CN106905415B - Polypeptide combined with drug-resistant cervical carcinoma cancer cell line Hela cell membrane surface molecule - Google Patents
Polypeptide combined with drug-resistant cervical carcinoma cancer cell line Hela cell membrane surface molecule Download PDFInfo
- Publication number
- CN106905415B CN106905415B CN201710099311.1A CN201710099311A CN106905415B CN 106905415 B CN106905415 B CN 106905415B CN 201710099311 A CN201710099311 A CN 201710099311A CN 106905415 B CN106905415 B CN 106905415B
- Authority
- CN
- China
- Prior art keywords
- drug
- polypeptide
- phage
- membrane surface
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
Abstract
The invention discloses a polypeptide combined with a drug-resistant cervical carcinoma cell line Hela cell membrane surface molecule, which provides the functionality of a protein tag for the drug-resistant cervical carcinoma cell line Hela cell membrane surface molecule, and is selected from one of the following amino acid sequences: SEQ ID NOs: 1.2, 3, 4, 5, 6, 7, 8, 9 and 10. The invention also discloses a nucleic acid which codes the polypeptide and is selected from one of the following base sequences: SEQ ID NOs: 11. 12, 13, 14, 15, 16, 17, 18, 19 and 20. The polypeptide or the nucleic acid is applied to the combination with the drug-resistant cervical cancer cell line Hela cell membrane surface molecule. The polypeptide provided by the invention has strong affinity to tumor cells, and can be used as a targeting head group for targeting specific tumor cells; moreover, the combination of the polypeptides and tumor cells can inhibit certain functions of cell membranes, possibly inhibit the growth of the tumor cells or have synergistic effect with chemotherapeutic drugs, have therapeutic effect, and can be used for the targeted therapy of tumors.
Description
Technical Field
The invention belongs to the technical field of biology, and relates to a polypeptide combined with a drug-resistant cervical carcinoma cell line Hela cell membrane surface molecule.
Background
The phage display technology (phage display technology) is a biological technology in which a DNA sequence of a foreign protein or polypeptide is inserted into an appropriate position of a structural gene of a coat protein of a phage, so that the foreign gene is expressed along with the expression of the coat protein, and at the same time, the foreign protein is displayed on the surface of the phage along with the reassembly of the phage.
The targeted therapy of tumor cells has been the focus of research. Hela cells, which are artificially cultured and have the ability to proliferate indefinitely, have been produced for an entire 65 years to 2016. In the medical field, Hela cells are widely used in tumor research, biological experiments or cell culture, and have become very important tools in medical research. Such cells were first isolated in tissue culture from human bodies, and were continuously cultured in research rooms all over the world, and thus, they were widely used in various studies. They readily proliferate in vitro to form an epithelial cell arrangement. Therefore, the search of polypeptide molecules capable of specifically binding to Hela cells as protein tags is of great significance for the search of targeted therapy of tumor cells.
Disclosure of Invention
An object of the present invention is to solve at least the above problems and/or disadvantages and to provide at least the advantages described hereinafter.
It is still another object of the present invention to provide a polypeptide that binds to a cell membrane surface molecule of Hela of a drug-resistant cervical cancer cell line.
Therefore, the technical scheme provided by the invention is as follows:
the polypeptide is combined with the drug-resistant cervical carcinoma cell line Hela cell membrane surface molecule, provides the protein label functionality for the drug-resistant cervical carcinoma cell line Hela cell membrane surface molecule, and is selected from one of the following amino acid sequences: SEQ ID NOs: 1.2, 3, 4, 5, 6, 7, 8, 9 and 10.
Preferably, in the polypeptide combined with the cell membrane surface molecule of Hela of the drug-resistant cervical cancer cell line, the polypeptide is selected from one of the following amino acid sequences: SEQ ID NOs: 1.2, 3, 4 and 5.
A nucleic acid encoding the polypeptide, wherein the nucleic acid is selected from one of the following base sequences: SEQ ID NOs: 11. 12, 13, 14, 15, 16, 17, 18, 19 and 20.
Preferably, the nucleic acid is selected from one of the following base sequences: SEQ ID NOs: 11. 12, 13, 14 and 15.
The polypeptide or the nucleic acid is applied to the combination with the drug-resistant cervical cancer cell line Hela cell membrane surface molecule and the tumor targeted therapy.
The invention at least comprises the following beneficial effects:
the polypeptide provided by the invention has strong affinity to tumor cells, and can be used as a targeting head group for targeting specific tumor cells; moreover, the combination of the polypeptides and tumor cells can inhibit certain functions of cell membranes, possibly inhibit the growth of the tumor cells or have synergistic effect with chemotherapeutic drugs, have therapeutic effect, and can be used for the targeted therapy of tumors.
Additional advantages, objects, and features of the invention will be set forth in part in the description which follows and in part will become apparent to those having ordinary skill in the art upon examination of the following or may be learned from practice of the invention.
Drawings
FIG. 1 is a photograph of a phage culture at the time of phage titer determination in a first round of panning in one embodiment of the present invention;
FIG. 2 is a photograph of a phage culture at the time of phage titer determination in a second round of panning in one embodiment of the present invention;
FIG. 3 is a photograph of a phage culture at the time of phage titer determination in a third round of panning in accordance with one embodiment of the present invention;
FIG. 4 shows the affinity detection result (OD value) of the third round of screening phage clones by Elisa on HeLa drug-resistant cells;
FIG. 5 is the relative affinity (P/N value) of the third round of screening phage clones for HeLa resistant cells by Elisa test;
FIG. 6 is a diagram showing the detection of DNA extraction results.
Detailed Description
The present invention is further described in detail below with reference to the attached drawings so that those skilled in the art can implement the invention by referring to the description text.
It will be understood that terms such as "having," "including," and "comprising," as used herein, do not preclude the presence or addition of one or more other elements or groups thereof.
As shown in fig. 1 to 6, the present invention provides a polypeptide bound to a drug-resistant cervical cancer cell line Hela cell membrane surface molecule, wherein the polypeptide provides a protein tag functionality for the drug-resistant cervical cancer cell line Hela cell membrane surface molecule, and the polypeptide is selected from one of the following amino acid sequences: SEQ ID NOs: 1.2, 3, 4, 5, 6, 7, 8, 9 and 10.
In one embodiment of the present invention, preferably, the polypeptide binds to a cell membrane surface molecule of Hela of the drug-resistant cervical cancer cell line, wherein the polypeptide is selected from one of the following amino acid sequences: SEQ ID NOs: 1.2, 3, 4 and 5.
The invention also provides a nucleic acid for encoding the polypeptide, wherein the nucleic acid is selected from one of the following base sequences: SEQ ID NOs: 11. 12, 13, 14, 15, 16, 17, 18, 19 and 20.
In one embodiment of the present invention, the nucleic acid is preferably selected from one of the following base sequences: SEQ ID NOs: 11. 12, 13, 14 and 15.
The polypeptide or the nucleic acid is applied to the combination with the drug-resistant cervical cancer cell line Hela cell membrane surface molecule and the tumor targeted therapy.
In order to make the technical scheme of the invention more clearly understood by those skilled in the art, the invention also provides the following embodiments:
examples
First, main reagent and instrument
(1) Human cervical epithelial cell (Tianjin Saier biotechnology Co., Ltd.)
(2) HeLa drug-resistant cell strain (Xinjiang military department general hospital pharmacy laboratory construction)
(3) Phage random heptapeptide library (Ph.D-7TM phase display peptide library) (Biolabs, UK)
(4) PRIM 1640 medium (Gibco, USA)
(5) High-grade fetal bovine serum (Gibco, USA)
(6) Trypsin (Amresco, USA)
(7) Dimethyl sulfoxide (DMSO) (Sigma, USA Co.)
(8) Tryptone, yeast extract (OXOID, England)
(9) Agarose, agar powder (Guangdong Huanji Microbe science and technology Co., Ltd.)
(10) PEG8000, Tris, BSA (Beijing Dingguo biology Co., Ltd.)
(11) IPTG, Xgal (Beijing Dingguo biology Co., Ltd.)
(12) 12-well plate, T25 flask (Orange Scientific, Belgium)
(13) Tetracycline (Beijing Dingguo biology Co., Ltd.)
(14) Tween 20 (Tianjin City Fuchen chemical reagent factory)
(15) Paraformaldehyde (Beijing Ding Guo biology Co., Ltd.)
(16) HRP/anti-M13anti foods (Amersham Biosciences, USA)
(17) NaI (Beijing Ding national biology Co., Ltd.)
(18) EDTA (Beijing Ding Guo biology Co., Ltd.)
(19) NaCl (Beijing ancient country biology Co., Ltd.)
(20)NaHCO3(Beijing ancient country biology Co., Ltd.)
(21)NaN3(Beijing ancient country biology Co., Ltd.)
(22) LB culture medium: each liter contains: 10g of Bacto-Tryptone, 5g of yeast extract and 5g of NaCl. Autoclaving, and storing at room temperature.
(23) LB/IPTG/Xgal plates: LB medium +15g/L agar powder. Autoclaving, cooling to below 70 deg.C, adding 1ml IPTG/Xgal, mixing and plating. The plates were stored at 4 ℃ in the dark.
(24) Top agar layer: each liter contains: 10g of Bacto-Tryptone, 5g of yeast extract,5g of NaCl and 7g of agar powder. Autoclaved and divided into 50ml aliquots. The solid medium is stored at room temperature and melted by a microwave oven.
(25) Tetracycline stock solution: dissolved in ethanol water (1:1) at a concentration of 20 mg/ml. Storage at-20 ℃ protected from light. Shaking before use.
(26) LB-Tet plates: LB medium +15g/L agar powder. Autoclaving, cooling to below 70 deg.C, adding 1ml tetracycline stock solution, mixing and pouring onto a plate. The plates were stored at 4 ℃ in the dark, if the plates were brown or black.
(27) Blocking buffer: 0.1M NaHCO3(pH 8.6),5mg/ml BSA, 0.02% NaN 3. Filtering, sterilizing and storing at 4 ℃.
(28) TBS 50mM Tris-HCl (pH 7.5),150mM NaCl. Autoclaving, and storing at room temperature.
(29) PEG/NaCl 20% (w/v) PEG-8000,2.5M NaCl. Autoclaving, and storing at room temperature.
(30) Iodide buffer solution: 10mM Tris-HCl (pH8.0), 1mM EDTA,4M NaI. Storing at room temperature in dark. (31) IPTG/Xgal formulation: 1.25g of IPTG (isoproyl. beta. -D-thiogalactoside) and 1g of Xgal (5-Bromo-4-chloro-3-indolyl. beta. -D-galactolactide) were dissolved in 25ml of dimethylformamide. The solution is stored at-20 ℃ in the dark
(32)CO2Incubator (Thermo, USA)
(33) SW-CJ-1FD cell clean bench (Suzhou decontamination equipment Co., Ltd.)
(34) BHC-1600A/B3 biological safety cabinet (Suzhou Antai air technology Co., Ltd.)
(35) THZ-C constant temperature oscillator (Guangzhou Shenhua biotechnology limited)
(36) Ultra-low temperature refrigerator at-80 ℃ (Thermo, USA)
(37) C3i-CR3i Low temperature high speed centrifuge (Thermo, USA)
(38) EDLTA 320pH meter (Mettler Toledo, USA)
(39) SK-1 rapid mixer (Jiangsu Guohua instrument factory)
(40) HY-5 convolution oscillator (Honghua instrument factory of Jintan city, Jiangsu province)
(41) Vertical pressure steam sterilizer YXQ-LS-30SII (Shanghai Bosch real Co., Ltd. medical facility)
(42) FA1004 type electronic balance (Shanghai Liangping instrument and meter Co., Ltd.)
(43) DK-8D type electric constant temperature water tank (Shanghai-Hengshi Co., Ltd.)
(44)6131 biological spectrophotometer (Eppendorf, Germany)
(45) Enzyme-linked immunity detector (Shanghai Yonike instrument Co., Ltd.)
Second, experimental method and procedure
Peptide library screening:
1. human cervical epithelial cells and drug-resistant HeLa cells in logarithmic growth phase are inoculated in a 12-well plate, and the density is 70-80% of cell mass in 24 h.
2. ER2738 single clones (plates plated for phage titer determination) were picked into 10ml LB liquid medium.
Washing human cervical epithelial cells once with PBS, adding 1ml of blocking solution into each hole, and acting at 37 ℃ for at least 1 h.
4. And removing the blocking liquid. The plate was then washed 6 times with PBS. Spin each time so that the bottom and edge of the plate or well are washed, pour out the buffer, and do so quickly to avoid drying the plate.
5. Diluted 4X 10 with 1ml of cell culture medium10Phage (i.e., 10. mu.l of the original library) were then added to the cell plate and gently shaken at room temperature for 60 min.
And 6, washing the HeLa drug-resistant cells by PBS, adding 1ml of confining liquid into each hole, acting for at least 1h at 37 ℃, and quickly washing the plate by PBS for 6 times.
7. Transferring the phage mixed solution incubated with the human cervical epithelial cells to a HeLa drug-resistant cell plate, and gently shaking at room temperature for 60 min.
8. The plate was washed 10 times with PBS buffer as described in 4, and the bound molecules were separated with nonspecific buffer 1ml0.2MGlycine-HCl (pH2.2), 1mg/ml BSA: gently shake for 10min and the eluate is sucked into another clean microfuge tube. The eluate was then neutralized with 150. mu.l of 1M Tris-HCl (pH 9.1).
9. The eluate was stored overnight at 4 ℃ and amplified the next day. At this time, ER2738 was cultured overnight in LB-Tet medium, and the next day, culture 1:100 was diluted in 20ml LB (contained in 250ml Erlenmeyer flask) and the unamplified eluate was added. The culture was vigorously shaken at 37 ℃ for 4.5 hours, and the step 11) was continued.
10. The remaining eluate should be amplified: the eluate was added to 20ml of ER2738 culture (the cells should be in pre-log phase) and incubated vigorously at 37 ℃ for 4.5h with shaking.
11. The culture was transferred into a centrifuge tube and then centrifuged at 10,000rpm at 4 ℃ for 10 min. Transferring the supernatant into another centrifuge tube, and centrifuging.
12. The upper 80% of the supernatant was transferred to a fresh tube and 1/6 volumes of PEG/NaCl were added. The phage are allowed to settle at 4 ℃ for at least 60min, preferably overnight.
PEG precipitation was centrifuged at 10,000rpm at 13.4 ℃ for 15 min. The supernatant was decanted, centrifuged briefly again and the residual supernatant was aspirated.
14. The pellet was resuspended in 1ml TBS and the suspension transferred to a microfuge tube and centrifuged at 4 ℃ for 5min to pellet the residual cells.
15. The supernatant was transferred to another fresh microfuge tube and reprecipitated with 1/6 volumes of PEG/NaCl. Incubate on ice for 60 min. Centrifuging at 4 deg.C for 10min, discarding supernatant, centrifuging for a short time, and removing residual supernatant by pipette.
16. The pellet was resuspended in 200. mu.l TBS, 0.02% NaN3In (1). Centrifuge for 1min and precipitate any residual insoluble material. The supernatant was transferred to a fresh tube. This is the eluate after amplification.
17. The eluate after amplification was titrated with LB/IPTG/Xgal plates according to the general M13 method. Stored at 4 ℃.
18. Human cervical epithelial cells in logarithmic growth phase were seeded in 12-well plates for a second round of panning.
19. Determination of phage titer:
recipient bacterium ER2738 was cultured to mid-log phase (OD600 about 0.5) and divided into 200. mu.L aliquots; after the phage to be detected is diluted by 10 times with LB culture medium, 10 mul of the phage to be detected is taken per concentration and mixed with 200 mul of ER2738 bacterial liquid in early logarithmic growth phase, then added with 3mL of LB top layer agar which is preserved at 45 ℃, poured into an LB solid plate containing IPTG/Xgal rapidly, kept overnight at 37 ℃ and counted into blue plaques. Calculating the formula: phage titer (pfu/10 μ L) is plaque number × dilution, i.e., phage forming units per 10 μ L. As shown in figure 1 of the drawings, in which,
the result of the phage titer assay was: 116 clones; 1.16X 1015pfu
20. The number of blue spots on the plate was counted to determine the titer. By using thisValues are calculated corresponding to 1-2 x 1011Amount of pfu added. If the titer is too low, the next rounds of panning may be performed down to 109The phage loading of pfu was tested.
21. And (3) carrying out a second round of panning: the eluate obtained by the first panning and amplification is 1-2X 1011The phage amount of pfu was subjected to panning.
22. The amplified titers of the eluates from the second round of panning were determined on LB/IPTG/Xgal plates. As shown in figure 2 of the drawings, in which,
the result of the phage titer assay was: 112 single clones; 1.12X 1015pfu
23. Then 1 block of 12-well plate of HeLa-resistant cells was inoculated for the third round of panning.
24. Performing a third panning: 2X 10 of the eluate amplified by the second panning11Amount of phage in pfu.
25. The titer of the eluate from the third panning run was determined on LB/IPTG/Xgal plates without amplification. The third round of eluate was not necessarily amplified. Plaques obtained when titre was determined could be used for sequencing: as long as care is taken not to exceed 18 hours, deletion is likely to occur when the plate is cultured for too long a period. The remaining eluate was stored at 4 ℃. As shown in fig. 3.
The result of the phage titer assay was: 86 clones; 8.6X 1014pfu。
(II) ELISA for identifying affinity of phage to HeLa-resistant cells
1. HeLa drug-resistant cell is added at a ratio of 1X 104Inoculating to 96-well plate at 37 deg.C and 5% CO2After the cells are cultured in an incubator for 24 hours, carrying out serum-free treatment on the cells for 1 hour, cleaning the cells, and then fixing the cells for 20min by using 4% paraformaldehyde;
slightly washing with PBS, treating with 0.1% TritonX-100 for 10min, and washing with PBST-0.05% for 3 times (1 min/time);
after blocking for 1h with 3.2% PBS-BSA, a titer of about 10 was added12pfu phage incubated at 37 ℃ for 2h, PBST-0.05%
Washing for 3 times (1 min/time);
4. adding HRP-anti M13antibody, incubating at 37 deg.C for 1h, washing with PBST-0.05% solution for 3 times, 1 min/time;
5. color development was performed with TMB, the reaction was stopped with HCl, and the reading was taken at 450nm with a microplate reader. Phage stock blue spots were randomly picked as controls and P/N >2.1 was positive.
6. After three rounds of continuous screening, 30 phage clones were randomly selected from the phage peptide library and named as phase-1, phase-2, phase-3, …, and phase-30, respectively. The phage library blue spots were used as controls, and the affinity of phage clones for HeLa-resistant cells was preliminarily identified by ELISA, and the OD values of each phage clone were obtained, as shown in fig. 4.
When P/N (OD clone/OD random control clone) >2.1, it can be said that this clone has high affinity for HeLa resistant cells. ELISA results showed 17 positive clones with P/N > 2.1. There were 16 clones with P/N >2.5 and above, 2 clones with P/N >3.0, phase-4 and phase-22, respectively, as shown in FIG. 5. The P/N value represents the affinity to the tumor cells, and the greater the P/N value, the stronger the binding capacity. The 10 phages with the largest P/N value were selected and subjected to amplification sequencing as follows.
(III) amplification sequencing of plaques
1. The overnight ER2738 culture was diluted 1:100 and inoculated into LB medium in 1ml portions into culture tubes. One tube for each clone to be identified (ten clones with the highest affinity were selected).
Shaking-culturing at 2.37 deg.C for 4.5 h.
3. The culture was transferred into a microcentrifuge tube and centrifuged at 14000rpm for 30 sec. The supernatant was transferred to a fresh tube and centrifuged again. 80% of the supernatant was transferred to a fresh centrifuge tube by a pipette, which was the amplified phage stock solution and was stored at 4 ℃ for several weeks with little effect on titer. The long-term storage is carried out by diluting with sterilized glycerol 1:1 and storing at-20 ℃.
4. Mu.l of phage-containing supernatant was transferred to a fresh centrifuge tube.
5. Add 200. mu.l PEG/NaCl, reverse mix, and let stand at room temperature for 10 min.
Centrifuging at 14000rpm at 6.4 ℃ for 10min, and discarding the supernatant.
7. Centrifuge briefly and carefully aspirate the residual supernatant.
8. The pellet was resuspended thoroughly in 100. mu.l iodide buffer and 250. mu.l ethanol was added. Incubate at room temperature for 10 min. A short incubation at room temperature precipitates the single-stranded phage DNA while most of the phage proteins remain in solution.
Centrifuge at 14000rpm for 10min at 9.4 ℃ and discard the supernatant. The precipitate was washed with 500. mu.l 70% ethanol (-20 precooling) and briefly dried under vacuum.
10. The pellet was resuspended in 30. mu.l of TE [10mM Tris-HCl (pH8.0), 1mM EDTA ].
11. Quantification was performed by agarose gel electrophoresis. Mu.l (approximately 0.5ug of purified single-stranded M13mp18DNA) of the above template solution was sufficient for sequencing with a peptide library with sequencing primer-96 g of III primer for sequencing by Jinzhi Biotech, Suzhou. In FIG. 6, the gel identification result shows that the DNA extraction quality of each clone is good, and the gel identification result can be used for subsequent sequencing analysis.
Through the invention, 10 polypeptide molecules which can be combined with Hela cell membrane surface molecules are obtained as protein tags.
1, sequencing result: CTCAGGCATAGGACGCTGAAC
S:GTTCAGCGTCCTATGCCTGAG(SEQ ID NO：11)
Peptide:Val Gln Arg Pro MET Pro Glu(VQRPMPE)(SEQ ID NO：1)
P/N2.800613497, phase-2 in fig. 5.
2, sequencing result: AGCATACAAAGACGCCAAAGA
S:TCTTTGGCGTCTTTGTATGCT(SEQ ID NO：12)
Peptide:Ser Leu Ala Ser Leu Tyr Ala(SLASLYA)(SEQ ID NO：2)
P/N3.171779141, phase-4 in fig. 5.
3, sequencing result: AS ATGCGCCCGCGTCACATAAGA phage (bacteriophage)
S:TCTTATGTGACGCGGGCGCAT(SEQ ID NO：13)
Peptide:Ser Tyr Val Thr Arg Ala His(SYVTRAH)(SEQ ID NO：3)
P/N2.898773006, phase-5 in fig. 5.
4, sequencing result: AS CGAATCATGAGCATACTGCGT phage (bacteriophage)
S:ACGCAGTATGCTCATGATTCG(SEQ ID NO：14)
Peptide:Thr Gln Tyr Ala His Asp Ser(TQYAHDS)(SEQ ID NO：4)
P/N2.947852761, phase-8 in fig. 5.
5, sequencing result: AS AGCCGGAGGAGCCGCAAGACT phage (bacteriophage)
S:AGTCTTGCGGCTCCTCCGGCT(SEQ ID NO：15)
Peptide:Ser Leu Ala Ala Pro Pro Ala(SLAAPPA)(SEQ ID NO：5)
P/N2.8343558281, phase-12 in fig. 5.
6, sequencing result: CGTAGGCCCCGGCGAAAGCTT
S:AAGCTTTCGCCGGGGCCTACG(SEQ ID NO：16)
Peptide:Lys Leu Ser Pro Gly Pro Thr(KLSPGPT)(SEQ ID NO：6)
P/N2.662576687, phase-14 in fig. 5.
7, sequencing result: CCGAAACGGAGGCGGCGACAT
S:ATGTCGCCGCCTCCGTTTCGG(SEQ ID NO：17)
Peptide:Met Ser Pro Pro Pro Phe Arg(MSPPPFR)(SEQ ID NO：7)
P/N2.825153374, phase-16 in fig. 5.
8, sequencing result: AS AGGAAGCGAAATCGTACGCTC phage (bacteriophage)
S:GAGCGTACGATTTCGCTTCCT(SEQ ID NO：18)
Peptide:Glu Arg Thr Ile Ser Leu Pro(ERTISLP)(SEQ ID NO：8)
P/N3.208588957, phase-22 in fig. 5.
9, sequencing result: CTGCGCACCCGAATTCAAAGC
S:GCTTTGAATTCGGGTGCGCAG(SEQ ID NO：19)
Peptide:Ala Leu Asn Ser Gly Ala Gln(ALNSGAQ)(SEQ ID NO：9)
P/N2.76380368, phase-23 in fig. 5.
10, sequencing result: CTACGTCGGCCCACCACCCAG
S:CTGGGTGGTGGGCCGACGTAG(SEQ ID NO：20)
Peptide:Leu Gly Gly Gly Pro Thr-(LGGGPT-)(SEQ ID NO：10)
P/N2.650306748, phase-26 in fig. 5.
Wherein, Peptide: Ser Leu Ala Ser Leu Tyr Ala (SLASLYA) (SEQ ID NO: 2)
Peptide:Ser Tyr Val Thr Arg Ala His(SYVTRAH)(SEQ ID NO：3)
Peptide:Thr Gln Tyr Ala His Asp Ser(TQYAHDS)(SEQ ID NO：4)
Peptide:Ser Leu Ala Ala Pro Pro Ala(SLAAPPA)(SEQ ID NO：5)
Peptide:Glu Arg Thr Ile Ser Leu Pro(ERTISLP)(SEQ ID NO：8)
The 5 polypeptide sequences have stronger affinity with HeLa drug-resistant cells.
The polypeptide provided by the invention has strong affinity to tumor cells, and can be used as a targeting head group for targeting specific tumor cells; moreover, the combination of the polypeptides and tumor cells can inhibit certain functions of cell membranes, possibly inhibit the growth of the tumor cells or have synergistic effect with chemotherapeutic drugs, have therapeutic effect, and can be used for the targeted therapy of tumors.
While embodiments of the invention have been described above, it is not limited to the applications set forth in the description and the embodiments, which are fully applicable in various fields of endeavor to which the invention pertains, and further modifications may readily be made by those skilled in the art, it being understood that the invention is not limited to the details shown and described herein without departing from the general concept defined by the appended claims and their equivalents.
SEQUENCE LISTING
General hospital in Xinjiang military area
<120> polypeptide combined with drug-resistant cervical carcinoma cell line Hela surface molecule and application thereof
<130> 2016
<160> 20
<170> PatentIn version 3.5
<210> 1
<211> 7
<212> PRT
<213> phage (bacteriophage)
<400> 1
Val Gln Arg Pro Met Pro Glu
1 5
<210> 2
<211> 7
<212> PRT
<213> phage (bacteriophage)
<400> 2
Ser Leu Ala Ser Leu Tyr Ala
1 5
<210> 3
<211> 7
<212> PRT
<213> phage (bacteriophage)
<400> 3
Ser Tyr Val Thr Arg Ala His
1 5
<210> 4
<211> 7
<212> PRT
<213> phage (bacteriophage)
<400> 4
Thr Gln Tyr Ala His Asp Ser
1 5
<210> 5
<211> 7
<212> PRT
<213> phage (bacteriophage)
<400> 5
Ser Leu Ala Ala Pro Pro Ala
1 5
<210> 6
<211> 7
<212> PRT
<213> phage (bacteriophage)
<400> 6
Lys Leu Ser Pro Gly Pro Thr
1 5
<210> 7
<211> 7
<212> PRT
<213> phage (bacteriophage)
<400> 7
Met Ser Pro Pro Pro Phe Arg
1 5
<210> 8
<211> 7
<212> PRT
<213> phage (bacteriophage)
<400> 8
Glu Arg Thr Ile Ser Leu Pro
1 5
<210> 9
<211> 7
<212> PRT
<213> phage (bacteriophage)
<400> 9
Ala Leu Asn Ser Gly Ala Gln
1 5
<210> 10
<211> 6
<212> PRT
<213> phage (bacteriophage)
<400> 10
Leu Gly Gly Gly Pro Thr
1 5
<210> 11
<211> 21
<212> DNA
<213> phage (bacteriophage)
<400> 11
gttcagcgtc ctatgcctga g 21
<210> 12
<211> 21
<212> DNA
<213> phage (bacteriophage)
<400> 12
tctttggcgt ctttgtatgc t 21
<210> 13
<211> 21
<212> DNA
<213> phage (bacteriophage)
<400> 13
<210> 14
<211> 21
<212> DNA
<213> phage (bacteriophage)
<400> 14
acgcagtatg ctcatgattc g 21
<210> 15
<211> 21
<212> DNA
<213> phage (bacteriophage)
<400> 15
agtcttgcgg ctcctccggc t 21
<210> 16
<211> 21
<212> DNA
<213> phage (bacteriophage)
<400> 16
aagctttcgc cggggcctac g 21
<210> 17
<211> 21
<212> DNA
<213> phage (bacteriophage)
<400> 17
atgtcgccgc ctccgtttcg g 21
<210> 18
<211> 21
<212> DNA
<213> phage (bacteriophage)
<400> 18
<210> 19
<211> 21
<212> DNA
<213> phage (bacteriophage)
<400> 19
gctttgaatt cgggtgcgca g 21
<210> 20
<211> 21
<212> DNA
<213> phage (bacteriophage)
<400> 20
ctgggtggtg ggccgacgta g 21
Claims (3)
1. The polypeptide is combined with the drug-resistant cervical carcinoma cell line Hela cell membrane surface molecule, provides the protein label functionality for the drug-resistant cervical carcinoma cell line Hela cell membrane surface molecule, and is selected from one of the following amino acid sequences: SEQ ID NOs: 2.3, 4, 5 and 8.
2. A nucleic acid encoding the polypeptide of claim 1, wherein the nucleic acid is selected from one of the following base sequences: SEQ ID NOs: 12. 13, 14, 15 and 18.
3. The use of the polypeptide of claim 1 or the nucleic acid of claim 2 in the preparation of a medicament for the targeted treatment of drug-resistant cervical cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710099311.1A CN106905415B (en) | 2017-02-23 | 2017-02-23 | Polypeptide combined with drug-resistant cervical carcinoma cancer cell line Hela cell membrane surface molecule |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710099311.1A CN106905415B (en) | 2017-02-23 | 2017-02-23 | Polypeptide combined with drug-resistant cervical carcinoma cancer cell line Hela cell membrane surface molecule |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106905415A CN106905415A (en) | 2017-06-30 |
| CN106905415B true CN106905415B (en) | 2021-04-20 |
Family
ID=59208038
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710099311.1A Active CN106905415B (en) | 2017-02-23 | 2017-02-23 | Polypeptide combined with drug-resistant cervical carcinoma cancer cell line Hela cell membrane surface molecule |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106905415B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113527433B (en) * | 2021-07-14 | 2023-04-25 | 呈诺再生医学科技(珠海横琴新区)有限公司 | Polypeptide and application thereof in diagnosis and treatment of prostate cancer |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5821055A (en) * | 1985-01-14 | 1998-10-13 | Washington Research Foundation | Chlamydia major outer membrane protein |
| CN1306272C (en) * | 2000-11-17 | 2007-03-21 | 罗切斯特大学 | In vitro methods of producing and identifying immunoglobulin molecules in eukaryotic cells |
| CN102887942B (en) * | 2011-12-31 | 2015-02-25 | 四川大学 | Ovarian-cancer-targeted polypeptide |
| CN105039333B (en) * | 2015-08-21 | 2018-07-24 | 天津医科大学 | Hepatoma-targeting peptide and its application |
-
2017
- 2017-02-23 CN CN201710099311.1A patent/CN106905415B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN106905415A (en) | 2017-06-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113563463B (en) | Neutralizing nano antibody for resisting novel coronavirus SARS-CoV-2 and application thereof | |
| CN112552402B (en) | Anti-human EGFR nano antibody and application | |
| Ashby et al. | Use of peptide libraries for identification and optimization of novel antimicrobial peptides | |
| CN114478696B (en) | Novel affinity polypeptide of coronavirus spike protein receptor binding region RBD and application thereof | |
| CN104650190A (en) | Polypeptide specifically bound on surface of hepatoma carcinoma cell | |
| CN106905415B (en) | Polypeptide combined with drug-resistant cervical carcinoma cancer cell line Hela cell membrane surface molecule | |
| Lee et al. | Design, synthesis, and antimicrobial activities of novel functional peptides against Gram‐positive and Gram‐negative bacteria | |
| CN111393507B (en) | Novel polypeptide specifically bound with multiple tumor cells and application thereof | |
| CN111253472B (en) | Novel polypeptide targeting multiple tumor cells and application thereof | |
| CN105037499B (en) | It is directed to people's histamine receptor 4 using phage antibody library（HR4）Epitope mimic peptide screening and its vaccine construction method | |
| CN115260289B (en) | Inflammation colon targeting peptide and screening method thereof | |
| CN105017385B (en) | Based on simulation people's histamine receptor 4（HR4）The vaccine and its construction method of epitope | |
| CN111040019B (en) | Ligand polypeptide for specific binding with TfR protein and application thereof | |
| CN107793471B (en) | Folate receptor alpha specific binding peptide 4 and application thereof | |
| US20050266498A1 (en) | Method for screening biomolecule activity regulator | |
| CN107446021B (en) | Folate receptor alpha specific binding peptide 5 and application thereof | |
| CN115260291B (en) | Affinity polypeptide of specific affinity interleukin-10 and application thereof | |
| CN112266408B (en) | Heptapeptide specifically combined with NCL-H460 cells, encoding gene, preparation method and application | |
| CN110746489B (en) | Polypeptide for specifically targeting triple-negative breast cancer and application thereof | |
| CN103145804A (en) | Porcine parvovirus VP2 affinity peptide and coding nucleotide thereof | |
| CN115850427B (en) | Conus double-alpha helix antibacterial peptide, preparation method and application thereof | |
| CN112266407B (en) | Heptapeptide specifically combined with p53 protein, coding gene, preparation method and application | |
| CN113214360B (en) | RHAMM antagonistic polypeptide, derivative and application thereof | |
| Min-Hee et al. | Selection and characterization of peptides specifically binding to $ TiO_2 $ nanoparticles | |
| CN110317244B (en) | RAGE (receptor for activating receptor) antagonistic polypeptide and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |