CN106905432B - A kind of fusion protein and its preparation method and application of α melanocyte-stimulating hormone(MSH) - Google Patents

Abstract

The invention belongs to genetic engineering pharmaceutical fields, and in particular to a kind of fusion protein of α melanocyte-stimulating hormone(MSH).The fusion protein includes 1 nexin transduction domain (Protein transduction domian, PTD), 1 human serum albumins (Albumin Human, ) and a α melanocyte-stimulating hormone(MSH) (α-Melanocyte stimulating hormone HSA, α-MSH), and it is added between α-MSH and HSA with flexible link peptide, it ensure that fusion protein high level in host stablizes expression, while retaining α-MSH bioactivity, it can be effectively across blood-brain barrier, improve drug effect, have effects that extend half-life period simultaneously.Present invention simultaneously provides the preparation method of the fusion protein and its inhibiting or treating the application in inflammation of the central nervous system.

Description

A kind of fusion protein and its preparation method and application of α melanocyte-stimulating hormone(MSH)

Technical field

The invention belongs to genetic engineering pharmaceutical fields, and in particular to a kind of fusion protein of α melanocyte-stimulating hormone(MSH) and its Preparation method and application.

Background technique

Brain tissue impairment caused by injury of blood vessel, inflammation and wound will lead to the cognition dysfunction of body, this kind of disease Disease drastically influences people's lives quality and working efficiency.Cranial nerve is paid close attention to mostly for the clinical medicine of above-mentioned disease at present The reparation and protection of tissue, in fact, other than nerve cell, star spongiocyte, few dendron spongiocyte, endothelial cell And microglia also needs the reparation after damage.Endogenous immune neuromedin α melanocyte-stimulating hormone(MSH) (α- Melanocyte stimulating hormone, α-MSH) there is potential anti-inflammatory, neurotrophy, anti-apoptotic effect.To upper Stating disease has significant treatment potentiality, and smaller relative to traditional antimetabolic immunosuppressor side effect, grinds on basis Study carefully and all there is important value in clinical treatment, be expected to become novel neuroprotective agent, is a kind of clinical time having a extensive future Select drug.

The immunomodulatory effect of α-MSH is generated through following approach: (1) directly acting on periphery macrophage, monokaryon and neutrophilia α-MSH receptor on the immunocytes such as granulocyte；(2) α-MSH receptor on intracerebral neuron is acted on, and then it is anti-to start downstream Scorching nerve pathway；(3) local inflammation of central nervous system is by the α-MSH that locally generates by acting on maincenter microglia With astrocyte and be suppressed, can also by peripheral cells generate α-MSH maincenter is acted on by cerebrospinal fluid circulation.Furthermore α- The anti-inflammatory activity of MSH is proved in several animal models.The irritating allergic dermatitis of these animal models, contact allergy Property dermatitis, vasculitis, arthritis, inflammation of eye section, gastroenteritis, brain inflammation and allergic inflammation.

In inflammation of the central nervous system, α-MSH participate in neu- roimmunomodulation access molecular mechanism it is as follows: α-MSH by Its is receptor-mediated, reduce inflammatory reaction in maximum adjuster molecule NF- к B mediation transcriptional activity, and then prevent anticusp because The release of son, inhibits the expression of adhesion molecule, to reduce brain tissue impairment, plays nutrition, protection, repairs injured cerebral tissue Effect.

α-MSH is mainly generated by hypothalamus, hypophysis and a variety of peripheral tissues' cells, is made of 13 amino acid, rat is quiet It is a few minutes that arteries and veins, which injects Half-life in vivo, for such pharmaceutical grade protein, it is necessary to consider glomerular filtration problem, therefore, Its half-life period will be extended by carrying out modification and transformation or the other methods of structure to α-MSH.

HSA is human endogenous's property albumen, and molecular weight reaches 66kDa, reaches intracorporal half-life period 19 days in people, is had without immune Originality, human compatibility be good, without characteristics such as enzyme activity, is the transport agent of many endogenous metabolism substances and exogenous drugs.On Stating characteristic makes HSA become one ideal carrier of long acting protein/polypeptide drug exploitation.

Therefore, the present invention utilizes albumin fusion technology (Albumin Fusion technology) by α-MSH and HSA The flexibility molecular adaptor (link peptide) with special construction is added, using technical side disclosed by the invention in fusion between the two Case, not only ensure that the stability and bioactivity of fusion protein, but also increase molecular weight.

Although disclosing the half-life period that can extend destination protein by the strategy of the expression of fusion protein in the prior art, But the design of fusion protein is the numerous process of program complexity, an influence factor in itself, only passes through the simple adduction of sequence It is the stability and high efficiency expression that cannot achieve α-MSH, the purpose for extending its half-life period, this is known to one of skill in the art 's.

Meanwhile in order to enable above-mentioned fusion protein effectively across blood-brain barrier, to treat brain inflammation and related disease, The present invention joined in fusion protein amino acid sequence nexin transduction domain (Protein transduction domian, PTD), PTD is comparatively ideal across BBB transport vehicle of discovered in recent years, has the function of powerful delivery, can transport and be higher than certainly Exogenous protein, DNA, RNA, chemical molecular, magnetic bead, liposome can be transported through carefully by the macromolecular that 100 times of body molecular weight After birth, and this process is not limited by molecular size and type.

Based on above-mentioned status, inventor discloses a kind of fusion protein of α melanocyte-stimulating hormone(MSH), which is had The unique amino acid sequence having can guarantee that its high level in host stablizes expression, retain α-MSH original function Meanwhile Half-life in vivo significantly extends, while can treat brain inflammation and related disease across blood-brain barrier.

Summary of the invention

The purpose of the present invention is to provide a kind of fusion protein of α melanocyte-stimulating hormone(MSH), which can be in host High level stablizes expression in vivo, and long half time can treat brain inflammation and related disease effectively across blood-brain barrier.

It is another object of the present invention to provide a kind of preparation methods of the fusion protein of α melanocyte-stimulating hormone(MSH).

It is another object of the present invention to provide a kind of recombinant expression carriers.

It is another object of the present invention to provide a kind of host expression systems.

It is another object of the present invention to provide a kind of fusion protein applications of α melanocyte-stimulating hormone(MSH).

The fusion protein of α melanocyte-stimulating hormone(MSH) of the present invention includes 1 nexin transduction domain (Protein Transduction domian, PTD), 1 human serum albumins (Albumin Human, HSA) and a α melanophore Hormone (α-Melanocyte stimulating hormone, α-MSH).

Wherein, the fusion protein packet also contains link peptide L, and HSA is connect by link peptide L with α-MSH.

The DNA sequence dna of the L is GGAGGTGGAGGTTCTGGAGGTGGATCTGGT, and amino acid sequence is GGGGSGGGSG。

The PTD is located at the end N- of fusion protein, and α-MSH is located at the end C- of fusion protein, fusion protein structure Formula is expressed as PTD-HSA-L- α-MSH.

The PTD has amino acid sequence shown in SEQ ID NO:2, encodes the DNA sequence of the amino acid sequence of the PTD Column are as shown in SEQ ID NO:1；Or substitution, missing or insertion amino acid residue are obtained with institute in the amino acid sequence State the active amino acid sequence of PTD, and the DNA sequence dna of amino acid sequence described in coding.

The HSA has amino acid sequence shown in SEQ ID NO:4, encodes the DNA sequence of the amino acid sequence of the HSA Column are as shown in SEQ ID NO:3；Or substitution, missing or insertion amino acid residue are obtained with institute in the amino acid sequence State the active amino acid sequence of HSA, and the DNA sequence dna of amino acid sequence described in coding.

α-the MSH has amino acid sequence shown in SEQ ID NO:6, encodes the amino acid sequence of the α-MSH DNA sequence dna is as shown in SEQ ID NO:5；Or substitution, missing or insertion amino acid residue are obtained in the amino acid sequence Active amino acid sequence with the α-MSH, and the DNA sequence dna of amino acid sequence described in coding.

The amino acid sequence of the fusion protein is as shown in SEQ ID NO:8, the amino acid sequence of encoding said fusion protein The DNA sequence dna of column is as shown in SEQ ID NO:7.

Above-mentioned fusion protein is prepared using yeast cell to express, and the yeast is thermophilic pichia methanolica (Pichia pastoris)。

The preparation method of the fusion protein of α melanocyte-stimulating hormone(MSH) of the present invention comprising the steps of:

1. full genome synthesizes α-MSH sequence；

2. obtaining PTD-HSA sequence by PCR amplification；

3. extending α-MSH and 2. middle PTD-HSA in round pcr connection 1. using merging, connected by In-fusion technology Target fragment and carrier obtain the expression of recombinant yeast of the DNA sequence dna containing the fusion protein for encoding the α melanocyte-stimulating hormone(MSH) Carrier；Wherein, the carrier is pPink α-HC.

4. by step, 3. the recombinant yeast expression vector is transformed into competent E.coli TOP10 cell, is extracted It is sequenced after recombinant expression carrier plasmid, correct plasmid will be sequenced and be transformed into host expression system and express and melt to get described Hop protein.Wherein, the host expression system is thermophilic pichia methanolica.

A kind of recombinant expression load of the DNA sequence dna of the fusion protein amino acid sequence containing coding for alpha melanocyte-stimulating hormone(MSH) Body.

A kind of host expression system containing above-mentioned recombinant expression carrier.

A kind of fusion protein of α melanocyte-stimulating hormone(MSH) preparation inhibit or the drug for the treatment of inflammation of the central nervous system in Application.Beneficial effects of the present invention:

1. the present invention is merged α-MSH with HSA using human serum albumins integration technology, it is added between the two with special Structure and certain flexible molecular adaptor (link peptide), guarantee the stability and bioactivity of fusion protein, effectively increase Molecular weight realizes the stability and high efficiency expression of α-MSH, achievees the purpose that extend its half-life period.

2. the present invention joined PTD in fusion protein amino acid sequence, while retaining α-MSH original function, energy Enough brain inflammation and related disease effectively are treated across blood-brain barrier.

3. the fusion protein of α melanocyte-stimulating hormone(MSH) of the present invention can inhibit in preparation or treatment central nervous system It applies, is suitble in this field large-scale promotion in the drug of inflammation.

Detailed description of the invention

Fig. 1 carrier pPink α-HC

Fig. 2 carrier pPINK α-HC/PTD-HSA-L- α-MSH

Specific embodiment

Major experimental instrument:

Liquid-transfering gun, superclean bench (safe and sound), magnetic stirring apparatus, micro-wave oven, high-temp steam sterilizing pot, -80 DEG C of Low-temperature Ices Case (Forma), ultrapure water instrument (Millipore), ice machine, centrifuge (Hitachi), HDB-PLUS type constant-temperature metal bath, HZQ-F16OA type constant-temperature shaking incubator (Shanghai one is permanent), PCR instrument (Applied Biosystems), tabletop refrigerated centrifuge (Thermo), DYY-8B type electrophoresis apparatus (Bole), 300 type gel imager (GE) of Image Quant etc..

Main experimental materials:

1. restriction endonuclease StuI, KpnI, XhoI, AflII (NEB Products, the U.S.)

2. small propose plasmid kit, PCR purification kit, DNA plastic recovery kit (raw work biology, China)

3.T4DNA connection enzyme reagent kit (Takara Products, DaLian, China)

4. carrier pPink α-HC, carrier pcDNA3.1-HSA, Pichi strain, Infusion kit (Invitrogen Products, the U.S.)

5. Escherichia coli TOP10 (TIANGEN Biotech (Beijing) Co., Ltd.)

6. yeast extract, peptone (Oxford Products, the U.S.)

7.LB culture medium

Yeast extract 5g, peptone 10g, NaCl 10g, is dissolved in 1000ml deionized water, and with the NaOH of 1mol/L PH value is adjusted to 7.0, autoclaving.

8.YPD culture medium

Yeast extract 10g, tryptone 20g, Agar 20g, is dissolved in 900ml deionized water, high pressure sterilization, cooling 20% dextrose of the 100ml after filter degerming is added afterwards.

9.YPDS culture medium

Yeast extract 10g, peptone 20g, D-sorbite 182.2g are dissolved in 900ml deionized water, high pressure sterilization, 20% dextrose of the 100ml after filter degerming is added after cooling.

10.BMGY fluid nutrient medium

Yeast extract 10g, peptone 20g, no amino acid yeast nitrogen 13.4g, glycerol 10g, potassium phosphate 26.631g, It is dissolved in the sterilizing of 1000ml distilled water mesohigh, is cooled to room temperature, adjusts pH to 6.0,4 DEG C save backup.

11. the configuration of 1% Ago-Gel

According to dosage, the TAE buffer of every 100ml is added 1g agarose, is boiled using microwave stove heating, make agarose Melt completely, a small amount of ethidium bromide (EB) is added dropwise in room temperature when being cooled to non-scald on hand, be poured into after mixing and be well placed comb in advance Glue groove in, until room temperature is cooled to after solidification completely, to take out comb i.e. usable.

The fusion protein yeast of embodiment 1pPINK α-HC/PTD-HSA-L- α-MSH and pPINK α-HC/HSA-L- α-MSH The construction and expression of expression vector

One, the building of pPINK α-HC/PTD-HSA-L- α-MSH carrier

1. designing PCR primer:

NFT1:TCTCTCGAGAAAAGGTACGGTAGAAAGAAACGTAGACAAAGACGTAGA

NFT2:GAAAGAAACGTAGACAAAGACGTAGA GATGCACACAAGAGTGAG

R2:GCTCCATAGAGTAAGAACCAGATCCACCTCCAGAACCTCCACCTCCTAAGCCTAAGGCAGCTTG

R1:TTAAATGGCCGGCCGGTACCttaAACTGGCTTACCCCATCTAAAGTGCTCCATAGAGTAAGAAC

2. first round PCR amplification: using pcDNA3.1-HSA Plasmid DNA as template, using NFT2 and R2 as upstream and downstream Primer carries out PCR amplification.Reaction condition is as follows: 1. it is denaturalized: 94 DEG C, and 5min；2. denaturation: 94 DEG C, 1min；3. renaturation: 55 DEG C, 30S；4. extending: 72 DEG C, 2min；5. return step " 2. " carries out 35 circulations；6. extending: 72 DEG C, 5min, global cycle number is 30 times.PCR product is subjected to 1% agarose gel electrophoresis, amplifies the part PTD-HSA-L- of about 1.8kb size as the result is shown α-MSH band.

3. the second wheel PCR amplification: using the product of first round PCR amplification as template, using NFT1 and R1 as upstream and downstream Primer carries out PCR amplification.Reaction condition is as follows: 1. it is denaturalized: 94 DEG C, and 5min；2. denaturation: 94 DEG C, 1min；3. renaturation: 55 DEG C, 30S；4. extending: 72 DEG C, 2min；5. return step " 2. " carries out 35 circulations；6. extending: 72 DEG C, 5min, global cycle number is 30 times.PCR product is subjected to 1% agarose gel electrophoresis, amplifies the complete PTD-HSA-L- of about 1.8kb size as the result is shown The above PCR product is carried out glue recycling by α-MSH DNA band.

4.KpnI and StuI double digestion pPINK α-HC (Invitrogen Products) Plasmid DNA, glue recycling obtain PPINK α-HC (KpnI/StuI) carrier segments, the pPINK α-HC (KpnI/ for being recycled above-mentioned glue using Infusion kit StuI) carrier segments and PTD-HSA-L- α-MSH DNA target gene fragment carry out recombining reaction, and reaction product converts large intestine bar Bacterium competence TOP10 is applied to ammonia benzyl resistance LB 37 DEG C of overnight incubations of plate, screening positive clone.Institute's clone send Invitrogen Company's sequencing, the correct clone designation of sequence are pPINK α-HC/PTD-HSA-L- α-MSH.

Two, the building of pPINK α-HC/HSA-L- α-MSH carrier

1. designing PCR primer:

NF:TCTCTCGAGAAAAGGGATGCACACAAGAGTGAG

R2:GCTCCATAGAGTAAGAACCAGATCCACCTCCAGAACCTCCACCTCCTAAGCCTAAGGCAGCTTGR1: TTAAATGGCCGGCCGGTACCttaAACTGGCTTACCCCATCTAAAGTGCTCCATAGAGTAAGAAC

2. first round PCR amplification: using pcDNA3.1-HSA Plasmid DNA as template, drawing using NF and R2 as upstream and downstream Object carries out PCR amplification.Reaction condition is as follows: 1. it is denaturalized: 94 DEG C, and 5min；2. denaturation: 94 DEG C, 1min；3. renaturation: 55 DEG C, 30S；4. extending: 72 DEG C, 2min；5. return step " 2. " carries out 35 circulations；6. extending: 72 DEG C, 5min, global cycle number is 30 times.PCR product is subjected to 1% agarose gel electrophoresis, amplifies the part HSA-L- α-of about 1.8kb size as the result is shown MSH band.

3. the second wheel PCR amplification: using the product of first round PCR amplification as template, drawing using NF and R1 as upstream and downstream Object carries out PCR amplification.Reaction condition is as follows: 1. it is denaturalized: 94 DEG C, and 5min；2. denaturation: 94 DEG C, 1min；3. renaturation: 55 DEG C, 30S；4. extending: 72 DEG C, 2min；5. return step " 2. " carries out 35 circulations；6. extending: 72 DEG C, 5min, global cycle number is 30 times.PCR product is subjected to 1% agarose gel electrophoresis, amplifies the complete HSA-L- α-of about 1.8kb size as the result is shown The above PCR product is carried out glue recycling by MSH DNA band.

4.KpnI and StuI double digestion pPINK α-HC (Invitrogen Products) Plasmid DNA, glue recycling obtain PPINK α-HC (KpnI/StuI) carrier segments, the pPINK α-HC (KpnI/ for being recycled above-mentioned glue using Infusion kit StuI) carrier segments and HSA-L- α-MSH DNA target gene fragment carry out recombining reaction, and reaction product converts Escherichia coli sense By state TOP10, it is applied to ammonia benzyl resistance LB 37 DEG C of overnight incubations of plate, screening positive clone.Institute's clone send Invitrogen company Sequencing, the correct clone designation of sequence are pPINK α-HC/HSA-L- α-MSH.

Three, the expression of PTD-HSA-L- α-MSH and HSA-L- α-MSH fusion protein in yeast

Correct pPINK α-HC/PTD-HSA-L- α-MSH Plasmid DNA and pPINK α-HC/HSA-L- α-MSH matter will be sequenced PPINK α-HC/PTD-HSA-L- α-MSH and pPINK α-the HC/HSA-L- that grain DNA is linearized after being recycled with AflII digestion α-MSH segment, converts thermophilic pichia methanolica respectively, and transformed bacteria solution is then inoculated in PAD plate, and 30 DEG C are cultivated 3-4 days, chooses Take positive colony.It will obtain positive colony and be inoculated with BMGY fluid nutrient medium respectively, 30 DEG C are cultivated 48 hours, and BMMY is then forwarded to Inducing expression in culture medium after continuing 96 hours, 1500rpm low-temperature centrifugation 15 minutes, takes supernatant, SDS-PAGE electrophoresis detection egg White expression.The molecular weight of fusion protein PTD-HSA-L- α-MSH is about 70kDa, the amino acid sequence of PTD-HSA-L- α-MSH Column encode the DNA sequence dna of PTD-HSA-L- α-MSH as shown in SEQ ID NO:7 as shown in SEQ ID NO:8；Fusion protein The molecular weight of HSA-L- α-MSH is about 69kDa, and the amino acid sequence of HSA-L- α-MSH is as shown in SEQ ID NO:10, coding The DNA sequence dna of HSA-L- α-MSH is as shown in SEQ ID NO:9.

Across the blood-brain barrier function verifying of embodiment 2PTD-HSA-L- α-MSH

Experimental material

1. laboratory apparatus

Syringe, liquid-transfering gun, centrifuge (Hitachi), ultrapure water instrument (Millipore), Ultrasound Instrument, constant temperature training

Support case (Shanghai one is permanent), microplate reader (Thermo) etc..HSAElisa kit (Cygnus Technologies)

2. experimental animal

10 standard weight kunming mices, are purchased from Lanzhou University's Experimental Animal Center.

3. experimental method

The grouping and administration mode of mouse:

10 kunming mices are randomly divided into two groups, 18~22g of weight or so: 1- control group (injects HSA-L- α-MSH), The fusion protein group (injection PTD-HSA-L- α-MSH) of 2- α melanocyte-stimulating hormone(MSH).

Control group tail vein injection (150uL, 1 μm/kg) HSA-L- α-MSH.The fusion protein group of α melanocyte-stimulating hormone(MSH) Tail vein injection (150uL, 1 μm/kg) PTD-HSA-L- α-MSH.After 6 hours, anesthetized mice takes out hippocampal tissue, carries out group Knit homogenate.PTD-HSA-L- α-MSH in ELISA method detection hippocampal homogenates is horizontal.

Analysis of experimental results:

Table 1

The above description of test present invention provides PTD-HSA-L- α-MSH fusion protein can be effectively enough across blood-brain barrier.

Embodiment 3PTD-HSA-L- α-MSH bioactivity research

Experimental material

1. laboratory apparatus

Syringe, liquid-transfering gun, centrifuge (Hitachi), ultrapure water instrument (Millipore), Ultrasound Instrument, constant temperature training

Support case (Shanghai one is permanent), microplate reader (Thermo) etc..TNF-a Elisa kit (is) up to section

2. experimental animal

20 standard weight kunming mices, are purchased from Lanzhou University's Experimental Animal Center.

3. experimental method

The grouping and administration mode of mouse:

Lipopolysaccharides LPS (Lipopolysaccharides) i.e. Gram-negative bacteria endotoxin is gramnegative bacterium Cell wall constituent, mouse intracerebroventricular injection LPS can cause nerve retrograde affection and inflammatory reaction in brain, this reality The inspection for index is tested with the tumor necrosis factor (tumor necrosis factors a, TNF-a) in mouse brain hippocampal tissue The fusion protein for surveying α-MSH of the present invention mends the drug effect in inflammatory model in mouse brain as caused by LPS.

20 kunming mices are divided into four groups, 18~22g of weight or so: 1- control group, 2-LPS group, 3-PTD-HSA-L- α-MSH+LPS group, 4-a-MSH+LPS group.Control group injects 300 μ L physiological saline in two times, and per injection amount is 150 μ L；LPS Group first injects 150 μ L LPS (5mg/kg), rear to inject 150 μ L physiological saline；3-PTD-HSA-L- α-MSH+LPS group is first injected 150 μ L LPS (5mg/kg), it is rear to inject 150 μ L PTD-HSA-L- α-MSH (1 μM/kg)；A-MSH+LPS group first injects 150 μ L LPS (5mg/kg), it is rear to inject 150 μ L a-MSH.After 2 hours, mouse is put to death, hippocampal tissue is taken out rapidly, carries out tissue homogenate. This experiment injection system is intraperitoneal injection.

TNF-α in ELISA method detection hippocampal homogenates is horizontal.

Analysis of experimental results:

Grouping	TNF-α(pg/mg)
		Control group	14.8±4.2
LPS group	191.9±9.1
		LPS+PTD-HSA-L- α-MSH group	38.3±18.3
LPS+ α-MSH group	155.8±10.3

Compared with the control group, TNF-α is significantly raised in LPS group Hippocampus of Mice, illustrates model foundation success；With α- MSH+LPS group is compared, and TNF-α significantly reduces in Hippocampus of Mice in PTD-HSA-L- α-MSH group, is illustrated of the present invention PTD-HSA-L- α-MSH can reduce the inflammation of central nervous system significantly, more convincingly demonstrate PTD-HSA-L- α-MSH energy Enough across blood-brain barrier, while original effect of α-MSH is kept, to treat brain inflammation and related disease.

The above content is a further detailed description of the present invention in conjunction with specific preferred embodiments, and it cannot be said that Specific implementation of the invention is only limited to these instructions.For those of ordinary skill in the art to which the present invention belongs, exist Under the premise of not departing from present inventive concept, a number of simple deductions or replacements can also be made, all shall be regarded as belonging to of the invention Protection scope.

Claims (7)

1. a kind of fusion protein of α melanocyte-stimulating hormone(MSH), which is characterized in that the fusion protein includes 1 protein transduction knot Structure domain (Protein transduction domian, PTD), 1 human serum albumins (Albumin Human, HSA), one α melanocyte-stimulating hormone(MSH) (α-Melanocyte stimulating hormone, α-MSH) and a link peptide L, HSA pass through Link peptide L is connect with α-MSH, and the DNA sequence dna of the link peptide L is GGAGGTGGAGGTTCTGGAGGTGGATCTGGT, amino Acid sequence is GGGGSGGGSG, and the amino acid sequence of the fusion protein is as shown in SEQ ID NO:8, encoding said fusion protein Amino acid sequence DNA sequence dna as shown in SEQ ID NO:7.

2. a kind of fusion protein of α melanocyte-stimulating hormone(MSH) according to claim 1, which is characterized in that the fusion egg It is white to be prepared using yeast cell to express.

3. a kind of fusion protein of α melanocyte-stimulating hormone(MSH) according to claim 2, which is characterized in that the yeast For thermophilic pichia methanolica (Pichia pastoris).

4. a kind of preparation method of the fusion protein of α melanocyte-stimulating hormone(MSH) as claimed in claim 3, which is characterized in that institute The method of stating comprises the steps of:

1. full genome synthesizes α-MSH sequence；

2. obtaining PTD-HSA sequence by PCR amplification；

3. extending α-MSH and 2. middle PTD-HSA in round pcr connection 1. using merging, passes through In-fusion technology and connect mesh Segment and carrier, obtain the expression of recombinant yeast of the DNA sequence dna containing the fusion protein for encoding the α melanocyte-stimulating hormone(MSH) Carrier；

4. by step, 3. the recombinant yeast expression vector is transformed into competent E.coli TOP10 cell, by the matter Grain is transformed into host expression system and is expressed to get the fusion protein, wherein the host expression system is thermophilic methanol Pichia pastoris.

5. a kind of fusion protein amino of the α melanocyte-stimulating hormone(MSH) containing coding as described in any one of claim 1-3 The recombinant expression carrier of the DNA sequence dna of acid sequence.

6. a kind of host expression system containing the recombinant expression carrier described in claim 5.

7. the fusion protein of α melanocyte-stimulating hormone(MSH) described in any one of claim 1-3 is in preparation inhibits or treats Application in the drug of pivot nervous system inflammation.