgtcggcgt aaccggcg 28
<210> 8
<211> 28
<212> DNA
<213>artificial sequence
<400> 8
cgccggttac gccgacgccg acgacgcc 28
<210> 9
<211> 25
<212> DNA
<213>artificial sequence
<400> 9
cgagctcatg tctcgcgcct cctcc 25
<210> 10
<211> 32
<212> DNA
<213>artificial sequence
<400> 10
ggggtaccag caacactaat gatgctttct cc 32
<210> 11
<211> 38
<212> DNA
<213>artificial sequence
<400> 11
cggggtacca agcttaacct ctcacagtac gagcatcc 38
<210> 12
<211> 36
<212> DNA
<213>artificial sequence
<400> 12
ccggaattct ctagaggcac attatgtttt tccacg 36
Claims (2)
1. a kind of expression vector containing resistant gene of salt GmMYB173, the expression vector is pDL28-HA-GmMYB173-59A-
RFP；
The 59A is that the 59th threonine of GmMYB173 DNA encoding the protein is sported glycine；
The amino acid sequence of the GmMYB173 DNA encoding the protein is as shown in SEQ ID No.2.
2. expression vector described in claim 1 is cultivating the application in incultured soybean.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710271602.4A CN106906223B (en) | 2017-04-24 | 2017-04-24 | A kind of application of soybean salt-tolerance gene GmMYB173 and its expression vector and expression vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710271602.4A CN106906223B (en) | 2017-04-24 | 2017-04-24 | A kind of application of soybean salt-tolerance gene GmMYB173 and its expression vector and expression vector |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106906223A CN106906223A (en) | 2017-06-30 |
| CN106906223B true CN106906223B (en) | 2019-08-02 |
Family
ID=59210092
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710271602.4A Expired - Fee Related CN106906223B (en) | 2017-04-24 | 2017-04-24 | A kind of application of soybean salt-tolerance gene GmMYB173 and its expression vector and expression vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106906223B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110684089B (en) * | 2018-07-04 | 2021-07-27 | 中国农业科学院作物科学研究所 | Application of plant stress tolerance related protein GmMYB118 in regulation and control of plant stress tolerance |
| CN110790831B (en) * | 2019-12-04 | 2021-08-24 | 中国农业科学院作物科学研究所 | Plant salt-tolerant drought-tolerant protein and coding gene and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104604500A (en) * | 2015-01-30 | 2015-05-13 | 杭州师范大学 | Method for improving adaptive capacity of soybeans in saline-alkali soil |
| CN104726476A (en) * | 2015-03-19 | 2015-06-24 | 山东省农作物种质资源中心 | Soybean salt-tolerant gene GmCIPK2 and application thereof |
-
2017
- 2017-04-24 CN CN201710271602.4A patent/CN106906223B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104604500A (en) * | 2015-01-30 | 2015-05-13 | 杭州师范大学 | Method for improving adaptive capacity of soybeans in saline-alkali soil |
| CN104726476A (en) * | 2015-03-19 | 2015-06-24 | 山东省农作物种质资源中心 | Soybean salt-tolerant gene GmCIPK2 and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| "Glycine max MYB transcription factor MYB173 (MYB175) mRNA, complete cds"，GenBank: DQ822923.1;Liao,Y. et al.;《GenBank》;20060805;第1页 |
| Quantitative Phosphoproteomic and Metabolomic Analyses Reveal GmMYB173 Optimizes Flavonoid Metabolism in Soybean under Salt Stress;Erxu Pi et al.;《Molecular & Cellular Proteomics》;20180301;第17卷(第6期);第1209-1224页 |
| Soybean GmMYB76, GmMYB92, and GmMYB177 genes confer stress tolerance in transgenic Arabidopsis plants;Yong Liao et al.;《Cell Research》;20080826;第18卷;第1047-1060页 |
| 大豆14-3-3蛋白与转录因子蛋白GmMYB173的互作;董萌等;《作物学报》;20161231;第42卷(第10期);第1419-1428页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106906223A (en) | 2017-06-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114107340B (en) | Mevalonate kinase gene RKMK and application thereof | |
| CN107383179B (en) | A kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application | |
| CN112501149B (en) | Alkaline protease mutant and gene, engineering bacterium, preparation method and application thereof | |
| CN106868023B (en) | Cucumber CsERF004 gene and coding protein and application thereof | |
| CN106906223B (en) | A kind of application of soybean salt-tolerance gene GmMYB173 and its expression vector and expression vector | |
| CN101775070A (en) | Plant stress tolerance correlative protein, encoding gene and application thereof | |
| CN109628465A (en) | SlNAC29 gene is improving the application in tomato bacterial leaf spot resistance and drought tolerance | |
| CN114107266B (en) | Protease mutant with improved heat resistance, encoding gene and application thereof | |
| CN101748144B (en) | Torch pear haloduric gene PpGST and application thereof | |
| CN108517324A (en) | One NtIPMD gene for influencing tobacco axillary bud differentiation | |
| CN113444734A (en) | Preparation method and application of salt-tolerant transgenic poplar | |
| CN110129358B (en) | Application of rice Os01g32730 gene | |
| CN102242134B (en) | Cloning of soybean GmSGT (Glycine max serine glyoxylate aminotransferase) gene and 5' UTR (Untranslated Regions) thereof and application thereof | |
| CN114107327B (en) | Trichoderma viride high-temperature stress response key enzyme gene TvHSP70, recombinant expression vector, engineering bacteria and application thereof | |
| CN108504672A (en) | Ralstonia solanacearum N477 extracellular proteins PHD and its encoding gene and application | |
| CN112795580B (en) | Pitaya gene HuAAE3 and application thereof in regulation and control of high temperature stress resistance of plants | |
| CN107987139A (en) | A kind of Dof transcription factors and its application in terms of plant salt tolerance is improved | |
| CN110343164A (en) | A kind of pig interferon alpha-mutant and its preparation method and application of 7 site mutation of high activity | |
| CN106967732B (en) | Cotton glutathione peroxidase GhGPX8 and application thereof | |
| CN109608535A (en) | A kind of the chicken alpha interferon peptide chain and its recombinant expression engineered strain of optimization | |
| CN101575366B (en) | Rice plant type gene and application thereof | |
| CN104911155B (en) | Using the heat-resistant of genetic engineering transformation against SOD and its encoding gene and application | |
| CN109402159A (en) | One kind turning the building of Sm1-chit42 trichoderma engineering bacteria and its application | |
| CN113788887B (en) | Cucumber photosynthetic system II reaction center protein CsPSII-CP47 and application thereof in resisting melon epidemic disease | |
| CN114292943B (en) | Application of tomato SlC H39 gene as negative regulatory factor in improving low temperature resistance of tomato |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190802 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |