CN106906221A - Soybean seedling promotees lateral root growth gene Gmr937 and application - Google Patents

Abstract

The invention discloses soybean seedling stage lateral root growth-promoting gene Gmr937 , which adopts Eastep ^TM kit to extract M18 seedling root system total RNA, reverse transcribes cDNA, and clones soybean seedling stage root system development-promoting related Gmr937 gene. The plant overexpression vector and RNAi expression vector were respectively constructed, and the recombinant plasmid was transformed into soybean JN18 by Agrobacterium-mediated method. 21 overexpression vector-positive plants of the T1 generation were detected by PCR, and a single copy of RANi expression was integrated into the recipient soybean JN18 genome. Measure the total length of the lateral roots of the control plants and transgenic plants cultivated under suitable conditions. The total length of the lateral roots of the overexpression transgenic plants is 90cm, which is 10cm higher than that of the control; Gmr937 gene can promote the development of soybean lateral root. The drought resistance physiological and biochemical indexes of transgenic soybean and CK control group after 7 days of drought treatment were measured, and the overexpression of Gmr937 gene in soybean could improve the drought tolerance of soybean.

Description

Gene Gmr937 for Promoting Lateral Root Growth in Soybean Seedling Stage and Its Application

technical field

The invention belongs to the field of molecular biology, and specifically relates to the gene Gmr937 for promoting lateral root growth in soybean seedling stage and its application.

Background technique

The root system is an important organ for crops to absorb water and nutrients. A strong root system is of great significance in promoting the photosynthesis of the aboveground part, increasing the yield of crops, and improving the stress resistance of crops. Understanding the gene functions of crop roots at the molecular level will provide a theoretical basis for improving crop yields and related research in plant drought resistance. Because the soil limits the observability of the root system, it is difficult to study the root system of plants under field conditions, so the research on the root system of crops is not as deep as the aboveground part.

At present, the research on the genes related to lateral root growth mainly focuses on the growth and development of lateral roots and stress resistance. Wang Feng et al. ^[3] studied the gene Os02g0198200 related to rice lateral root development, showing that this gene can promote the growth and development of rice lateral roots, and is of great significance to the growth and development of rice, high yield and stress resistance; Ren Yongzhe ^[4] in Arabidopsis root system In the study of the molecular mechanism of development, the functional analysis of the RML1 gene was carried out, and it was found that the lateral root development level of the transgenic plants was significantly improved, and the gene was related to the synthesis of glutathione, indicating that glutathione played a role in promoting the development of lateral roots. Wang Dinghui found in the drought resistance analysis of the GmHAP3-17 gene that under natural drought conditions, the transgenic GmHAP3-17 gene plants and wild soybeans showed obvious phenomena such as more developed root systems, deeper roots, and more lateral roots, indicating that the gene has a positive effect on soybean plants. Regulated drought resistance function, this gene becomes the genetic resource for cultivating drought-resistant transgenic crops.

Contents of the invention

The object of the present invention is to provide a soybean seedling stage lateral root growth-promoting gene Gmr937 and its application for the plant to have a strong root system and to promote the photosynthesis, yield and stress resistance of the aboveground part.

Soybean gene Gmr937 , its base sequence is shown in the sequence table SEQ ID NO.1;

The gene is artificially synthesized.

Application of soybean gene Gmr937 to promote lateral root growth in plant seedling stage.

Application of soybean gene Gmr937 in cultivating drought-tolerant transgenic plant varieties.

The plant is soybean.

The present invention provides soybean seedling-stage lateral root growth-promoting gene Gmr937 , which uses Eastep ^TM kit to extract M18 seedling root total RNA, reverse-transcribes cDNA, and clones soybean seedling-stage root-promoting-related Gmr937 gene. The plant overexpression vector and RNAi expression vector were respectively constructed, and the recombinant plasmid was transformed into soybean JN18 by Agrobacterium-mediated method. 21 overexpression vector-positive plants of the T1 generation were detected by PCR, and a single copy of RANi expression was integrated into the recipient soybean JN18 genome. Three positive plants were randomly selected for fluorescent quantitative PCR assay, and 13 positive plants were found. Using the 35s promoter as a probe to carry out Southern hybridization detection, the results showed that the target gene for transformation. The results showed that the Gmr937 gene had the highest expression level in soybean seedling leaves, which was 12 times that of the control, and the lowest expression level in the stem, which was 7 times that of the control. The expression level of Gmr937 interference plants in soybean seedling roots and leaves was 0.7 times that of the control, and the expression level in stems was 0.85 times that of the control. The total length of the lateral roots of the control plants and transgenic plants cultivated under suitable conditions was measured, and the results showed that the total length of the lateral roots of the overexpression transgenic plants was 90 cm, which was 10 cm higher than that of the control; the total length of the lateral roots of the RNAi interference transgenic plants was 70 cm, which was 8 cm lower than that of the control group , indicating that the Gmr937 gene can promote the development of soybean lateral roots. The drought resistance physiological and biochemical indexes of transgenic soybean and CK control group after 7 days of drought treatment were measured, and the results showed that overexpression of Gmr937 gene in soybean could improve the drought tolerance of soybean.

Description of drawings

Figure 1 Structural diagram of overexpression vector;

Figure 2 Structural diagram of RNA interference vector;

Figure 3 PCR verification of the target gene of the cloning vector, M: DNA Marker DL2000; P: Positive control; N: Negative control; A1,2: Amplification of the PCR product of the target fragment; B1-4 PCR product of the cloning vector;

Figure 4 PCR and double enzyme digestion verification of overexpression vector, M: DNA Marker DL2000; 1 overexpression vector PCR product, 2: overexpression vector plasmid double enzyme digestion product;

Figure 5 Interference carrier PCR and double restriction verification, M: DNA Marker DL2000; 1: N937 sense PCR product; 2: N937 antisense fragment PCR product; 3: interference carrier double restriction product; 4 intron PCR product;

Figure 6 PCR detection of T0 transformed seedlings; M: DNA Marker DL2000; P: positive control; N: negative control; CK: non-transgenic plants; A: 35s promoter detection B: Bar gene detection C: NOS terminator detection 1 ~ 3: PCR products of transgenic plants Note: A: PCR detection for 35S promoter; B: PCR detection for bargene; C: PCR detection for NOS gene; M: DNA Marker DL2000; P: Positive control; N: Negative control; CK: Non － transformed plant; 1 ~ 3: Transgenic plants;

Figure 7 PCR detection of T1 generation plants of transgenic plants, M: DNA Marker DL2000; P: positive control; N: negative control; CK: non-transgenic plants; 1-4: A35s PCR detection of transgenic plants; B: Bar gene detection; C: NOS Terminator detection; Note: A: PCR detection for 35S promoter; B: PCR detection for bargene; C: PCR detection for NOS gene; M: DNA Marker DL2000; P: Positive control; N: Negative control; CK: Non － transformed plant ; 1 ~ 4: Transgenic plants;

Figure 8 Southern hybridization detection of T1 transgenic plants, M: λ Hind Ⅲ DNA Marker; P: Positive control; CK: Untransformed plants; A: Overexpression plants; B: Interference plants 1-3: Transformed plants Note: M: λ Hind Ⅲ DNA Marker; P: Positive control; CK: Non-transformed plant; 1-3: Transgenic plants;

The relative expression level of the Gmr937 gene in Fig. 9 soybean seedling stage in T1 transformed plant root, stem and leaf tissue;

The relative expression of target gene in root, stem and leaf tissue after Fig. 10 soybean seedling stage drought treatment 24h;

Figure 11 Comparison of transgenic plants and CK after drought treatment.

detailed description

Embodiment 1 Gmr937 gene cloning and construction of expression vector

Cloned Plant Material of Gmr937 Gene

1) Plant material Cultivated soybean (Glycine max) Ji Nong 18, M18 plant material provided by Plant Biotechnology Center of Jilin Agricultural University.

Vectors and strains Escherichia coli strain DH5α, Agrobacterium strain EHA105, cloning vector pMD18-T, basic plant expression vector pCAMBIA3301, provided by the Plant Biotechnology Center of Jilin Agricultural University;

Biological Reagent Easteptm Universal Total RNA Extraction Kit, DNA GEL Extraction Kit, Gel Recovery Kit, pMD18-vector Vector Kit, Restriction Enzymes (BglⅡ, BsteⅡ), Seamless Cloning Kit and Reverse Transcription Kit Purchased from Zhongmei Taihe (Beijing) Company.

2) Cloning of Gmr937 gene

Primer N937A1/937NAS1 for the full-length sequence of the Gmr937 gene was designed using Primer 5 software, as shown in Table 1. Total RNA was extracted from the root system of M18 seedlings with the Eastep ^TM kit, reverse-transcribed into cDNA, and the Gmr937 gene was cloned. The cDNA obtained by reverse transcription was used as a template, and the optimal temperature of the specific primer N937A1/937NAS1 was used for gradient PCR at 10°C. Reaction system: DNA template 2 μl, 10×buffer 2.5 μl, 2 mmol L-1 dNTP 1.5 μl, 25 mmol L-1 MgSO4 2.0 μl, 10 μmol L-1 primer (F/R) 1 μl each , high-fidelity enzyme Kod Plus (5 U·µl-1) 0.3 µl, add ddH2O to 25 µl. Reaction conditions: Pre-denaturation at 94°C for 5 min, denaturation at 94°C for 45 s, annealing at 58°C for 45 s, extension at 72°C for 1.5 min, 35 cycles; post-extension at 72°C for 5 min. Take 10 µl of the amplified product to separate and recover on 1.5% agarose gel, connect the recovered product to the pMD18T vector to form the PMD-18T- Gmr937 cloning vector, and pick out the single clone for sequencing.

The sequencing results were compared with the NCBI database, and the amino acid sequence of the Gmr937 sequence was analyzed online by Expasy to compare the homology of the amino acid sequence and predict the function. Primer information as shown in Table 1;

Extract the total RNA from the roots of M18 seedlings as a template, reverse transcribe it into cDNA, amplify the target fragment of Gmr937 with the designed specific primer N937A1/N937AS1, the size is 1000bp as shown in Figure 3A, and connect the amplified fragment to PMD-18T. The target fragment was identified by PCR, and a Gmr937 gene fragment of 1000 bp in size consistent with the expected size was obtained, as shown in Figure 3B.

3) Construction of Gmr937 vector

The primers were designed using the seamless cloning software CE Design V1.03, and the overexpression primers N937cbdA'/N937cbdAS' are shown in Table 1. The above cloning vector PMD-18T- Gmr937 and the vector pCambia3301 plasmid were subjected to double enzyme digestion (BglⅡ, BsteⅡ) to purify and recover the large linear fragment and the Gmr937 target fragment, and connect them according to the instructions of the seamless cloning kit to obtain the pCambia3301 -Gmr937 expression vector , transform the constructed expression vector into Escherichia coli for storage, extract and store the bacterial liquid plasmid, verify by PCR and double enzyme digestion, and send the positive strains to Changchun Kumei Biotechnology Co., Ltd. for sequencing, and screen the positive strains according to the sequencing results. The structure of pCambia3301- Gmr937 expression vector is shown in Figure 1.

Use BglⅡ, BsteⅡ to double-digest the plant overexpression vector to obtain a gene fragment of 1000bp in size, which is consistent with the size of the target gene fragment. The PCR detection and double-digestion detection of the target fragment on the constructed overexpression vector plasmid are shown in Figure 4. After PCR and The results of double enzyme digestion indicated that the overexpression vector of the target gene was constructed successfully.

4) Construction of RNAi expression vector

Use RNAi interference primers N937gr1A'/N937gr1AS', N937gr2A'/N937gr2AS' to PCR on the cloning vector to obtain the sense and antisense fragments of the target gene Gmr937 , use primers N937nhz1A'/N937nhzAS' to perform PCR on the soybean genome, and clone the functional spacer sequence for formation Stem loop structure. Follow the instructions of the seamless cloning kit to connect and transform to obtain the RNAi expression vector pCambia3301-RNAi -Gmr937 with the herbicide-resistant Bar gene as a selection marker. The structure of the RNA interference vector is shown in Figure 2.

Use BglⅡ, BsteⅡ to double-digest the plant interference vector to obtain a gene fragment of 2200bp in size, which is consistent with the sum of the sense, antisense and intron fragments of the target gene, and perform PCR on the sense, antisense and intron sequences of the interference vector The verification and double enzyme digestion verification are shown in Figure 5. The identification results show that the sense and antisense fragments and intron sequences of the target gene have been successfully connected to the 3301 vector, and the plant interference vector has been successfully constructed.

Example 2 Gmr937 vector Agrobacterium transformation method to obtain transgenic plants and detection

According to the cotyledon node infection method of Zhongying soybean ^[8] , the constructed plant overexpression vector and RNAi expression vector were transferred into recipient plant JN18 by Agrobacterium-mediated method to obtain transgenic plants.

1) PCR detection

Genomic DNA of transgenic plants was extracted by CTAB method, primers for 35s promoter, NOS terminator and bar gene were designed, Gmr937 expression vector plasmid and DNA of JN18 control group were used as positive control and negative control respectively, the target fragment was amplified by PCR, and the amplified product Analyzed by electrophoresis on a 1% agarose gel.

The reconstructed plant expression vector was transformed into recipient soybean JN18 by the Agrobacterium-mediated method, and the obtained T0 transformed plants were tested by PCR, as shown in FIG. 6 . The results indicated that 35s promoter, Bar gene and NOS terminator had been transferred into the transformed plants.

PCR detection was performed on the T1 generation plants, and the results are shown in Figure 7, and the 35s promoter-specific bands, the Bar gene-specific bands and the NOS terminator-specific bands were obtained, which were consistent with the expected results. Among the 100 T1 generation seeds, 34 were transformed into positive plants, of which 21 were overexpression plants and 13 were interference plants.

2) Southern hybridization detection

The positive seedlings that were successfully transformed were cultivated to obtain T1 generation seeds, which were single-digested with endonuclease BamHI and performed Southern hybridization with the 35s promoter sequence as a probe to detect the integration of the target gene in the genome of T1 generation plants.

The plants with positive Southern blot detection results were tested by qRT-PCR, as shown in Figure 9. The results proved that the N937 gene was expressed in the roots, stems and leaves of the transgenic soybean plants at the seedling stage, and the expression of the target gene in the overexpressed plants had a significant increase. Improvement, the most obvious increase in the leaves, the relative expression level is 12 times that of the control, and the expression level in the root is 10 times that of the control; It is 0.8 times that of the control, and the expression level in the stem is 0.85 times that of the control.

After 24 hours of drought treatment, the expression level of the target gene in the overexpressed plants was significantly increased, and the expression level in the leaves was 14 times that of the control group, and the expression level in the roots was 12 times that of the control group. The expression level in roots and stems of plants transfected with RNAi- Gmr937 vector was 0.8 times that of the control group, and the expression level in leaves was 0.7 times that of the control group, as shown in FIG. 10 . The results showed that the expression of Gmr937 gene in the overexpression transformants increased significantly under drought conditions.

3) qRT-PCR detection

Extract RNA from roots, stems and leaves of T1 transgenic Gmr937 overexpression plants and RNAi- Gmr937 transgenic plants at seedling stage, and reverse transcribe them into cDNA. The specific primers QA/QAS designed for fluorescent quantitative PCR are shown in Table 1. Soybean actin was used as an internal reference for qRT-PCR detection. The reaction system: primers QA/QAS 2µl each, DNA template 2µl, DD water 4µl, SYBRPremix Mix 10µl; Reaction conditions: pre-denaturation at 95°C for 5min, denaturation at 95°C for 30s, annealing at 58°C for 30s, extension at 72°C for 30s. The Mx3000 real-time fluorescent quantitative PCR instrument was used to amplify the target sequence according to the instructions of the SYBR Premix ExTaql kit. Each sample was repeated three times, and the relative expression of the target gene was calculated and analyzed by 2- ^△△CT .

The total DNA of 34 positive plants was extracted, the expression vector pCambia3301- Gmr937 and the RNAi expression vector pCambia3301-RNAi- Gmr937 plasmid were used as positive controls, JN18 without gene introduction was used as a negative control, 35s was used as a probe, and endonuclease BamHI Enzyme digestion of the whole genome of soybean, and Southern hybridization detection, the results are shown in Figure 8, the untransformed JN18 plants did not show hybridization signals, and 6 positive plants of the 42 plants tested showed obvious hybridization signals, and the results showed that the 35s gene and The single-copy form integrated into the recipient soybean genome at different sites of integration.

4) Root length of transformed plants and related physiological and biochemical tests

Two groups of treatments were set up, the first group was treated at 25°C with a humidity of 10% and the control group of the CK plants, and the second group was treated at 25°C with a humidity of 5% and the control group of the transformed plants with the CK plants Each group was repeated three times. After 7 days, the total length of lateral roots of each group was measured by direct measurement method, the relative conductivity of leaf tissue of each group was measured by alternating current method, and the malondialdehyde content of leaf tissue of each group was measured by ultraviolet analysis method. , the peroxidase activity of each group was measured by colorimetric method, and the data was processed by DPS software, and the difference between samples was analyzed by Duncan method.

Two experimental groups, suitable water treatment and drought treatment, were set up, and the total length of lateral roots of CK, overexpression and interference T1 generation plants were measured under the two treatment conditions. In contrast, the total length of the lateral root system increased by 17.5%-23%, and the total length of the lateral root system of the overexpressed plants after drought treatment increased by 24.6%-28.3% compared with the CK control group. The total length of the lateral root system decreased by 6.3% to 10.2% compared with the control group (Table 2). It shows that the gene can significantly promote the growth and development of soybean lateral roots. After 24 hours of drought treatment, the N937-transferred gene did not change significantly, and the leaves of the CK control group drooped slightly and wilted, while the leaves of the RNAi-N937-transferred plants shrank significantly and curled up, as shown in Figure 11.

Note/Note: Duncan's, P = 0. 05 A: Gmr937 expression plants a: Gmr937 interference plants

5), the length of the young root of the transformed plant and the relevant physiological and biochemical detection

Two groups of treatments were set up, the first group was treated at 25°C with a humidity of 10% and the control group of the CK plants, and the second group was treated at 25°C with a humidity of 5% and the control group of the transformed plants with the CK plants Each group was repeated three times. After 7 days, the total length of lateral roots of each group was measured by direct measurement method, the relative conductivity of leaf tissue of each group was measured by alternating current method, and the malondialdehyde content of leaf tissue of each group was measured by ultraviolet analysis method. , the peroxidase activity of each group was measured by colorimetric method, and the data was processed by DPS software, and the difference between samples was analyzed by Duncan method.

Generally, under adversity stress, the permeability of plant cell membrane will change to adapt to the environment. The degree of damage to cell membrane can be obtained indirectly by measuring the conductivity of cells permeated in aqueous solution. big. It can be seen from Table 3 that under normal temperature conditions, there is no significant difference in the relative electrical conductivity of the leaves of the transgenic Gmr937 gene and the leaves of the untransformed plants. The difference between the rates reached a significant level, and the relative conductivity of the Gmr937 -transformed plants was significantly lower than that of the non-transformed plants, which decreased by 13.8-15.15%. The relative electrical conductivity of plant leaves increased by 3.27-5.31%.

Malondialdehyde is a commonly used indicator of membrane lipid peroxidation, which can reflect the degree of peroxidation of cell membrane and the strength of the response to adversity stress. It can be seen from Table 4 that under suitable conditions, there was no significant difference in the MDA content of the leaves of transgenic Gmr937 plants and leaves of non-transformed plants. ． 86%～10． 34%, the difference between the two reached a significant level, indicating that the leaves of the transgenic lines suffered less stress damage than the leaves of the non-transgenic lines.

The malondialdehyde content of plants transfected with RNAi- Gmr937 gene was not significantly different from that of non-transgenic plants, which indicated that the leaves of plants transfected with the interference vector did not undergo significant changes in stress damage.

Peroxidase (POD) can measure the strength of plant stress resistance. It can be seen from Table 5 that under suitable conditions, there was no significant difference in POD activity between the leaves of transgenic Gmr937 plants and leaves of CK plants. After 7 days of drought treatment, the peroxidase activity of transgenic Gmr937 plants was significantly higher than that of non-transformed plants, an increase of 24. 62% ~ 31． 78%, the difference between the two reached a significant level, indicating that the active oxygen scavenging ability of the antioxidant system of transgenic plants is higher than that of non-transgenic plants.

Through data analysis and comparison, it was found that the Gmr9337 gene transgenic plants had increased resistance to drought stress, while the interfering gene transgenic plants had reduced drought resistance, which further indicated that the function of the Gmr937 gene was related to the drought resistance of plants. The protein expressed by the N937 gene is the functional element of the protein kinase active protein, and the heat shock protein is related to the drought resistance and high temperature resistance of plants, which is consistent with the experimental results ^[18-20] . The number and length of lateral roots of Gmr937 transgenic plants after drought treatment were significantly higher than those of CK control plants and Gmr937 interference plants, and the development of lateral roots of CK plants was better than that of transgenic lines. Under normal conditions, soybeans transfected with the N937 gene have more main root length and number of lateral roots than normal plants in the morphology of root development, while the roots of the lines introduced with the Gmr937 interference gene have slower root development, which is consistent with the research results of Mo Jingang ^[21] et al. Therefore, it was identified that the Gmr937 gene has a certain function on the lateral root development of soybean.

Under the drought stress in this experiment, by measuring the physiological and biochemical indicators of the transformed plants and non-transformed plants, there were significant differences between the transformed Gmr937 positive plants and the control group, the expression of soybean Gmr937 gene and the relative conductivity, malondialdehyde content related to changes in peroxidase. It indicated that the Gmr937 gene caused physiological and biochemical changes in cell membrane permeability, membrane peroxidation degree and antioxidant system after being subjected to drought stress ^[22] . The results proved that the overexpression of transgenic Gmr937 gene can improve the drought tolerance of transgenic soybean, which laid the foundation for the utilization of this gene. Since the target gene plays an important role in the growth and development of plants and abiotic stress, the plant Gmr937 gene with the function of abiotic stress tolerance is transferred into economic crops, which can improve the stress tolerance of economic crops, accelerate the growth and development of roots and It is very important to stabilize the output of crops ^[23-25] . The expression of Gmr937 gene at the protein level needs to be further studied.

<110> Jilin Agricultural University

<120> Gene Gmr937 for promoting lateral root growth in soybean seedling stage and its application

<160> 1

<210> 1

<211> 1000

<212>DNA

<213> Artificial

<400> 1

acgattcgag ctcggtaccc gggatcctct agagatttttttcagcgcca tctcccccttg 60

cgtttgggcc tggcccatta gttcccttgc ctccgtaatt tcttgaccca gttcgaccca 120

ttgccaccaa gggatttctc tggcccgatg cggtcctagt tccggattcc atacatgtgt 180

ctccacgtcc cacccatgct ctgtttttgc tagtcatctc cattttgacg gccctcgcta 240

tattcatcaa acgtcctctc gttaacagat tggcaacgtg caagctcttc aaaccatgtg 300

cgaagcaagc gaaatattgt tcgtcttgca atttgggaat ctgagcaatt aaacattcaa 360

accgttgaat gtagtcatca atgctcctcg tctgttgcag cgccgataat tgctcatatg 420

ctgttccctt ccctgcatac ctctgcatca gttcatactt caattcctcc cacgtcaggt 480

tctcattctc aagcagtaac aaattgaaga aatgaacggt cccgttctcc atgctaatct 540

gggcgagcct caccttcacc tcgtcgcttg tttcctgcac ctggaaatag atttcagccc 600

ttgaaatcca gccgacggga tcttcgccag tgaaagaagg gagctccacc ttcttgatcg 660

attgtcggaa ttcgtctagt gcttctgctt ctaagctctt ccaaaccgaa ccagcactga 720

tcggatttgg cctctttcca ccatgctctc cgttcgtttt ggccttgcga cttccgccat 780

gtgatccttc tccctcttct ccatcgttga tgttcatcat caagctcttc gtcaccagtt 840

ctaggatctt cgactggttc tcctttgctt cttttgcttc tgcttgtatc gcctccatca 900

tcgatttcat catctccaaa tcaccttcaa ccttttccat cctcgcgtcc atcgctgatt 960

cgtccgctgg ttttatcgtc gacctgcagg catgcaagcg 1000

Claims (5)

1. Soybean gene Gmr937 , its base sequence is shown in the sequence table SEQ ID NO.1. 2. The soybean gene Gmr937 according to claim 1, characterized in that: said gene is artificially synthesized. 3. The application of the soybean gene Gmr937 according to claim 1 to promote the growth of lateral roots at the plant seedling stage. 4. The application of the soybean gene Gmr937 according to claim 1 in cultivating drought-tolerant transgenic plant varieties. 5. The application according to claim 3 or 4, characterized in that: the plant is soybean.